run_metadata: 68289
This data as json
| rowid | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 68289 | SRR099360 | SRX041570 | SRS172420 | SRP005640 | PRJNA79973 | Zebrafish Development | 4432-2WA | Other | Sample from publication: Determinism and Stochasticity during Maturation of the Zebrafish Antibody Repertoire. Authors: Jiang Weinstein Penland White Fish and Quake. | pubmed:21393572 | Immunoglobulin heavy chain cDNA from 3 mpf WIK zebrafish Danio rerio leading with MID barcode CTCGCGTGTC or with no barcode leading with either IgM reverse primer TGCACTGAGACAAACCGAAG or IgZ reverse primer TCAGAGGCCAGACATCCAAT | 4433 3MA DT | 4433 3MA DT | 1 | 4433 3MA DT | Zebrafish WIK | Standard Roche 454 GS Titanium shotgun library protocol was followed. | AMPLICON | TRANSCRIPTOMIC | PCR | SINGLE | LS454 | 454 GS FLX Titanium | <SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR> | SRP005640 | 56064850.0 | 187695.0 | 4433 3MA DT | 0:4 1:294.70 | 4 | 294 | SRX041570 | SRS172420 | SRA029829 | Stanford University|Quake | Stanford University | 1 | 0.3144 | 0.00306 | 0.99987 | 0.0 | 106 | B | usable mapping rate | legacy | early | unknown | random_priming | unknown | bulk | other_seq | 454 | United States | 2011-04-07 | Adult | Adult | BCR TCR repertoire | Hematopoietic System |