rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 9651,ERR3266392,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L001_R1_001.fastq.gz,fastq,603238067.0,8014716.0,E MTAB 7846:sponge tdr gfp positive rep2 lane1,0:75.27 1:0,A:164797697;C:136552121;G:141138007;T:160737152;N:13090,75,0,,,164797697,136552121,141138007,160737152,13090,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95083,,0.06432,,0.71532,,0.50098,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9652,ERR3266393,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L002_R1_001.fastq.gz,fastq,603749720.0,8021069.0,E MTAB 7846:sponge tdr gfp positive rep2 lane2,0:75.27 1:0,A:164972969;C:136661417;G:141205792;T:160896264;N:13278,75,0,,,164972969,136661417,141205792,160896264,13278,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.951,,0.06542,,0.71768,,0.50051,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9653,ERR3266394,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L003_R1_001.fastq.gz,fastq,608154053.0,8079704.0,E MTAB 7846:sponge tdr gfp positive rep2 lane3,0:75.27 1:0,A:166117918;C:137731172;G:142320339;T:161970092;N:14532,75,0,,,166117918,137731172,142320339,161970092,14532,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95155,,0.0657,,0.71634,,0.49493,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9654,ERR3266395,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L004_R1_001.fastq.gz,fastq,599143392.0,7959897.0,E MTAB 7846:sponge tdr gfp positive rep2 lane4,0:75.27 1:0,A:163706904;C:135622453;G:140192351;T:159605249;N:16435,75,0,,,163706904,135622453,140192351,159605249,16435,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95061,,0.06431,,0.71764,,0.50166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9655,ERR3266388,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L001_R1_001.fastq.gz,fastq,616761505.0,8202480.0,E MTAB 7846:sponge tdr gfp positive rep1 lane1,0:75.19 1:0,A:168679238;C:139548565;G:143969797;T:164545362;N:18543,75,0,,,168679238,139548565,143969797,164545362,18543,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95019,,0.06806,,0.7097,,0.50337,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9656,ERR3266389,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L002_R1_001.fastq.gz,fastq,617529482.0,8212485.0,E MTAB 7846:sponge tdr gfp positive rep1 lane2,0:75.19 1:0,A:168925757;C:139655387;G:144096837;T:164831236;N:20265,75,0,,,168925757,139655387,144096837,164831236,20265,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9492,,0.06753,,0.712,,0.49881,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9657,ERR3266390,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L003_R1_001.fastq.gz,fastq,624156883.0,8300861.0,E MTAB 7846:sponge tdr gfp positive rep1 lane3,0:75.19 1:0,A:170696950;C:141302376;G:145759286;T:166377781;N:20490,75,0,,,170696950,141302376,145759286,166377781,20490,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94917,,0.06724,,0.71291,,0.50783,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9658,ERR3266391,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L004_R1_001.fastq.gz,fastq,615013615.0,8179180.0,E MTAB 7846:sponge tdr gfp positive rep1 lane4,0:75.19 1:0,A:168237742;C:139106952;G:143535658;T:164110735;N:22528,75,0,,,168237742,139106952,143535658,164110735,22528,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94892,,0.06723,,0.71206,,0.50775,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9659,ERR3266384,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L001_R1_001.fastq.gz,fastq,659562366.0,8762947.0,E MTAB 7846:sponge tdr gfp negative rep2 lane1,0:75.27 1:0,A:178744772;C:150091912;G:155092318;T:175619332;N:14032,75,0,,,178744772,150091912,155092318,175619332,14032,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9517,,0.06908,,0.70822,,0.48025,,73,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9660,ERR3266385,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L002_R1_001.fastq.gz,fastq,658688825.0,8751176.0,E MTAB 7846:sponge tdr gfp negative rep2 lane2,0:75.27 1:0,A:178540155;C:149844100;G:154850294;T:175438757;N:15519,75,0,,,178540155,149844100,154850294,175438757,15519,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95059,,0.06748,,0.70806,,0.48177,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9661,ERR3266386,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L003_R1_001.fastq.gz,fastq,665901310.0,8846927.0,E MTAB 7846:sponge tdr gfp negative rep2 lane3,0:75.27 