run_metadata: 9676
This data as json
| rowid | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 9676 | ERR3266369 | ERX3292997 | ERS3358380 | ERP114712 | PRJEB32081 | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E-MTAB-7846 | Transcriptome Analysis | To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence. | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | sponge isl gfp negative rep2 | SAMEA5556340 | UQ | ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | E MTAB 7846:sponge isl gfp negative rep2 s | sponge isl gfp negative rep2 s | RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios. | Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative | RNA-Seq | TRANSCRIPTOMIC | PolyA | SINGLE | ILLUMINA | NextSeq 500 | ERP114712 | NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers | ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08 | E4_7neg_S9_L002_R1_001.fastq.gz | fastq | 704791838.0 | 9359668.0 | E MTAB 7846:sponge isl gfp negative rep2 lane2 | 0:75.30 1:0 | A:194317422;C:157276895;G:162624670;T:190558322;N:14529 | 75 | 0 | 194317422 | 157276895 | 162624670 | 190558322 | 14529 | ERX3292997 | ERS3358380 | ERA1822647 | European Nucleotide Archive | European Nucleotide Archive | 1 | 0.93816 | 0.08859 | 0.70999 | 0.4661 | 76 | B | usable mapping rate | illumina | nextseq | unknown | poly_a | nextera | sc | single_cell_plate | smartseq | Unknown | 2019-04-08 | Larval | Larval | Embryo Imprecise | All anatomical structures |