run_metadata: 43776

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
43776	SRR6113348	SRX3228186	SRS2552753	SRP119063	PRJNA412499	Analysis of gene expression changes by knock down of hace1 tumour suppressor in zebrafish	GSE104380	Transcriptome Analysis	Background: In this study we reveal a previously undescribed role of the HACE1 HECT domain and Ankyrin repeat Containing E3 ubiquitin protein ligase 1 tumor suppressor protein in normal vertebrate heart development using the zebrafish Danio rerio model. We examined the link between the cardiac phenotypes associated with hace1 loss of function to the expression of the Rho small family GTPase rac1 which is a known target of HACE1 and promotes ROS production via its interaction with NADPH oxidase holoenzymes. We examined expression changes induced by knock down of hace1 in zebrafish at 48 hpf the stage when heart abnormalities are observed. This was done by collecting duplicate samples of control and hace1 morphant embryos and performing RNA sequencing on them. Conclusions: Our study demonstrates that HACE1 is critical in the normal development and proper function of the heart via a ROS dependent mechanism. Overall design: 2 samples of control and hace1 morphant zebrafish embryos at 48 hpf were analyzed		pubmed:29024245		48 hpf control MO injected sample B	GSM2796625		tissue:whole embryos\|morpholino:control\|strain:Tubingen\|Stage:48 hpf	48 hpf control MO injected sample B	Torrent Suite 4.2.1 used for basecalling Trimming with Cutadapt v1.2.1 Second pass trimming with home made script in order to remove reads shorter than 17bp and larger than 300bp and Q<20 2 steps alignement for RNA with tophat v2.0.6 and bowtie2 v2.0.2 Quantification and normalization with StrandNGS Version 2.1 with the following settings Strand specific reads: false Consider partial reads: true Max EM Iterations: 1000 Convergence criterion for EM: 0.0010 Normalization Type = DeSeq Threshold for normalization = 1 Baseline type = median of all samples Genome build: Danio rerio Zv9 78 Transcripts 2015.01.22 Supplementary files format and content: tab delimited text files include normalised values or raw counts for each sample	whole embryos	The hace1 HECT 5’ CCCTCGAACTGTTAGACAGAATAAA 3’ and standard control morpholinos 5’ CCTCTTACCTCAGTTACAATTTATA 3’ were purchased from Genetools LLC Philomath OR. The hace1 morpholino splice site resides within the catalytically active HECT domain upstream of the critical cysteine residue required for hace1 ubiquitin ligase function. Knockdown of hace1 was verified by RT PCR as described in Daugaard et al Daugaard et al. 2013.	TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.	Zebrafish housing breeding conditions and developmental staging of larvae were performed according to Westerfield Westerfield 2000. Use of zebrafish in this study was approved by the Dalhousie University Committee on Laboratory Animals Protocol 15 123. All zebrafish embryos were maintained in E3 embryo medium 5 mM NaCl 0.17 mM KCl 0.33 mM CaCl2 0.33 mM MgSO4 in 10 cm Petri dishes at 28oC.	morpholino:control\|strain:Tubingen\|Stage:48 hpf	GSM2796625	GSM2796625: 48 hpf control MO injected sample B; Danio rerio; RNA Seq	GSM2796625		1	TRIzol Reagent RNA Extraction protocol Ambion RNA Life technologies was used to extract RNA from pooled samples of hace1 or control morphants n=6 per group. Approximately 100 embryos per sample were used. Tubingen wild type strain TU fish were previously injected with either hace1 MO or control MO using the injection protocol noted above. RNA samples were quantified using the NanoDrop Spectrophotometer ND 1000 Thermo Fisher Scientific Wilmington DE. RNA yields for this experiment were lower than the 100µg of RNA needed for RNA sequencing so 3 samples were pooled into one for a final n=2 for each of the hace1 MO and control MO groups. Barcoded cDNA libraries were prepared using RNA Seq Version 2 kit from Life Technologies following their recommended protocol. Library preparations were assayed for both quality control and quantity using Experion DNA 1K chip Life Technologies and diluted to 16 pM concentration. Samples were sequenced using a Proton Sequencer from Life Technologies on a PI chip following the manufacturer recommended protocol. Each chip was loaded with 2 samples.	GEO Accession:GSM2796625	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ION_TORRENT	Ion Torrent Proton		SRP119063			Ctl_B_raw.fastq.gz	fastq	1645083935.0	24006365.0	GSM2796625 r1	0:68.53	A:451390140;C:379131185;G:405300969;T:409261641;N:0	68				451390140	379131185	405300969	409261641	0	SRX3228186	SRS2552753	SRA615148	GEO	Life Sciences Research Institute	1	0.70292		0.09465		0.78776		0.4826		50		B		usable mapping rate	ion_torrent	ion_torrent	unknown	cdna_unspecified	unknown	bulk	unknown	unknown		Canada	2017-09-28	Hatching	Embryo	Whole Organism	All anatomical structures