1:0,A:180412445;C:151589489;G:156677030;T:177206192;N:16154,75,0,,,180412445,151589489,156677030,177206192,16154,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95095,,0.06855,,0.7082,,0.4787,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9662,ERR3266387,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L004_R1_001.fastq.gz,fastq,655674573.0,8711278.0,E MTAB 7846:sponge tdr gfp negative rep2 lane4,0:75.27 1:0,A:177658097;C:149188009;G:154201531;T:174609176;N:17760,75,0,,,177658097,149188009,154201531,174609176,17760,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9503,,0.06838,,0.70926,,0.47475,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9663,ERR3266380,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L001_R1_001.fastq.gz,fastq,634491637.0,8440052.0,E MTAB 7846:sponge tdr gfp negative rep1 lane1,0:75.18 1:0,A:170881257;C:145535643;G:150561786;T:167495156;N:17795,75,0,,,170881257,145535643,150561786,167495156,17795,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94996,,0.05672,,0.70571,,0.48691,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9664,ERR3266381,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L002_R1_001.fastq.gz,fastq,632900752.0,8418846.0,E MTAB 7846:sponge tdr gfp negative rep1 lane2,0:75.18 1:0,A:170454908;C:145141392;G:150172752;T:167112562;N:19138,75,0,,,170454908,145141392,150172752,167112562,19138,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94905,,0.05627,,0.70457,,0.4865,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9665,ERR3266382,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L003_R1_001.fastq.gz,fastq,638530115.0,8494045.0,E MTAB 7846:sponge tdr gfp negative rep1 lane3,0:75.17 1:0,A:171907482;C:146526309;G:151612209;T:168464163;N:19952,75,0,,,171907482,146526309,151612209,168464163,19952,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94919,,0.05578,,0.70849,,0.48073,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9666,ERR3266383,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L004_R1_001.fastq.gz,fastq,627433322.0,8346505.0,E MTAB 7846:sponge tdr gfp negative rep1 lane4,0:75.17 1:0,A:169016383;C:143886824;G:148914725;T:165593528;N:21862,75,0,,,169016383,143886824,148914725,165593528,21862,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94993,,0.05721,,0.7052,,0.48878,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9667,ERR3266376,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L001_R1_001.fastq.gz,fastq,618672195.0,8218047.0,E MTAB 7846:sponge isl gfp positive rep2 lane1,0:75.28 1:0,A:166422886;C:142212204;G:146857539;T:163167819;N:11747,75,0,,,166422886,142212204,146857539,163167819,11747,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94979,,0.08351,,0.70863,,0.47581,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9668,ERR3266377,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L002_R1_001.fastq.gz,fastq,618709102.0,8218295.0,E MTAB 7846:sponge isl gfp positive rep2 lane2,0:75.28 1:0,A:166470432;C:142189977;G:146819280;T:163216323;N:13090,75,0,,,166470432,142189977,146819280,163216323,13090,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94977,,0.08255,,0.70644,,0.47228,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9669,ERR3266378,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L003_R1_001.fastq.gz,fastq,625353059.0,8306375.0,E MTAB 7846:sponge isl gfp positive rep2 lane3,0:75.29 1:0,A:168233274;C:143793178;G:148510556;T:164802476;N:13575,75,0,,,168233274,143793178,148510556,164802476,13575,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95014,,0.08368,,0.70743,,0.47846,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9670,ERR3266379,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L004_R1_001.fastq.gz,fastq,615204990.0,8171748.0,E MTAB 7846:sponge isl gfp positive rep2 lane4,0:75.28 1:0,A:165565861;C:141380152;G:146028839;T:162214263;N:15875,75,0,,,165565861,141380152,146028839,162214263,15875,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94954,,0.08233,,0.70834,,0.48166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9671,ERR3266372,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L001_R1_001.fastq.gz,fastq,626474467.0,8318996.0,E MTAB 7846:sponge isl gfp positive rep1 lane1,0:75.31 1:0,A:170186220;C:142441110;G:147048643;T:166786401;N:12093,75,0,,,170186220,142441110,147048643,166786401,12093,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94907,,0.08132,,0.69684,,0.4736,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9672,ERR3266373,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L002_R1_001.fastq.gz,fastq,626477579.0,8318750.0,E