run_metadata: 73977

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
73977	SRR23290627	SRX19233903	SRS16638361	SRP420306	PRJNA929991	Genetic Predisposition to Neuroblastoma Results from a Regulatory Polymorphism that Promotes the Adrenergic Cell State	GSE224158	Transcriptome Analysis	Childhood neuroblastomas exhibit plasticity between an undifferentiated neural crest like “mesenchymal” cell state and a more differentiated sympathetic “adrenergic” cell state. These cell states are governed by autoregulatory transcriptional loops called core regulatory circuitries CRCs which drive the early development of sympathetic neuronal progenitors from migratory neural crest cells during embryogenesis. The adrenergic cell identity of neuroblastoma requires LMO1 as a transcriptional co factor. Both LMO1 expression levels and the risk of developing neuroblastoma in children are associated with a single nucleotide polymorphism G/T that affects a GATA motif in the first intron of LMO1. Here we showed that wild type zebrafish with the GATA genotype developed adrenergic neuroblastoma while knock in of the protective TATA allele at this locus reduced the penetrance of MYCN driven tumors which were restricted to the mesenchymal cell state. Whole genome sequencing of childhood neuroblastomas demonstrated that TATA/TATA tumors also exhibited a mesenchymal cell state and were low risk at diagnosis. Thus conversion of the regulatory GATA to a TATA allele in the first intron of LMO1 reduced the neuroblastoma initiation rate by preventing formation of the adrenergic cell state a mechanism that was conserved over 400 million yrs of evolution separating zebrafish and humans. Overall design: Ribosome depleted RNA seq in zebrafish bearing genomes with TATA/TATA or KO alleles of lmo1		pubmed:37183825		lmo1 KO MYCN 3	GSM7016831		source name:neuroblastoma\|tissue:neuroblastoma\|cell type:EGFP+ neuroblastoma cells\|genotype:d{beta}h:EGFP;MYCN;lmo1 /	lmo1 KO MYCN 3	RNA Seq reads were aligned to the danRer10 revision of the zebrafish reference genome using hisat2 version 2.1.0 PMID 31375807 in paired end mode. Reads in v90 of GRCz10 Ensembl genes were quantified using htseq count PMID 25260700 with parameters i gene name stranded=reverse m intersection strict. Expression as reads normalized by kilobase of exon per million mapped reads RPKM were calculated by counting the number of non redundant basepairs in all isoforms of each gene with the same gene name. Assembly: danRer10 Supplementary files format and content: RPKM files contain gene name read count total exon length and reads per kilobase of exon per million reads normalized values	neuroblastoma	To generate stable zebrafish lines carrying the TATA allele in the first intron of lmo1 Transcription Activator Like Effector Nuclease TALEN recognition sequences were designed to bind to the first intron of lmo1 surrounding the GATA site: TALEN1 five prime TACGACTGATTTGATTTT three prime and TALEN2 five prime TTCATTTCAAGTTCCAT three prime. TALEN expression vectors harboring a wild type FokI nuclease were generated as previously described Cade et al. Nucleic Acids Res. 2012 linearized by PmeI and used as templates for TALEN mRNA synthesis using the mMessage mMachine T3 Kit Ambion. For the targeted integration of the TATA allele a 41 nucleotide single stranded oligonucleotide containing the T allele sequence with 20 flanking nucleotides on either side of the T was designed. Equal amounts of TALEN1 and 2 mRNA 100 ng/L together with 100pg of oligonucleotide were injected together into 1 cell stage zebrafish embryos. To identify positive founder fish with a successful TATA knock in germline DNA was extracted by tail clip and the DNA fragment surrounding the TATA site was amplified by PCR and analyzed. The lmo1 knockout zebrafish line lmo1 / was generated by using CRISPR Cas9 genome editing technology targeting exon 2 Hwang et al. Nature Biotechnology 2013. The following lmo1 exon 2 CRISPR site was designed using a CRISPR Design web tool http://crispr.mit.edu: 5′ GGAGAGGGAGATCAGATCGA 3′ CRISPR gRNA was prepared by the cloning free single guide RNA synthesis method 61 using the Ambion T7 MEGAscript Kit AM1334M Ambion and purified with the Qiagen miRNeasy Kit 217004 Qiagen. Cas9 nuclease was purchased from New England Biolabs M0386T. Each embryo was injected with 1 nl of solution containing lmo1 specific gRNA 60 ng/ul and Cas9 30 ng/ul at the one cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing.	Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols.	All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. EGFP+ neuroblastoma cells were harvested from tumor bearing MYCN transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ cells were sorted.	tissue:neuroblastoma\|cell type:EGFP+ neuroblastoma cells\|genotype:d{beta}h:EGFP;MYCN;lmo1 /	GSM7016831	GSM7016831: lmo1 KO MYCN 3; Danio rerio; RNA Seq	GSM7016831 r1	GSM7016831	1	Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols.		RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	NextSeq 500		SRP420306			20171227_TT8_TT5121_S8_R1_001.fastq.gz 20171227_TT8_TT5121_S8_R2_001.fastq.gz	fastq fastq	5657754150.0	37718361.0	GSM7016831 r1	0:75 1:75	A:1447834797;C:1365984982;G:1411385887;T:1428492012;N:4056472	75	75			1447834797	1365984982	1411385887	1428492012	4056472	SRX19233903	SRS16638361	SRA1582957	Young Lab, Whitehead Institute for Biomedical Research	Young Lab, Whitehead Institute for Biomedical Research	2	0.96187	0.96571	0.04272	0.04141	0.75613	0.75943	0.54076	0.53376	75	75	B	B	biological fallback assumption	illumina	nextseq	5prime	rrna_depletion	nebnext	bulk	unknown	unknown		United States	2023-01-31	Undetermined	Embryo	Cancer or Tumor	Cancer or Tumor