run_metadata: 59363
This data as json
| rowid | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 59363 | SRR11869114 | SRX8419211 | SRS6730783 | SRP265148 | PRJNA635675 | Transcriptome comparison of wild type and tnnt2a MO zebrafish hearts | GSE151398 | Transcriptome Analysis | We performed RNA seq analyses to characterize transcriptomic changes in non beating tnnt2a morphant compared to wild type hearts. Overall design: Cardiac mRNA profile of wild type and tnnt2a morphant zebrafish hearts at 54 hpf. | pubmed:32668254 | tnnt2aMO zebrafish heart rep3 | GSM4577250 | source name:Hearts|genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | tnnt2aMO zebrafish heart rep3 | BCL files were converted to FASTQ files using bcl2fastq Conversion Software version Illumina. The FASTQ files were adapter and quality trimmed using Trim Galore! version 0.4.1 with default settings as described in the User Guide except for the setting of the quality cutoff q/ quality which was set to a Phred score of 15. Trim Galore! used Cutadapt version 1.9.1 as subroutine. Quality control of FASTQ files was performed by FastQC version 0.11.4 before and post trimming. post trimming FASTQ files were mapped against a reference genome with the splice aware aligner STAR version 2.5.0c to generate BAM files. The BAM files were built in a 2 pass Mapping twopassMode Basic and were finally sorted outSAMtype BAM SortedByCoordinate. All other settings have been left as default as described in the manual. Genome build: The genome index files were created by STAR with default settings using Danio rerio sequence and annotation data Ensembl build GRCz10 available on Illumina’s iGenome site http://support.illumina.com/sequencing/sequencing software/igenome.html. Supplementary files format and content: The mapped data was assembled and quantified per sample with the Cufflinks suite version 2.2.1. The Cufflinks assemblies were merged with Cuffmerge and differential expression analysis was performed with Cuffdiff setting up labels 'control' 'sih' for the two conditions and the bam files of samples S1 S2 S3 condition 1 and S4 S5 S6 condition 2 respectively Supplementary files format and content: Excel file generated as output indicates the mean value for each gene of 'control' and 'sih'; P value and Q value. | Hearts | tnnt2a morphant hearts were obtained by injecting tnnt2a morpholino 5’ CATGTTTGCTCTGATCTGACACGCA 3’ 1 ng/1 cell stage embryo | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | Zebrafish embryos were kept under standard conditions 28°C temperature in E3 medium until 54 hpf | genotype/variation:tnnt2a morpholino injection|tissue:Cardiac tissue|developmental stage:54 hpf | GSM4577250 | GSM4577250: tnnt2aMO zebrafish heart rep3; Danio rerio; RNA Seq | GSM4577250 | 1 | ∼100 hearts/replicate were extracted from 54 hpf WT and tnnt2a morphant embryos as previously described Lombardo et al. 2015. Hearts were pooled for each condition three biological replicates and total RNA was extracted with Trizol Sigma Aldrich using Phase Lock Gel Heavy tubes 1.5 mL Prime 5. cDNA libraries were prepared starting from 100 ng of RNA/replicate using “TruSeq Stranded Total RNA Sample Preparation Kit” Low Sample Protocol Ilumina. The fragment length distribution of generated libraries was monitored and the quantification was performed using the D1000 ScreenTape System Agilent Technologies. Equal molar amounts of individual libraries were pooled denatured with NaOH and diluted to 1.5pM. | GEO Accession:GSM4577250 | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | NextSeq 500 | SRP265148 | 6-sih-_S6_L001_R1_001.fastq.gz | fastq | 1247812004.0 | 16418579.0 | GSM4577250 r1 | 0:76 1:0 | A:274962956;C:222410755;G:449925631;T:300488475;N:24187 | 76 | 0 | 274962956 | 222410755 | 449925631 | 300488475 | 24187 | SRX8419211 | SRS6730783 | SRA1080949 | GEO | University of Potsdam | 1 | 0.87122 | 0.18371 | 0.75692 | 0.61687 | 76 | B | usable mapping rate | illumina | nextseq | unknown | cdna_unspecified | trueseq | bulk | unknown | unknown | Germany | 2020-05-28 | Hatching | Embryo | Heart | Cardiovascular System |