run_metadata: 73976
This data as json
| rowid | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 73976 | SRR23290626 | SRX19233904 | SRS16638362 | SRP420306 | PRJNA929991 | Genetic Predisposition to Neuroblastoma Results from a Regulatory Polymorphism that Promotes the Adrenergic Cell State | GSE224158 | Transcriptome Analysis | Childhood neuroblastomas exhibit plasticity between an undifferentiated neural crest like “mesenchymal” cell state and a more differentiated sympathetic “adrenergic” cell state. These cell states are governed by autoregulatory transcriptional loops called core regulatory circuitries CRCs which drive the early development of sympathetic neuronal progenitors from migratory neural crest cells during embryogenesis. The adrenergic cell identity of neuroblastoma requires LMO1 as a transcriptional co factor. Both LMO1 expression levels and the risk of developing neuroblastoma in children are associated with a single nucleotide polymorphism G/T that affects a GATA motif in the first intron of LMO1. Here we showed that wild type zebrafish with the GATA genotype developed adrenergic neuroblastoma while knock in of the protective TATA allele at this locus reduced the penetrance of MYCN driven tumors which were restricted to the mesenchymal cell state. Whole genome sequencing of childhood neuroblastomas demonstrated that TATA/TATA tumors also exhibited a mesenchymal cell state and were low risk at diagnosis. Thus conversion of the regulatory GATA to a TATA allele in the first intron of LMO1 reduced the neuroblastoma initiation rate by preventing formation of the adrenergic cell state a mechanism that was conserved over 400 million yrs of evolution separating zebrafish and humans. Overall design: Ribosome depleted RNA seq in zebrafish bearing genomes with TATA/TATA or KO alleles of lmo1 | pubmed:37183825 | lmo1 TATATATA MYCN 1 | GSM7016832 | source name:neuroblastoma|tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;TATA/TATA | lmo1 TATATATA MYCN 1 | RNA Seq reads were aligned to the danRer10 revision of the zebrafish reference genome using hisat2 version 2.1.0 PMID 31375807 in paired end mode. Reads in v90 of GRCz10 Ensembl genes were quantified using htseq count PMID 25260700 with parameters i gene name stranded=reverse m intersection strict. Expression as reads normalized by kilobase of exon per million mapped reads RPKM were calculated by counting the number of non redundant basepairs in all isoforms of each gene with the same gene name. Assembly: danRer10 Supplementary files format and content: RPKM files contain gene name read count total exon length and reads per kilobase of exon per million reads normalized values | neuroblastoma | To generate stable zebrafish lines carrying the TATA allele in the first intron of lmo1 Transcription Activator Like Effector Nuclease TALEN recognition sequences were designed to bind to the first intron of lmo1 surrounding the GATA site: TALEN1 five prime TACGACTGATTTGATTTT three prime and TALEN2 five prime TTCATTTCAAGTTCCAT three prime. TALEN expression vectors harboring a wild type FokI nuclease were generated as previously described Cade et al. Nucleic Acids Res. 2012 linearized by PmeI and used as templates for TALEN mRNA synthesis using the mMessage mMachine T3 Kit Ambion. For the targeted integration of the TATA allele a 41 nucleotide single stranded oligonucleotide containing the T allele sequence with 20 flanking nucleotides on either side of the T was designed. Equal amounts of TALEN1 and 2 mRNA 100 ng/L together with 100pg of oligonucleotide were injected together into 1 cell stage zebrafish embryos. To identify positive founder fish with a successful TATA knock in germline DNA was extracted by tail clip and the DNA fragment surrounding the TATA site was amplified by PCR and analyzed. The lmo1 knockout zebrafish line lmo1 / was generated by using CRISPR Cas9 genome editing technology targeting exon 2 Hwang et al. Nature Biotechnology 2013. The following lmo1 exon 2 CRISPR site was designed using a CRISPR Design web tool http://crispr.mit.edu: 5′ GGAGAGGGAGATCAGATCGA 3′ CRISPR gRNA was prepared by the cloning free single guide RNA synthesis method 61 using the Ambion T7 MEGAscript Kit AM1334M Ambion and purified with the Qiagen miRNeasy Kit 217004 Qiagen. Cas9 nuclease was purchased from New England Biolabs M0386T. Each embryo was injected with 1 nl of solution containing lmo1 specific gRNA 60 ng/ul and Cas9 30 ng/ul at the one cell stage. Mosaic F0 fish with germline mutation were identified and stable mutant lines were established by outcrossing. | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer’s protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | All zebrafish studies and maintenance were done in accord with Dana Farber Cancer Institute IACUC approved protocol #02 107. EGFP+ neuroblastoma cells were harvested from tumor bearing MYCN transgenic zebrafish. Tumors were mechanically homogenized and EGFP+ cells were sorted. | tissue:neuroblastoma|cell type:EGFP+ neuroblastoma cells|genotype:d{beta}h:EGFP;MYCN;TATA/TATA | GSM7016832 | GSM7016832: lmo1 TATATATA MYCN 1; Danio rerio; RNA Seq | GSM7016832 r1 | GSM7016832 | 1 | Tumors were extractyed and EGFP+ cells were sorted. Total RNA was extracted using the QIAzol lysis reagent Qiagen and was cleaned using the RNeasy kit Qiagen. Samples were treated with the TURBO DNase TURBO DNA free Kit; Ambion and cleaned using the RNeasy MinElute Cleanup kit Qiagen.Total RNA was depleted of ribosomal RNA with the SMARTer Universal Low Input RNA Kit Clontech. Enriched mRNA was then applied to library preparation according to manufacturer's protocol NEBNext Ultra. Strand specific library construction and Illumina NextSeq 500 sequencing of paired end 100 bp long reads were performed. Library preparation quality control and next generation sequencing were conducted by the Molecular Biology Core Facility of the Dana Farber Cancer Institute following standard protocols. | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | NextSeq 500 | SRP420306 | 20171227_TT9_TT5121_S9_R1_001.fastq.gz 20171227_TT9_TT5121_S9_R2_001.fastq.gz | fastq fastq | 6123774750.0 | 40825165.0 | GSM7016832 r1 | 0:75 1:75 | A:1585035458;C:1440745361;G:1549523490;T:1544047134;N:4423307 | 75 | 75 | 1585035458 | 1440745361 | 1549523490 | 1544047134 | 4423307 | SRX19233904 | SRS16638362 | SRA1582957 | Young Lab, Whitehead Institute for Biomedical Research | Young Lab, Whitehead Institute for Biomedical Research | 2 | 0.95657 | 0.95975 | 0.05348 | 0.05262 | 0.72441 | 0.73058 | 0.54992 | 0.55373 | 75 | 75 | B | B | biological fallback assumption | illumina | nextseq | 5prime | rrna_depletion | nebnext | bulk | unknown | unknown | United States | 2023-01-31 | Undetermined | Embryo | Cancer or Tumor | Cancer or Tumor |