RNAquarium Metadata Server
Institute Website Terms of Use Privacy Policy

run_metadata: 55264

This data as json

rowid run.accession experiment.accession sample.accession study.accession bioproject study.title study.alias study.type study.abstract study.attributes study.PMIDs sample.description sample.title sample.alias sample.centername sample.attributes GEOsample.title GEOsample.dataprocessing GEOsample.source GEOsample.treatmentprotocol GEOsample.extractprotocol GEOsample.growthprotocol GEOsample.characteristics GEOsample.accession experiment.title experiment.alias experiment.library_name experiment.design_description experiment.library_construction_protocol experiment.attributes experiment.library_strategy experiment.library_source experiment.library_selection experiment.library_layout experiment.platform experiment.instrument_model experiment.spot_descriptor experiment.study_ref run.title run.attributes run.filename run.semantic_name run.total_bases run.total_spots run.alias run.read_lengths run.base_counts run.r1_length run.r2_length run.r3_length run.r4_length run.Acount run.Ccount run.Gcount run.Tcount run.Ncount run.experiment run.pool_member submission.accession submission.srasource submission.bioprojectsource seqdetective.n_mates seqdetective.mapping_rate.mate1 seqdetective.mapping_rate.mate2 seqdetective.nofeature_rate.mate1 seqdetective.nofeature_rate.mate2 seqdetective.sparsity.mate1 seqdetective.sparsity.mate2 seqdetective.pos_strand_rate.mate1 seqdetective.pos_strand_rate.mate2 seqdetective.readlen.mate1 seqdetective.readlen.mate2 seqdetective.judgement.mate1 seqdetective.judgement.mate2 seqdetective.judgement.reason platform_family instrument_generation read_bias selection_class prep_kit sc_or_bulk tech_class technology tech_variant submission.bioprojectsource.country earliest_date devstage_curation devstage_curation_coarse tissue_curation tissue_curation_coarse
55264 SRR10210692 SRX6930433 SRS5460728 SRP223875 PRJNA575225 Biliary Atresia associated Mannosidase 1 alpha 2 gene regulates biliary and ciliary morphogenesis and laterality zebrafish GSE138251 Transcriptome Analysis The effect of MAN1A2 on biliary morphogenesis left right patterning and ciliogenesis was evaluated with knockdown in zebrafish and subsequent RNAseq experiment/analysis. Overall design: Total RNA sequencing protocol was performed on pooled liver tissue from all three batches one from controls and one from man1a2 morphant zebrafish. Each pool consisted of 100 livers from three batches of zebrafish larvae at 5 dpf   pubmed:33192543   Pooled MAN1A2 RNA seq GSM4103428   source name:liver tissue|tissue:liver|condition:MAN1A2 knockdown|developmental stage:Larvae at 5 dpf Pooled MAN1A2 RNA seq The quality of the sequencing reads was verified using FastQC. Omicsoft Sequence Aligner 2 was used to align the sequencing reads to Zebrafish genome. DEseq2 R package for RNAseq data was used for differential analysis. Genome build: GRCz10 Supplementary files format and content: For each processed data file there are 2 columns: the first column being Ensembl gene ID and the second column being raw read counts. liver tissue arf6 ATG MO 5’ GATCTTGGAAAGCATCTTCCCCATG 3’ man1a2 ATG MO 5’ CCGGCGTGGTCATATTTTGATGATC 3’ and man1a2 splicing MO 5’ AAGAATGTAAACTCACCTCTCTGAT 3’ were purchased from Gene Tools LLC. Embryos were injected at the one cell stage with man1a2 ATG MO 1.5 or 4.5 ng man1a2 splicing MO 5 or 7.5 ng or arf6 ATG MO 0.5 ng. Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. Embryos and adult fish were raised and maintained under standard laboratory conditions. We used the following transgenic lines: Tgdusp6:d2EGFPpt6 10 Tgkrt18:EGFPp314 11 TgEPV.Tp1 Mmu.Hbb:EGFPum14 12 TgEPV.Tp1 Mmu.Hbb:hist2h2l mCherrys939 13 and Tgfabp10a:DsRed ela3l:EGFPgz15 14 [the last three referred to here as TgTp1:GFP TgTp1:H2B mCherry and Tgfabp10a:DsRed respectively]. tissue:liver|condition:MAN1A2 knockdown|developmental stage:Larvae at 5 dpf GSM4103428 GSM4103428: Pooled MAN1A2 RNA seq; Danio rerio; RNA Seq GSM4103428   1 Total RNA was extracted from three different batches of 100 livers of uninjected control and man1a2 MO injected larvae at xxx dpf by using RNeasy Mini Kit. The pooled RNA was used to generate mRNA sequencing libraries using Illumina TruSeq Stranded mRNA sample preparation kit. Poly A containing mRNA molecules were purified using poly T oligo attached magnetic beads mRNA fragmented into small pieces using divalent cations and copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by using dUTP in the Second Strand Marking Mix followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. These cDNA fragments were ligated to single 'A' base and adapter then purified and enriched with PCR to create the final cDNA libraries. GEO Accession:GSM4103428 RNA-Seq TRANSCRIPTOMIC cDNA PAIRED ILLUMINA NextSeq 500   SRP223875     dr_man1a2_m_S16_all_R1_001.fastq.gz dr_man1a2_m_S16_all_R2_001.fastq.gz fastq fastq 5936191400.0 29680957.0 GSM4103428 r1 0:100 1:100 A:1578413598;C:1390775252;G:1427068571;T:1535244145;N:4689834 100 100     1578413598 1390775252 1427068571 1535244145 4689834 SRX6930433 SRS5460728 SRA970723 GEO Systems Biology, Bioengineering, UCSD 2 0.95924 0.8982 0.03926 0.03468 0.79622 0.80925 0.49947 0.48222 100 100 B B biological fallback assumption illumina nextseq unknown poly_a trueseq bulk unknown unknown   United States 2019-10-01 Larval Larval Liver Liver and Biliary System