MTAB 7846:sponge isl gfp positive rep1 lane2,0:75.31 1:0,A:170185337;C:142396801;G:147032265;T:166850532;N:12644,75,0,,,170185337,142396801,147032265,166850532,12644,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.08253,,0.6957,,0.47554,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9673,ERR3266374,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L003_R1_001.fastq.gz,fastq,632098509.0,8393388.0,E MTAB 7846:sponge isl gfp positive rep1 lane3,0:75.31 1:0,A:171699353;C:143766296;G:148442110;T:168177264;N:13486,75,0,,,171699353,143766296,148442110,168177264,13486,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94866,,0.08247,,0.69601,,0.48009,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9674,ERR3266375,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L004_R1_001.fastq.gz,fastq,622997479.0,8272752.0,E MTAB 7846:sponge isl gfp positive rep1 lane4,0:75.31 1:0,A:169306677;C:141586415;G:146241288;T:165847752;N:15347,75,0,,,169306677,141586415,146241288,165847752,15347,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9483,,0.08034,,0.69662,,0.47868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9675,ERR3266368,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L001_R1_001.fastq.gz,fastq,707454819.0,9395082.0,E MTAB 7846:sponge isl gfp negative rep2 lane1,0:75.30 1:0,A:194991862;C:157927850;G:163280639;T:191241488;N:12980,75,0,,,194991862,157927850,163280639,191241488,12980,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93871,,0.08926,,0.70806,,0.46501,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9676,ERR3266369,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L002_R1_001.fastq.gz,fastq,704791838.0,9359668.0,E MTAB 7846:sponge isl gfp negative rep2 lane2,0:75.30 1:0,A:194317422;C:157276895;G:162624670;T:190558322;N:14529,75,0,,,194317422,157276895,162624670,190558322,14529,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93816,,0.08859,,0.70999,,0.4661,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9677,ERR3266370,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L003_R1_001.fastq.gz,fastq,715991833.0,9508323.0,E MTAB 7846:sponge isl gfp negative rep2 lane3,0:75.30 1:0,A:197297222;C:159913026;G:165363927;T:193402765;N:14893,75,0,,,197297222,159913026,165363927,193402765,14893,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93844,,0.08854,,0.70828,,0.46042,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9678,ERR3266371,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L004_R1_001.fastq.gz,fastq,703723869.0,9345669.0,E MTAB 7846:sponge isl gfp negative rep2 lane4,0:75.30 1:0,A:194029886;C:157050176;G:162432310;T:190193608;N:17889,75,0,,,194029886,157050176,162432310,190193608,17889,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93897,,0.08993,,0.70863,,0.45707,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9679,ERR3266364,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L001_R1_001.fastq.gz,fastq,676581458.0,8983758.0,E MTAB 7846:sponge isl gfp negative rep1 lane1,0:75.31 1:0,A:184297337;C:153352193;G:158268476;T:180651038;N:12414,75,0,,,184297337,153352193,158268476,180651038,12414,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94981,,0.07715,,0.69138,,0.47243,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9680,ERR3266365,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L002_R1_001.fastq.gz,fastq,676876555.0,8987445.0,E MTAB 7846:sponge isl gfp negative rep1 lane2,0:75.31 1:0,A:184435129;C:153332402;G:158323789;T:180770978;N:14257,75,0,,,184435129,153332402,158323789,180770978,14257,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94901,,0.07805,,0.69179,,0.47182,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9681,ERR3266366,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L003_R1_001.fastq.gz,fastq,681771213.0,9052615.0,E MTAB 7846:sponge isl gfp negative rep1 lane3,0:75.31 1:0,A:185717696;C:154552039;G:159567102;T:181919781;N:14595,75,0,,,185717696,154552039,159567102,181919781,14595,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94923,,0.07768,,0.69167,,0.47219,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9682,ERR3266367,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L004_R1_001.fastq.gz,fastq,671169917.0,8911624.0,E MTAB 7846:sponge isl gfp negative rep1 lane4,0:75.31 