run_metadata: 41272

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
41272	SRR4026144	SRX2018181	SRS1614122	SRP081553	PRJNA338793	Characterization of genetic loss of function of Fus in zebrafish	GSE85554	Transcriptome Analysis	The RNA binding protein FUS is implicated in transcription alternative splicing of neuronal genes and DNA repair. Mutations in FUS have been linked to human neurodegenerative diseases such as ALS amyotrophic lateral sclerosis. We genetically disrupted fus in zebrafish Danio rerio using the CRISPR Cas9 system. The fus knockout animals are fertile and did not show any distinctive phenotype. Mutation of fus induces mild changes in gene expression on the transcriptome and proteome level in the adult brain. We observed a significant influence of genetic background on gene expression and 3’UTR usage which could mask the effects of loss of Fus. Unlike published fus morphants maternal zygotic fus mutants do not show motoneuronal degeneration and exhibit normal locomotor activity. Overall design: We performed paired end sequencing 100bp reads of the polyA+ transcriptome from brains of five individuals with Fus / genotype and four with Fus wild type genotype. Note on RNA Seq replicates: post performing first RNA sequencing on four replicates of Fus / and WT labeled with the prefix "Sample imb ketting 2014 13 " we received a notice from Illumina stating a problem with the library preparation kit lot that was used to prepare the libraries. Due to that we performed RNA sequencing a second time using the same input RNA except for the Fus knockout replicate #3 because there was not enough input RNA left. Instead a different Fus knockout replicate #1 was sequenced. However we compared the mapped reads from sequencing run 1 and sequencing run 2 using plotCorrelaction from DeepTools and the samples are highly correlated at least 0.97 and 0.95 Spearman and Pearson correlation respectively. Therefore we considered first "Sample imb ketting 2014 13 " and second sequencing runs as technical replicates.		pubmed:27898262		WT 4	GSM2277117		source name:adult female brain\|tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	WT 4	RNA sequencing reads were mapped to the zebrafish genome Zv10 using the aligner STAR version 2.4.1d. The command line parameters for the aligner STAR version 2.4.1d were: STAR runMode alignReads outBAMsortingThreadN 0 outFilterMultimapNmax 20 alignSJoverhangMin 8 alignSJDBoverhangMin 1 outFilterMismatchNmax 2 alignIntronMin 21 outSAMtype BAM SortedByCoordinate sjdbOverhang 99 outSJfilterReads Unique Read count table was produced with featureCounts v. 1.4.6 using Ensembl database gene annotation release 80. The command line parameters for the featureCounts v. 1.4.6 were: Q 1 O T 4 p P s 2 Differential expression was performed using the R/Bioconductor package DESeq2. CollapseReplicates function was used to collapse technical replicates from both sequencing runs. We followed the GATK version 3.5 best practices for RNA seq variant calling which involved a 2 step mapping approach with STAR. Reads were initially mapped with the following command line parameters: STAR runMode alignReads outFilterMismatchNmax 2 outFilterMultimapNmax 10 alignIntronMin 21 outStd SAM outSAMattributes Standard outSJfilterReads Unique. Detected splice junctions were then collected and filtered to generate a new index: STAR runMode genomeGenerate runThreadN 8 genomeDir sjdbStarIndex sjdbFileChrStartEnd SJ.out.tab.Pass1.sjdb sjdbOverhang 100. This new index now contains the splice junctions identified in any of the samples and can be used for more accurate mapping ensuring that all samples are mapped to the same index. The second mapping was done with the same parameters as the first with the addition of outSAMstrandField intronMotif which adds the XS strand attribute required for isoSCM. Aligned reads were then used to call variants using the suggested GATK best practices parameters. The reference Zebrafish VCF was downloaded from Ensembl release 83. Briefly reads groups were added to the alignments and duplicated reads identified and marked with Picard's AddOrReplaceReadGroups and MarkDuplicates respectively. Next