run_metadata: 62644

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
62644	SRR13297052	SRX9725961	SRS7919278	SRP299151	PRJNA686149	Transcriptionally regulated energy metabolism drives early erythropoiesis tif1g RNA seq	GSE163453	Transcriptome Analysis	Transcription and metabolism both influence cell function yet dedicated transcriptional control of metabolic pathways that regulate cell fate has rarely been defined. Through a chemical suppressor screen we discovered that inhibition of the pyrimidine biosynthesis enzyme DHODH rescues erythroid differentiation in bloodless moonshine mutant embryos defective for the transcription elongation factor tif1?. This rescue depends on the functional link of DHODH to mitochondrial respiration. Low a ketoglutarate levels caused by tif1? loss lead to histone hypermethylation. TIF? directly controls coenzyme Q synthesis gene expression and coenzyme Q levels are reduced in moonshine mutants. A coenzyme Q analogue rescues moonshine's bloodless phenotype. These results demonstrate mitochondrial metabolism is a key output of a lineage transcription factor that drives cell fate decisions in the early blood lineage. Overall design: tif1? ENSDART00000020116.9/NM 001002871.2 was knocked down tif1? KD by injecting 1 ng of an ATG blocking morpholino Gene Tools five prime?three prime morpholino sequence ATCTTGGCCTTTGTTGTCCGCCATC into zebrafish wild type TU embryos at the 1 2 cell stage. As a control Ctrl KD 1 ng of a Standard Control oligo designed by Gene Tools five prime?three prime morpholino sequence CCTCTTACCTCAGTTACAATTTATA was injected into zebrafish embryos at the 1 2 cell stage. tif1? KD and Ctrl KD embryos from each clutch were split in half and treated with either 7 µM leflunomide or the equivalent amount of DMSO from 5.3 hpf until 10 hpf when embryos were harvested for RNA seq by snap freezing them.	parent bioproject:PRJNA562552	pubmed:33986176		TU + tif1γ KD + DMSO tailbud stage replicate #3	GSM4979511		source name:Whole zebrafish embryos at 10 hpf = tailbud stage\|tissue:Whole body\|genotype/variation:TU + tif1<gamma> KD\|treatment:DMSO\|developmental stage:10 hpf = tailbud stage	TU + tif1γ KD + DMSO tailbud stage replicate #3	Step 1: Quality control of RNA Seq datasets was performed by FastQC and Cutadapt to remove adaptor sequences and low quality regions. Step 2: The high quality reads were aligned to Ensembl genome assembly GRCz11 using Tophat 2.0.11 without xxx splicing form calls. Step 3: Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. Step 4: FPKM values were used to normalize and quantify each transcripts; the resulting list of differential expressed genes are filtered by log2 fold change > 2 and q value < 0.05. Genome build: Ensembl GRCz11 Supplementary files format and content: 170104 7001405 0663 AH722FBCXY.htseq count.out.txt: Fragments Per Kilobase of transcript per Million mapped reads FPKM files contain gene names and FPKM values.	Whole zebrafish embryos at 10 hpf = tailbud stage	tif1γ KD and Ctrl KD embryos were treated with 7 µM leflunomide or the equivalent amount of DMSO from 5.3 hpf until 10 hpf when embryos were harvested by snap freezing them.	109 snap frozen embryos of each genotype and treatment group in triplicate were homogenized in 700 µl TRIzol Invitrogen/Thermo Fisher Scientific 15596026 using a tissue homogenizer with hard tissue Omni tip plastic homogenizing probes Omni International 30750H. 300 µl TRIzol was added and the samples transferred into a pre spun 16 000 x g 30 s room temperature 2 ml 5PRIME Phase Lock Gel Heavy tube Quantabio 2302830. post addition of 200 µl chloroform Sigma Aldrich C2432 the tube was vigorously inverted for 15 sec incubated at room temperature for 3 min and spun at 12 000 x g for 15 min at 4°C. The supernatant was transferred into a RNase free 1.7 ml tube. 300 µl buffer saturated phenol Invitrogen/Thermo Fisher Scientific 15513039 and 300 µl chloroform were added the samples vortexed for 15 sec and incubated and spun as before. The supernatant was transferred into a fresh RNase free 1.7 ml tube 600 µl chloroform added the samples were vortexed incubated and spun as before. The supernatant was transferred into a fresh RNase free 1.7 ml tube 600 µl 2 propanol VWR BDH1133 was added the samples were inverted 10 times and stored at 80°C overnight. Samples were spun at 17 000 x g for 30 min at 4°C and the supernatant was pipetted off. Samples were handled on ice from now on. Samples were washed three times with 1000 µl 75% ethanol in nuclease free water Invitrogen/Thermo Fisher Scientific AM9937 followed by spinning at 17 000 x g for 5 min at 4°C. post the final wash samples were air dried and resuspended in 50 µl nuclease free water. 