1:0,A:182910490;C:152045814;G:157010053;T:179186548;N:17012,75,0,,,182910490,152045814,157010053,179186548,17012,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.07612,,0.69106,,0.47736,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9683,ERR3266360,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L001_R1_001.fastq.gz,fastq,745666738.0,9917771.0,E MTAB 7846:sponge ccn gfp positive rep2 lane1,0:75.18 1:0,A:207714377;C:163732420;G:169037726;T:205161925;N:20290,75,0,,,207714377,163732420,169037726,205161925,20290,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94006,,0.17809,,0.68166,,0.48912,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9684,ERR3266361,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L002_R1_001.fastq.gz,fastq,747693645.0,9944395.0,E MTAB 7846:sponge ccn gfp positive rep2 lane2,0:75.19 1:0,A:208257288;C:164106384;G:169478025;T:205830399;N:21549,75,0,,,208257288,164106384,169478025,205830399,21549,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93873,,0.17738,,0.68296,,0.49656,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9685,ERR3266362,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L003_R1_001.fastq.gz,fastq,756134124.0,10056818.0,E MTAB 7846:sponge ccn gfp positive rep2 lane3,0:75.19 1:0,A:210573012;C:166089133;G:171475300;T:207973232;N:23447,75,0,,,210573012,166089133,171475300,207973232,23447,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94077,,0.18001,,0.68004,,0.49812,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9686,ERR3266363,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L004_R1_001.fastq.gz,fastq,747687619.0,9944417.0,E MTAB 7846:sponge ccn gfp positive rep2 lane4,0:75.19 1:0,A:208315943;C:164104155;G:169484250;T:205757712;N:25559,75,0,,,208315943,164104155,169484250,205757712,25559,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94025,,0.17965,,0.68124,,0.49249,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9687,ERR3266356,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L001_R1_001.fastq.gz,fastq,600153564.0,7972767.0,E MTAB 7846:sponge ccn gfp positive rep1 lane1,0:75.28 1:0,A:165075878;C:133961511;G:138306424;T:162797903;N:11848,75,0,,,165075878,133961511,138306424,162797903,11848,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95367,,0.14146,,0.69154,,0.46621,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9688,ERR3266357,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L002_R1_001.fastq.gz,fastq,600790169.0,7981038.0,E MTAB 7846:sponge ccn gfp positive rep1 lane2,0:75.28 1:0,A:165262968;C:133988329;G:138458635;T:163066854;N:13383,75,0,,,165262968,133988329,138458635,163066854,13383,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95365,,0.14116,,0.69301,,0.46836,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9689,ERR3266358,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L003_R1_001.fastq.gz,fastq,608611085.0,8084904.0,E MTAB 7846:sponge ccn gfp positive rep1 lane3,0:75.28 1:0,A:167402055;C:135871708;G:140314669;T:165009252;N:13401,75,0,,,167402055,135871708,140314669,165009252,13401,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95403,,0.14167,,0.69311,,0.4702,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9690,ERR3266359,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L004_R1_001.fastq.gz,fastq,599558663.0,7964718.0,E MTAB 7846:sponge ccn gfp positive rep1 lane4,0:75.28 1:0,A:164965131;C:133749666;G:138194884;T:162633558;N:15424,75,0,,,164965131,133749666,138194884,162633558,15424,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95285,,0.14085,,0.69037,,0.47345,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9691,ERR3266352,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L001_R1_001.fastq.gz,fastq,599599608.0,7970460.0,E MTAB 7846:sponge ccn gfp negative rep2 lane1,0:75.23 1:0,A:162236409;C:136907675;G:141538730;T:158902520;N:14274,75,0,,,162236409,136907675,141538730,158902520,14274,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95404,,0.05923,,0.69737,,0.48627,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9692,ERR3266353,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L002_R1_001.fastq.gz,fastq,600057776.0,7976438.0,E MTAB 7846:sponge ccn gfp negative rep2 lane2,0:75.23 1:0,A:162367410;C:136994919;G:141577782;T:159102194;N:15471,75,0,,,162367410,136994919,141577782,159102194,15471,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.953,,0.06085,,0.6952,,0.48868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9693,ERR3266354,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L003_R1_001.fastq.gz,fastq,607089697.0,8069901.0,E MTAB 7846:sponge ccn gfp negative rep2 