run_metadata: 52815

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
52815	SRR9211487	SRX5982378	SRS4887883	SRP200656	PRJNA547573	Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos	GSE132304	Transcriptome Analysis	We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.		pubmed:31431477		52 hpf nonskin1 replicate B	GSM3855895		source name:FACS isolated nonskin cells from whole embryos\|strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS nonskin1\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	52 hpf nonskin1 replicate B	Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.	FACS isolated nonskin cells from whole embryos	Transgenic embryos without xxx treatment	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.	strain:AB+TU\|developmental stage:52 hpf\|tissue:FACS nonskin1\|Sex:pooled male and female\|biomaterial provider:Fang Wang CSUDH\|birth location:UCLA\|genotype:krt4:DsRed	GSM3855895	GSM3855895: 52 hpf nonskin1 replicate B; Danio rerio; RNA Seq	GSM3855895		1	Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.	GEO Accession:GSM3855895	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2500		SRP200656			ZFishSkin_Reads_c06_52hpf-nonskin1_repB_i01.ATCACGA.pf1_XB039L2.fastq.gz	fastq	2006001000.0	40120020.0	GSM3855895 r1	0:50	A:519738512;C:486660134;G:481964980;T:517604839;N:32535	50				519738512	486660134	481964980	517604839	32535	SRX5982378	SRS4887883	SRA894819	GEO	UCLA	1	0.9459		0.07046		0.68389		0.48047		50		B		usable mapping rate	illumina	hiseq_era	unknown	poly_a	trueseq	bulk	unknown	unknown		United States	2019-06-06	Hatching	Embryo	Skin	Surface Structure