run_metadata: 30171
This data as json
| rowid | run.accession | experiment.accession | sample.accession | study.accession | bioproject | study.title | study.alias | study.type | study.abstract | study.attributes | study.PMIDs | sample.description | sample.title | sample.alias | sample.centername | sample.attributes | GEOsample.title | GEOsample.dataprocessing | GEOsample.source | GEOsample.treatmentprotocol | GEOsample.extractprotocol | GEOsample.growthprotocol | GEOsample.characteristics | GEOsample.accession | experiment.title | experiment.alias | experiment.library_name | experiment.design_description | experiment.library_construction_protocol | experiment.attributes | experiment.library_strategy | experiment.library_source | experiment.library_selection | experiment.library_layout | experiment.platform | experiment.instrument_model | experiment.spot_descriptor | experiment.study_ref | run.title | run.attributes | run.filename | run.semantic_name | run.total_bases | run.total_spots | run.alias | run.read_lengths | run.base_counts | run.r1_length | run.r2_length | run.r3_length | run.r4_length | run.Acount | run.Ccount | run.Gcount | run.Tcount | run.Ncount | run.experiment | run.pool_member | submission.accession | submission.srasource | submission.bioprojectsource | seqdetective.n_mates | seqdetective.mapping_rate.mate1 | seqdetective.mapping_rate.mate2 | seqdetective.nofeature_rate.mate1 | seqdetective.nofeature_rate.mate2 | seqdetective.sparsity.mate1 | seqdetective.sparsity.mate2 | seqdetective.pos_strand_rate.mate1 | seqdetective.pos_strand_rate.mate2 | seqdetective.readlen.mate1 | seqdetective.readlen.mate2 | seqdetective.judgement.mate1 | seqdetective.judgement.mate2 | seqdetective.judgement.reason | platform_family | instrument_generation | read_bias | selection_class | prep_kit | sc_or_bulk | tech_class | technology | tech_variant | submission.bioprojectsource.country | earliest_date | devstage_curation | devstage_curation_coarse | tissue_curation | tissue_curation_coarse |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 30171 | SRR27710101 | SRX23376519 | SRS20238441 | SRP485624 | PRJNA1068513 | Time course indivudal RNA Seq of zebrafish early development | GSE254071 | Transcriptome Analysis | Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates. | pubmed:39320016 | 41 15ss S5 | GSM8032974 | tissue:RW|strain:RW|geo loc name:missing|collection date:missing | 41 15ss S5 | Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample | RW | Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea. | The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011. | strain:RW|developmental.stage:15ss | GSM8032974 | GSM8032974: 41 15ss S5; Danio rerio; RNA Seq | GSM8032974 r1 | GSM8032974 | 1 | Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea. | RNA-Seq | TRANSCRIPTOMIC | cDNA | SINGLE | ILLUMINA | HiSeq X Ten | SRP485624 | Tasaki1-041_R1.fastq.gz | fastq | 649715401.0 | 4302751.0 | GSM8032974 r1 | 0:151 | A:216414707;C:127064944;G:132545819;T:173688314;N:1617 | 151 | 216414707 | 127064944 | 132545819 | 173688314 | 1617 | SRX23376519 | SRS20238441 | SRA1791114 | Aoyama Gakuinn University | Aoyama Gakuinn University | 1 | 0.7252 | 0.04719 | 0.79979 | 0.50615 | 151 | B | usable mapping rate | illumina | hiseq_era | unknown | cdna_unspecified | unknown | bulk | unknown | unknown | Japan | 2024-01-24 | Undetermined | Embryo | Embryo Imprecise | All anatomical structures |