lane3,0:75.23 1:0,A:164235344;C:138684000;G:143335680;T:160819270;N:15403,75,0,,,164235344,138684000,143335680,160819270,15403,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95245,,0.06055,,0.69589,,0.48813,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9694,ERR3266355,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L004_R1_001.fastq.gz,fastq,598098243.0,7950223.0,E MTAB 7846:sponge ccn gfp negative rep2 lane4,0:75.23 1:0,A:161836808;C:136564804;G:141157424;T:158521860;N:17347,75,0,,,161836808,136564804,141157424,158521860,17347,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95299,,0.06032,,0.69501,,0.48928,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9695,ERR3266348,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L001_R1_001.fastq.gz,fastq,668175990.0,8872549.0,E MTAB 7846:sponge ccn gfp negative rep1 lane1,0:75.31 1:0,A:179859350;C:153483169;G:158360605;T:176462088;N:10778,75,0,,,179859350,153483169,158360605,176462088,10778,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95955,,0.07154,,0.69696,,0.46425,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9696,ERR3266349,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L002_R1_001.fastq.gz,fastq,668154755.0,8872093.0,E MTAB 7846:sponge ccn gfp negative rep1 lane2,0:75.31 1:0,A:179811687;C:153454931;G:158314391;T:176560936;N:12810,75,0,,,179811687,153454931,158314391,176560936,12810,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96029,,0.06969,,0.69684,,0.46725,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9697,ERR3266350,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L003_R1_001.fastq.gz,fastq,676984426.0,8989004.0,E MTAB 7846:sponge ccn gfp negative rep1 lane3,0:75.31 1:0,A:182159685;C:155578195;G:160511499;T:178722363;N:12684,75,0,,,182159685,155578195,160511499,178722363,12684,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96012,,0.07159,,0.69554,,0.46811,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9698,ERR3266351,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L004_R1_001.fastq.gz,fastq,666031892.0,8843695.0,E MTAB 7846:sponge ccn gfp negative rep1 lane4,0:75.31 1:0,A:179243298;C:152946459;G:157873912;T:175953752;N:14471,75,0,,,179243298,152946459,157873912,175953752,14471,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96014,,0.07169,,0.69493,,0.47058,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 29202,SRR27329257,SRX23006269,SRS19970080,SRP479683,PRJNA1055904,BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation,GSE251904,Transcriptome Analysis,Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.,,pubmed:40057955,,Zebrafish Lateral Ectoderm 7.5 hpf 4,GSM7989708,,source name:Lateral Ectoderm|tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing,Zebrafish Lateral Ectoderm 7.5 hpf 4,FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample,Lateral Ectoderm,Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,Embryos were kept at 28.5 C until dissociation,tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS,GSM7989708,GSM7989708: Zebrafish Lateral Ectoderm 7.5 hpf 4; Danio rerio; RNA Seq,GSM7989708 r1,GSM7989708,1,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP479683,,,Lateral_Ectoderm_4.mate1.fastq.gz Lateral_Ectoderm_4.mate2.fastq.gz,fastq fastq,6211000588.0,26929501.0,GSM7989708 r1,0:80.64 1:150,A:1950010947;C:1101223011;G:1497556265;T:1656016608;N:6193757,80,150,,,1950010947,1101223011,1497556265,1656016608,6193757,SRX23006269,SRS19970080,SRA1774740,"Heisenberg group, Institute of Science and Technology Austria (ISTA)","Heisenberg group, Institute of Science and Technology Austria (ISTA)",2,0.65918,0.4633,0.04875,0.02201,0.90623,0.92608,0.79936,0.77887,68,150,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,Austria,2023-12-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 29203,SRR27329258,SRX23006268,SRS19970081,SRP479683,PRJNA1055904,BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation,GSE251904,Transcriptome Analysis,Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.,,pubmed:40057955,,Zebrafish Lateral Ectoderm 7.5 hpf 3,GSM7989707,,source name:Lateral Ectoderm|tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing,Zebrafish Lateral Ectoderm 7.5 hpf 3,FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample,Lateral Ectoderm,Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,Embryos were kept at 28.5 C until dissociation,tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS,GSM7989707,GSM7989707: Zebrafish