run_metadata: 61902

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
61902	SRR13074856	SRX9521899	SRS7729106	SRP292929	PRJNA678983	Reactive oligodendrocyte progenitor cells re myelinate the regenerating zebrafish spinal cord [Single cell]	GSE161642	Transcriptome Analysis	Spinal cord injury SCI results in loss of neurons oligodendrocytes and myelin sheaths all of which are not efficiently restored. The scarcity of oligodendrocytes in the lesion site impairs remyelination of spared fibres which leaves axons denuded impedes signal transduction and contributes to permanent functional deficits. In contrast to mammals zebrafish can functionally regenerate the spinal cord. Yet little is known about oligodendroglial lineage biology and remyelination capacity post SCI in a regeneration permissive context. Here we report that in adult zebrafish SCI results in axonal oligodendrocyte and myelin sheath loss. We find that OPCs the oligodendorocyte progenitor cells survive the injury enter a reactive state proliferate and differentiate into oligodendrocytes. Concomitantly the oligodendrocyte population is re established to pre injury levels within two weeks.Transcriptional profiling revealed that reactive OPCs upregulate the expression of several myelination related genes. Interestingly global reduction of axonal tracts and partial re myelination relative to pre injury levels persist at later stages of regeneration yet suffices for functional recovery. Taken together these findings imply that in the zebrafish spinal cord OPCs replace lost oligodendrocytes and thus re establish myelination during regeneration. Overall design: Single cell transcriptome of reactive olig2:eGFP+ OPCs from the zebrafish spinal cord at 7 days post lesion dpl and sham controls.	parent bioproject:PRJNA679077	pubmed:33158923		SHAM.1X 01 C03	GSM4911695		source name:OPC\|age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:sham control	SHAM.1X 01 C03	Basecalls were performed using Illumina bcl2fastq version 2.19.1. Reads were aligned to the zebrafish genome assembly GRCz10 using GSNAP 2018 05 30; parameters: gunzip A sam t 14 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 N 0 n 1 s EnsemblGene 87.ss.GRCz10.iit with known splice sites from Ensembl v87 as support. Uniquely aligned fragments and gene annotations from Ensembl v87 were used for featureCounts v1.6.2 parameters: a EnsemblGene 87.GRCz10.TR.gtf s 0 Q 1 T 8 to obtain a table with read counts per gene. Genome build: GRCz10 Supplementary files format and content: Tab delimited counts table from featureCounts bfx1011.GRCz10.e87.txt.gz with the following columns: Ensembl Gene ID Chromosome Gene Start Gene End Gene Length then all sample counts; comments start with '#'	OPC	Adult fish were anaesthetized by immersion in 0.25 % w/vol Tricaine Sigma Aldrich and the spinal cord was transected under visual control 5 mm caudal to the brainstem spinal cord junction as previously described Becker et al. 1997 . Sham lesioned fish were treated equally except that the spinal cord was left intact.	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks’ Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al. 2013 Picelli et al. 2013. Briefly either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 μl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB spun down and frozen at ‑80 °C. post thawing the samples 2 μl of a primer mix was added. RNA was then denatured for 3 minutes at 72 °C and the reverse transcription was performed at 42 °C for 90 min post filling up to 10 μl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 °C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 μM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 μl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation 700 pg cDNA in 2 μl were mixed with 0.5 μl Tagment DNA Enzyme 2.5 μl Tagment DNA Buffer Nextera Illumina and tagmented at 55 °C for 5 min. Subsequently Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 μM dual indexing primers. post PCR libraries were quantified with AccuBlue Broad range chemistry equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.		