run_metadata: 36265

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
36265	SRR058073	SRX022206	SRS084221	SRP002640	PRJNA128943	Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing	GSE22068	Other	We present “centered sites ” a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11–12 contiguous Watson–Crick pairs to the center of the microRNA. In elevated Mg2+ centered sites impart mRNA cleavage but in cells centered sites repress protein output without xxx Agronaute catalyzed cleavage. Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain. This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets mRNA degradomes were sequenced from human brain and HeLa cells and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639.		pubmed:20620952		Zebrafish Embryo small RNAs	GSM548640		source name:Embryo Cells\|data type:small RNAs\|tissue:embryo	Zebrafish Embryo small RNAs	Small RNA sequences from same total RNA samples were mapped to the human genome hg18 requiring a perfect match and reads co localizing to annotated miRNA loci miRBase version 11.0 were counted. sequence reads are summarized as frequency counts	Embryo Cells		The small RNA cDNA libraries were made as described Grimson et al. 2008 except for the three prime adaptor ligation which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol see http://web.wi.mit.edu/bartel/pub/protocols.html.		data type:small RNAs\|tissue:embryo	GSM548640	GSM548640: Zebrafish Embryo small RNAs	GSM548640: Zebrafish Embryo small RNAs	GSM548640: Zebrafish Embryo small RNAs	1		GEO Accession:GSM548640	RNA-Seq	TRANSCRIPTOMIC	other	SINGLE	ILLUMINA	Illumina Genome Analyzer	<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>	SRP002640		quality book char:@\|quality scoring system:log odds	Zebrafish_embryo_24h.fastq	fastq	62213148.0	1728143.0	GSM548640 1	0:36	A:13550515;C:14269249;G:15670049;T:18673533;N:49802	36				13550515	14269249	15670049	18673533	49802	SRX022206	SRS084221	SRA020539	GEO	Bartel lab, Whitehead Institute	1	0.02298		0.02186		0.9988		0.3246		36		B		usable mapping rate	illumina	early_illumina	unknown	small_rna	unknown	bulk	unknown	unknown		United States	2010-06-01	Undetermined	Embryo	Embryo Imprecise	All anatomical structures