run_metadata: 36642

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
36642	SRR700538	SRX233124	SRS393098	SRP018538	PRJNA189226	Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos	GSE44233	Transcriptome Analysis	The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.		pubmed:23850773		Seq14	GSM1081112		tissue:sorted cardiomyocytes\|developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Gata4 morphant	Seq14	Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.	sorted cardiomyocytes	Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.	RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.	Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.	developmental stage:24hpf\|transgenic line:tgmyl7::gfp\|experimental group:Gata4 morphant	GSM1081112	GSM1081112: Seq14; Danio rerio; RNA Seq	GSM1081112 1		1		GEO Accession:GSM1081112	RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	Illumina HiSeq 2000		SRP018538			seq14.txt.gz	fastq	3144425502.0	61655402.0	GSM1081112 r1	0:51	A:825172912;C:756354008;G:742919584;T:819897573;N:81425	51				825172912	756354008	742919584	819897573	81425	SRX233124	SRS393098	SRA066447	GEO	Todd Evans Lab, Cell and Developmental Biology, Weill Cornell	1	0.93659		0.0806		0.73716		0.47614		51		B		usable mapping rate	illumina	hiseq_era	full_length	random_priming	trueseq	bulk	bulk	bulk		United States	2013-02-11	Pharyngula	Embryo	Heart	Cardiovascular System