run_metadata: 57074

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
57074	SRR11214395	SRX7826907	SRS6238042	SRP251256	PRJNA609696	Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq]	GSE146200	Transcriptome Analysis	Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.	parent bioproject:PRJNA609691	pubmed:28962522		JD11 [miRNA seq]	GSM4368075		source name:30 pooled larvae 5dpf triptolide for 6 h\|strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	JD11 [miRNA seq]	The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw "tag counts" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; "abundance normalised" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.	30 pooled larvae 5dpf triptolide for 6 h	5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	Zebrafish Danio rerio were maintained at 28.5 °C	strain:WIK\|developmental stage:5dpf\|treatment:triptolide 1.6μM for 6 h\|tissue:30 pooled larvae\|molecule subtype:small RNA	GSM4368075	GSM4368075: JD11 [miRNA seq]; Danio rerio; ncRNA Seq	GSM4368075		1	Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.	GEO Accession:GSM4368075	ncRNA-Seq	TRANSCRIPTOMIC	size fractionation	SINGLE	ILLUMINA	NextSeq 550		SRP251256			small_JD11.combined.fastq.gz	fastq	323802250.0	6476045.0	GSM4368075 r1	0:50 1:0	A:78153815;C:77052322;G:87557986;T:81035226;N:2901	50	0			78153815	77052322	87557986	81035226	2901	SRX7826907	SRS6238042	SRA1049684	GEO	Centre for Immunity, Infection and Evolution	1	0.06809		0.00424		0.99368		0.52229		50		B		usable mapping rate	illumina	nextseq	unknown	size_fractionation	trueseq	bulk	bulk	bulk		United States	2020-03-02	Larval	Larval	Whole Organism	All anatomical structures