run_metadata: 30790
This data as json
| rowid | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 30790 | SRR28359160 | SRX23964382 | SRS20764023 | SRP495499 | PRJNA1088503 | Investigating the transcriptional heterogeneity of the beta cells experiencing Ca2+ excitotoxicity | GSE261729 | Transcriptome Analysis | Beta cells are remarkably heterogeneous. However beta cells response to chronic stress at a single cell level remains largely unknown. Here we used a chemo genetic model of beta cell excitotoxcity coupled with single cell RNA sequencing to understand beta cells response to chronic stress. Remarkably we found that a subset of stressed beta cells progressed towards death while the other group evaded the destruction by dedifferentiation. Vulnerable beta cells that progressed towards death showed upregulation of genes implicated in apoptosis inflammation and immune system activation. The resilient beta cells that evaded the stress showed increased expression aldh1a3 a canonical marker of mammalian beta cell dedifferentiation. Overall design: We used three different treatment groups for this study. Tgins:Kaede larvae n=20 treated with capsaicin csn for 48 hours i.e. from 3 dpf to 5 dpf dpf were used as control. Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 24 hours i.e. from 4 dpf to 5 dpf were used to identify genes involved in immediate stress response and Tgins:TRPV;Tgins:Kaede larvae n=20 treated with csn for 48 hours i.e. from 3 dpf to 5 dpf were used to identify the genes involved in chronic stress response. Post csn treatment pancreatic islets from the larvae were manually dissected and then subsequently dissociated via enzymatic digestion. Post dissociation the beta cells were stained with calcein viability marker dye and FACS sorted. Individual beta cells were collected in a 384 well plate and their transcriptomes were profiled using smart seq2. RNA 01 H19 RNA 02 G11 RNA 03 P18 do not correspond to the other samples eg Ctrl CNS24 CNS48 2. | pubmed:39762647 | CSN48 1 03 D08 | GSM8150118 | tissue:beta cells|cell type:beta cells|treatment:CSN48 1|geo loc name:missing|collection date:missing | CSN48 1 03 D08 | bcl2fastq2 2.19.1 Alignment with GSNAP v2019 06 10 to the GRCz11 and reference and Ensembl gene annotation 95 was used to detect spiice sites gsnap.sse42 d GRCz11 gunzip A sam t 20 use sarray=1 input buffer size=500000 output buffer size=500000 B 5 n 1 m 0.6 s EnsemblGene 95.ss.GRCz11.iit N 0 Counts were created with featureCounts v2.0.1; featureCounts a EnsemblGene 95.GRCz11.TR.gtf s 0 p o bfx1391.GRCz11.e95.tsv Q 1 T 8 Assembly: GRCz11 Supplementary files format and content: tab separated file with the output of featurecounts where each column represent either a sample or gene information start end strand geneid and each row is a gene. Cells countain fragments per gene per sample. | beta cells | The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT | cell type:beta cells|treatment:CSN48 1 | GSM8150118 | GSM8150118: CSN48 1 03 D08; Danio rerio; RNA Seq | GSM8150118 r1 | GSM8150118 | 1 | The cells are sorted with an Aria III FACS into a 384 well plate pre loaded with 0.5 µl freshly prepared lysis buffer 0.2 % Tween 20 solution with 4 U/µl murine RNase inhibitor NEB. post the sort the plate is shortly centrifuged and lysed cells stored at 80°C.post thawing the plate the cells are immediately mixed with 0.5 µl of a primer mix containing 5 mM dNTP Invitrogen 0.5 µM dT primer* 2 U RNase Inhibitor NEB ERCC spike in mix with a final dilution of 1:2*107. RNA is denatured for 3 minutes at 72 °C followed by reverse transcription at 42 °C for 90 min post filling up to 1.5 µl with RT buffer mix for a final concentration of 1x superscript II buffer Invitrogen 1 M betaine 5 mM DTT 6 mM MgCl2 1 µM TSO primer* 2.3 U RNase Inhibitor and 25 U Superscript II. post synthesis the reverse transcriptase is inactivated at 70°C for 15 min. The cDNA is amplified using Kapa HiFi HotStart Readymix Peqlab at a final 1x concentration and 0.1 uM UPprimer under following cycling conditions: initial denaturation at 98°C for 3 min 23 cycles [98°C 20 sec 67°C 15 sec 72°C 6 min] and final elongation at 72°C for 5 min. The amplified cDNA is purified using 0.6x volume of hydrophobic Sera Mag SpeedBeads GE Healthcare resuspended in a buffer consisting of 10 mM Tris 20 mM EDTA 18.5 % w/v PEG 8000 and 2 M sodium chloride solution and DNA is eluted in 12 ul nuclease free water. The concentration of the samples is measured with a Tecan plate reader Infinite 200 pro in 384 well black flat bottom low volume plates Corning using AccuBlue Broad range chemistry Biotium For library preparation up to 700 pg cDNA maximal 2 µl is desiccated and rehydrated in 1 ul Tagmentation mix 1x TTBL buffer 0.1 ul Tagment DNA Enzyme; from TruePrep DNA Library Prep Kit V2 for Illumina; Vazyme and tagmented at 55°C for 5 min. Subsequently Illumina indices are added during PCR 72°C 3 min 98°C 30 sec 13 cycles [98°C 10 sec 63°C 20 sec 72°C 1 min] 72°C 5 min with 1x concentrated KAPA Hifi HotStart Ready Mix and 0.17 µM dual indexing primers. post PCR libraries are quantified with AccuBlue Broad range chemistry equimolarly pooled and size selected with 0.6xright/0.9x left volume of rebuffered Sera Mag SpeedBeads. This is followed by Illumina sequencing on a Novaseq6000 50 bp PE S1 flowcell aiming at an average sequencing depth of 0.6 mio reads per cell. dT primer: C6 aminolinkerAAGCAGTGGTATCAACGCAGAGTCGAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN where N represents a random base and V any base beside thymidine; TSO primer: AAGCAGTGGTATCAACGCAGAGTACATrGrGrG where rG stands for ribo guanosine; UP primer: C6 aminolinker AAGCAGTGGTATCAACGCAGAGT | RNA-Seq | TRANSCRIPTOMIC | cDNA | PAIRED | ILLUMINA | Illumina NovaSeq 6000 | SRP495499 | loader:fastq load.py | L53690_Track-95414_R1.fastq.gz L53690_Track-95414_R2.fastq.gz | fastq fastq | 51053856.0 | 500528.0 | GSM8150118 r1 | 0:51 1:51 | A:14497740;C:9903942;G:10595509;T:16053978;N:2687 | 51 | 51 | 14497740 | 9903942 | 10595509 | 16053978 | 2687 | SRX23964382 | SRS20764023 | SRA1825239 | Dresden-concept Genome Center, TU Dresden | Ninov Lab, CRTD, TU Dresden | 2 | 0.76986 | 0.77936 | 0.11864 | 0.12512 | 0.97264 | 0.97268 | 0.5459 | 0.55357 | 51 | 51 | B | B | biological fallback assumption | illumina | novaseq_era | unknown | random_priming | unknown | sc | single_cell_plate | smartseq | Germany | 2024-03-15 | Undetermined | Larval | Pancreas | Endocrine System |