5 µg of RNA was DNase treated with the TURBO DNA free Kit Ambion AM1907 as per the manufacturer’s protocol in a volume of 50 µl for 30 min at 37°C. Instead of adding the DNase Inactivation Reagent the reaction was cleaned up using RNAClean XP SPRI paramagnetic beads Beckman Coulter A63987 following the manufacturer’s instructions. The final elution volume was 48 µl. 1.5 µg DNase treated RNA samples were spiked with ERCC ExFold RNA Spike In Mixes Thermo Fisher Scientific 4456739 as per the manufacturer’s protocol. Ribosomal RNAs were removed with the Ribo Zero Magnetic Gold Kit Illumina MRZG12324 and strand specific libraries were prepared with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina NEB E7420 and NEBNext Multiplex Oligos for Illumina NEB E7335 all according to the manufacturer’s protocols. For quality control and pooling purposes the final libraries were run on a high sensitivity DNA chip Agilent 5067 46426 on the Agilent 2100 Bioanalyzer. The average library size was 265 bp. Libraries were sequenced on the Illumina HiSeq 4000.	Zebrafish embryos were grown in embryo medium E3 at 28.5°C water temperature as per standard protocols.	tissue:Whole body\|genotype/variation:TU + tif1<gamma> KD\|treatment:DMSO\|developmental stage:10 hpf = tailbud stage	GSM4979511	GSM4979511: TU + tif1γ KD + DMSO tailbud stage replicate #3; Danio rerio; RNA Seq	GSM4979511		1	109 snap frozen embryos of each genotype and treatment group in triplicate were homogenized in 700 µl TRIzol Invitrogen/Thermo Fisher Scientific 15596026 using a tissue homogenizer with hard tissue Omni tip plastic homogenizing probes Omni International 30750H. 300 µl TRIzol was added and the samples transferred into a pre spun 16 000 x g 30 s room temperature 2 ml 5PRIME Phase Lock Gel Heavy tube Quantabio 2302830. post addition of 200 µl chloroform Sigma Aldrich C2432 the tube was vigorously inverted for 15 sec incubated at room temperature for 3 min and spun at 12 000 x g for 15 min at 4°C. The supernatant was transferred into a RNase free 1.7 ml tube. 300 µl buffer saturated phenol Invitrogen/Thermo Fisher Scientific 15513039 and 300 µl chloroform were added the samples vortexed for 15 sec and incubated and spun as before. The supernatant was transferred into a fresh RNase free 1.7 ml tube 600 µl chloroform added the samples were vortexed incubated and spun as before. The supernatant was transferred into a fresh RNase free 1.7 ml tube 600 µl 2 propanol VWR BDH1133 was added the samples were inverted 10 times and stored at 80°C overnight. Samples were spun at 17 000 x g for 30 min at 4°C and the supernatant was pipetted off. Samples were handled on ice from now on. Samples were washed three times with 1000 µl 75% ethanol in nuclease free water Invitrogen/Thermo Fisher Scientific AM9937 followed by spinning at 17 000 x g for 5 min at 4°C. post the final wash samples were air dried and resuspended in 50 µl nuclease free water. 5 µg of RNA was DNase treated with the TURBO DNA free Kit Ambion AM1907 as per the manufacturer's protocol in a volume of 50 µl for 30 min at 37°C. Instead of adding the DNase Inactivation Reagent the reaction was cleaned up using RNAClean XP SPRI paramagnetic beads Beckman Coulter A63987 following the manufacturer's instructions. The final elution volume was 48 µl. 1.5 µg DNase treated RNA samples were spiked with ERCC ExFold RNA Spike In Mixes Thermo Fisher Scientific 4456739 as per the manufacturer's protocol. Ribosomal RNAs were removed with the Ribo Zero Magnetic Gold Kit Illumina MRZG12324 and strand specific libraries were prepared with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina NEB E7420 and NEBNext Multiplex Oligos for Illumina NEB E7335 all according to the manufacturer's protocols. For quality control and pooling purposes the final libraries were run on a high sensitivity DNA chip Agilent 5067 46426 on the Agilent 2100 Bioanalyzer. The average library size was 265 bp. Libraries were sequenced on the Illumina HiSeq 4000.	GEO Accession:GSM4979511	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 4000		SRP299151			MR-11_GGCTAC_L001_R1_001.fastq.gz MR-11_GGCTAC_L001_R2_001.fastq.gz	fastq fastq	2740296800.0	13701484.0	GSM4979511 r1	0:100 1:100	A:726668062;C:638808792;G:649464189;T:725160579;N:195178	100	100			726668062	638808792	649464189	725160579	195178	SRX9725961	SRS7919278	SRA1177432	GEO	Oncology/Hematology, Boston Children's Hospital	2	0.89218	0.89804	0.31739	0.32027	0.73158	0.73446	0.47188	0.463	100	100	B	B	biological fallback assumption	illumina	hiseq_era	unknown	rrna_depletion	nebnext	bulk	unknown	unknown		United States	2020-12-17	Gastrula	Embryo	Trunk	Surface Structure