run_metadata: 30177

This data as json

rowid	run.accession	experiment.accession	sample.accession	study.accession	bioproject	study.title	study.alias	study.type	study.abstract	study.attributes	study.PMIDs	sample.description	sample.title	sample.alias	sample.centername	sample.attributes	GEOsample.title	GEOsample.dataprocessing	GEOsample.source	GEOsample.treatmentprotocol	GEOsample.extractprotocol	GEOsample.growthprotocol	GEOsample.characteristics	GEOsample.accession	experiment.title	experiment.alias	experiment.library_name	experiment.design_description	experiment.library_construction_protocol	experiment.attributes	experiment.library_strategy	experiment.library_source	experiment.library_selection	experiment.library_layout	experiment.platform	experiment.instrument_model	experiment.spot_descriptor	experiment.study_ref	run.title	run.attributes	run.filename	run.semantic_name	run.total_bases	run.total_spots	run.alias	run.read_lengths	run.base_counts	run.r1_length	run.r2_length	run.r3_length	run.r4_length	run.Acount	run.Ccount	run.Gcount	run.Tcount	run.Ncount	run.experiment	run.pool_member	submission.accession	submission.srasource	submission.bioprojectsource	seqdetective.n_mates	seqdetective.mapping_rate.mate1	seqdetective.mapping_rate.mate2	seqdetective.nofeature_rate.mate1	seqdetective.nofeature_rate.mate2	seqdetective.sparsity.mate1	seqdetective.sparsity.mate2	seqdetective.pos_strand_rate.mate1	seqdetective.pos_strand_rate.mate2	seqdetective.readlen.mate1	seqdetective.readlen.mate2	seqdetective.judgement.mate1	seqdetective.judgement.mate2	seqdetective.judgement.reason	platform_family	instrument_generation	read_bias	selection_class	prep_kit	sc_or_bulk	tech_class	technology	tech_variant	submission.bioprojectsource.country	earliest_date	devstage_curation	devstage_curation_coarse	tissue_curation	tissue_curation_coarse
30177	SRR27710107	SRX23376513	SRS20238435	SRP485624	PRJNA1068513	Time course indivudal RNA Seq of zebrafish early development	GSE254071	Transcriptome Analysis	Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.		pubmed:39320016		11 15ss 3	GSM8032944		tissue:RW\|strain:RW\|geo loc name:missing\|collection date:missing	11 15ss 3	Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample	RW		Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.	The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.	strain:RW\|developmental.stage:15ss	GSM8032944	GSM8032944: 11 15ss 3; Danio rerio; RNA Seq	GSM8032944 r1	GSM8032944	1	Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.		RNA-Seq	TRANSCRIPTOMIC	cDNA	SINGLE	ILLUMINA	HiSeq X Ten		SRP485624			Tasaki1-011_R1.fastq.gz	fastq	453450886.0	3002986.0	GSM8032944 r1	0:151	A:151317456;C:87084620;G:91618535;T:123429147;N:1128	151				151317456	87084620	91618535	123429147	1128	SRX23376513	SRS20238435	SRA1791114	Aoyama Gakuinn University	Aoyama Gakuinn University	1	0.72201		0.05792		0.80255		0.5133		151		B		usable mapping rate	illumina	hiseq_era	unknown	cdna_unspecified	unknown	bulk	unknown	unknown		Japan	2024-01-24	Undetermined	Embryo	Embryo Imprecise	All anatomical structures