run_metadata: 70582

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
70582	SRR20001185	SRX16042033	SRS13721701	SRP385134	PRJNA856272	Synonymous codon massive reporter library in zebrafish embryos	GSE207584	Transcriptome Analysis	Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.		pubmed:35840631		zf library 8h 3	GSM6300339		source name:Zebrafish embryo\|tissue:Zebrafish embryo\|time point:8h\|genotype:WT\|treatment:Injected zebrafish embryos	zf library 8h 3	Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing	Zebrafish embryo	10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection	Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.		tissue:Zebrafish embryo\|time point:8h\|genotype:WT\|treatment:Injected zebrafish embryos	GSM6300339	GSM6300339: zf library 8h 3; Danio rerio; OTHER	GSM6300339 r1	GSM6300339	1	Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.		OTHER	TRANSCRIPTOMIC	other	PAIRED	ILLUMINA	Illumina MiSeq		SRP385134			zf_library_8h_3_1.fastq.gz zf_library_8h_3_2.fastq.gz	fastq fastq	885299088.0	1763544.0	GSM6300339 r1	0:251 1:251	A:222214043;C:219331579;G:228248922;T:215275916;N:228628	251	251			222214043	219331579	228248922	215275916	228628	SRX16042033	SRS13721701	SRA1449828	Stowers Institute for Medical Research	Stowers Institute for Medical Research	2	0.0	0.0	0.0	0.0	1.0	1.0			251	251	T	T	mates < 9% mapping rate	illumina	miseq	unknown	poly_a	unknown	bulk	unknown	unknown		United States	2022-07-06	Undetermined	Embryo	Embryo Imprecise	All anatomical structures