age:adult\|genotype:Tgolig2:eGFP\|tissue:spinal cord\|cell type:olig2:eGFP+ OPCs\|treatment:sham control	GSM4911695	GSM4911695: SHAM.1X 01 C03; Danio rerio; RNA Seq	GSM4911695		1	Adult fish were terminally anesthetized in 0.1 % w/vol Tricaine Sigma Aldrich in E3 solution with 10 5 % v/v methylene blue. The skin and musculature were removed dorsally until the spinal cord was exposed and carefully removed with fine forceps. Extracted tissue was placed on a microscope scale slide # 474026 Carl Zeiss and starting from the lesion site a 0.5 mm piece was cut from the rostral part with a scalpel. For sham control group a 0.5 mm tissue was dissected at the same area of the spinal cord along the rostral to caudal axis of the fish. 9 spinal cords 0.5 mm pieces were used per group and placed in 1ml of sterile Hanks' Buffered Salt Solution HBSS Gibco. Before tissue dissociation spinal cords were kept constantly on ice to avoid cell degradation. Tissue dissociation live cell staining and FACS sorting of cells was done with modifications using an unpublished protocol developed by the Brand lab D. Freudenreich A. Weber M. Brand unpublished available on request from M.B. and Lange et al. 2020. Briefly excised tissue was dissociated with the Neural Tissue Dissociation Kit # 130 092 628 Miltenyi by incubating for 15 min at 37 °C in dissociation buffer. Tissue digestion was stopped by the addition of 30 µL of Papain inhibitor triturated with 10 strokes of a wide tipped fire polished Pasteur pipette and incubated at 37 °C for 10 min. post 2 more trituration steps with 10 strokes of a middle and small tipped fire polished Pasteur pipette respectively and incubation for 10 min at 37 °C cell suspension was applied to a 20 µm cell strainer BD Biosciences mounted on a 15 ml falcon tube. post washing with 10 ml of sterile HBSS cell suspension was pelleted by centrifugation at 300g for 10 min at room temperature. The supernatant was discarded and the pellet was re suspended in 500 μl fresh sterile HBSS. To stain for viable cells 1 µl of 2 mM Calcein AM cell permeant dye C1429 Invitrogen was added to the cell suspension. Cell suspension was protected from light and incubated for 10 min at room temperature until fluorescence activated cell sorting. RNAseq was based on Smart seq2 sensitive full length transcriptome profiling and modified from Picelli et. al. 2013 Picelli et al. 2013. Briefly either cells from Tgolig2:eGFP+ fish were FACsorted into single wells of a 96 well plate containing 2 μl of nuclease free water with 0.2 % v/v Triton X 100 and 4 U murine RNase Inhibitor NEB spun down and frozen at ‑80 °C. post thawing the samples 2 μl of a primer mix was added. RNA was then denatured for 3 minutes at 72 °C and the reverse transcription was performed at 42 °C for 90 min post filling up to 10 μl with reverse transcription buffer mix. The reverse transcriptase was inactivated at 70 °C for 15 min and the cDNA was amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 μM UP primer UP primer:AAGCAGTGGTATCAACGCAGAGT . The amplified cDNA was then purified using 1x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare and DNA was eluted in 12 μl nuclease free water. The concentration of the samples was measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium. For library preparation 700 pg cDNA in 2 μl were mixed with 0.5 μl Tagment DNA Enzyme 2.5 μl Tagment DNA Buffer Nextera Illumina and tagmented at 55 °C for 5 min. Subsequently Illumina indices were added during PCR with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.7 μM dual indexing primers. post PCR libraries were quantified with AccuBlue Broad range chemistry equimolarly pooled and purified twice with 1x volume Sera Mag SpeedBeads.	GEO Accession:GSM4911695	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	NextSeq 500		SRP292929			L31798_Track-65475_R1.fastq.gz	fastq	31934972.0	420197.0	GSM4911695 r1	0:76 1:0	A:8769567;C:7288144;G:7242972;T:8633980;N:309	76	0			8769567	7288144	7242972	8633980	309	SRX9521899	SRS7729106	SRA1160306	GEO	Brand, Center for Molecular and Cellular Bioengineering (CMCB), TU Dresden	1	0.83696		0.07569		0.94564		0.40838		76		B		usable mapping rate	illumina	nextseq	full_length	cdna_unspecified	nextera	sc	single_cell_plate	smartseq		Germany	2020-11-17	Adult	Adult	Spinal Cord	Nervous System