unidentified nucleotides Ns were corrected with GenomeAnalysisTK.jar T SplitNCigarReads rf ReassignOneMappingQuality RMQF 255 RMQT 60 U ALLOW N CIGAR READS improving intronic exonic assignments in the process. Base call scores were then adjusted for systematic sequencing errors with GenomeAnalysisTK.jar T BaseRecalibrator knownSites vcf. Finally variants were called with GenomeAnalysisTK.jar T HaplotypeCaller dontUseSoftClippedBases stand call conf 20.0 stand emit conf 20.0 and filtered with GenomeAnalysisTK.jar T VariantFiltration window 35 cluster 3 filterName FS filter "FS > 30.0" filterName QD filter "QD < 2.0". To identify de novo three primeUTRs and changes occurring between wild type and Fus knockout we used IsoSCM v2.0.10.7 This method uses abrupt changes in coverage to identify terminal exon boundaries. IsoSCM does not handle replicates thus we merged the alignments generated by the second mapping for the biological replicates of Fus knockout and wild type. New gene models with improved three primeUTRs were generated with the command assemble and then differential three primeUTR usage quantified with compare command. The top changes were selected with the following criteria: i upstream coverage higher than the median smallest median of either WT or Fus knockout; ii differential usage > 0.20; ii three primeUTR length > 50; and iv confidence score > 0.99. Genome build: Zv10 Supplementary files format and content: Tab delimited counts table file includes results of the DESeq2 analysis: normalized reads log2 fold change and statistics. VCF file represents a list of SNPs called by GATK and filtered see methods. isoSCM text file represents a list of most differentially changed three primeUTRs see methods.	adult female brain	The knockout Zebrafish line was created using CRISPR Cas9 and a single guide RNA targeting exon 3 of the FUS gene. Primers to clone the single guide RNA sequence for fus into DR274 were five prime TAGGGGGTTATGGAGGACAGTC three prime and five prime AAACGACTGTCCTCCATAACCC three prime. Injected fish were raised to maturity and genotyped via tail fin biopsy.	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	Zebrafish were maintained in standard conditions. Unless stated otherwise in all experiments a mix of AB and TU strain was used. All experiments were carried out according to German animal welfare law licenses 23 177 07/G 13 5 087 CRISPR Cas9 knockouts 23177 07/A 15 5 001 OES tail fin clips.	tissue:whole brain\|strain:AB x TU\|developmental stage:adult\|gender:female\|genotype:wild type	GSM2277117	GSM2277117: WT 4; Danio rerio; RNA Seq	GSM2277117		1	Whole brains from young adult individuals were dissected with forceps inside a dish filled with ice cold PBS. Each brain was immediately transferred to 500µl RNALater AM7020 Ambion and stored overnight at 4°C. Subsequently the brains were homogenized with a plastic pestle on ice in 300µl iCLIP Lysis buffer 50mM Tris Cl pH 7.5 100mM NaCl 1% Igepal CA 630Sigma I8896 0.1% SDS 0.5% sodium deoxycholate Protease Inhibitors EDTA free Roche anti RNase AM2692 Ambion 1:1000. The lysate was further split in two parts: 250µl of the lysate were immediately transferred to 750µl Trizol LS 10296028 Thermo Fisher and vigorously mixed. Total RNA for RNA sequencing was isolated from this fraction using standard Trizol LS protocol. Strand specific polyadenylated RNA libraries were prepared using the TruSeq Stranded RNA Library Preparation Kit and sequenced on an Illumina HiSeq2000 using the 2x 100bp read protocol.	GEO Accession:GSM2277117	RNA-Seq	TRANSCRIPTOMIC	cDNA	PAIRED	ILLUMINA	Illumina HiSeq 2500		SRP081553			Sample_imb_ketting_2014_13_WT_4_R1.fastq.gz Sample_imb_ketting_2014_13_WT_4_R2.fastq.gz	fastq fastq	7425010556.0	36757478.0	GSM2277117 r1	0:101 1:101	A:2145596358;C:1565455511;G:1562345442;T:2148814299;N:2798946	101	101			2145596358	1565455511	1562345442	2148814299	2798946	SRX2018181	SRS1614122	SRA451974	GEO	Rene Ketting, Institute of Molecular Biology	2	0.91897	0.92157	0.17645	0.17633	0.6981	0.69948	0.51038	0.50544	101	101	B	B	biological fallback assumption	illumina	hiseq_era	3prime	poly_a	trueseq	bulk	clip	iclip		Germany	2016-08-12	Adult	Adult	Brain	Nervous System