Lateral Ectoderm 7.5 hpf 3; Danio rerio; RNA Seq,GSM7989707 r1,GSM7989707,1,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP479683,,,Lateral_Ectoderm_3.mate1.fastq.gz Lateral_Ectoderm_3.mate2.fastq.gz,fastq fastq,5066130338.0,22014930.0,GSM7989707 r1,0:80.12 1:150,A:1476750755;C:934859886;G:1246347548;T:1403280136;N:4892013,80,150,,,1476750755,934859886,1246347548,1403280136,4892013,SRX23006268,SRS19970081,SRA1774740,"Heisenberg group, Institute of Science and Technology Austria (ISTA)","Heisenberg group, Institute of Science and Technology Austria (ISTA)",2,0.7566,0.52272,0.0462,0.02684,0.89489,0.91246,0.78848,0.77633,68,150,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,Austria,2023-12-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 29204,SRR27329259,SRX23006267,SRS19970078,SRP479683,PRJNA1055904,BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation,GSE251904,Transcriptome Analysis,Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.,,pubmed:40057955,,Zebrafish Lateral Ectoderm 7.5 hpf 2,GSM7989706,,source name:Lateral Ectoderm|tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing,Zebrafish Lateral Ectoderm 7.5 hpf 2,FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample,Lateral Ectoderm,Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,Embryos were kept at 28.5 C until dissociation,tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS,GSM7989706,GSM7989706: Zebrafish Lateral Ectoderm 7.5 hpf 2; Danio rerio; RNA Seq,GSM7989706 r1,GSM7989706,1,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP479683,,,Lateral_Ectoderm_2.mate1.fastq.gz Lateral_Ectoderm_2.mate2.fastq.gz,fastq fastq,6372234032.0,27787436.0,GSM7989706 r1,0:79.32 1:150,A:1908123129;C:1195826989;G:1555786583;T:1706205499;N:6291832,79,150,,,1908123129,1195826989,1555786583,1706205499,6291832,SRX23006267,SRS19970078,SRA1774740,"Heisenberg group, Institute of Science and Technology Austria (ISTA)","Heisenberg group, Institute of Science and Technology Austria (ISTA)",2,0.52417,0.50653,0.02922,0.02493,0.89479,0.90938,0.74721,0.74563,68,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,Austria,2023-12-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 29205,SRR27329260,SRX23006266,SRS19970079,SRP479683,PRJNA1055904,BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation,GSE251904,Transcriptome Analysis,Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.,,pubmed:40057955,,Zebrafish Lateral Ectoderm 7.5 hpf 1,GSM7989705,,source name:Lateral Ectoderm|tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing,Zebrafish Lateral Ectoderm 7.5 hpf 1,FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample,Lateral Ectoderm,Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,Embryos were kept at 28.5 C until dissociation,tissue:Lateral Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS,GSM7989705,GSM7989705: Zebrafish Lateral Ectoderm 7.5 hpf 1; Danio rerio; RNA Seq,GSM7989705 r1,GSM7989705,1,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP479683,,,Lateral_Ectoderm_1.mate2.fastq.gz Lateral_Ectoderm_1.mate1.fastq.gz,fastq fastq,10106832046.0,43799441.0,GSM7989705 r1,0:80.75 1:150,A:3384386532;C:1698196797;G:2308026869;T:2706071735;N:10150113,80,150,,,3384386532,1698196797,2308026869,2706071735,10150113,SRX23006266,SRS19970079,SRA1774740,"Heisenberg group, Institute of Science and Technology Austria (ISTA)","Heisenberg group, Institute of Science and Technology Austria (ISTA)",2,0.64457,0.42542,0.04802,0.01964,0.91541,0.93878,0.83455,0.83564,68,150,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,Austria,2023-12-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 29206,SRR27329261,SRX23006265,SRS19970077,SRP479683,PRJNA1055904,BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation,GSE251904,Transcriptome Analysis,Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.,,pubmed:40057955,,Zebrafish Animal Ectoderm 7.5 hpf 4,GSM7989704,,source name:Animal Ectoderm|tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing,Zebrafish Animal Ectoderm 7.5 hpf 4,FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample,Animal Ectoderm,Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,Embryos were kept at 28.5 C until dissociation,tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS,GSM7989704,GSM7989704: Zebrafish Animal Ectoderm 7.5 hpf 4; Danio rerio; RNA Seq,GSM7989704 r1,GSM7989704,1,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP479683,,,Animal_Ectoderm_4.mate1.fastq.gz Animal_Ectoderm_4.mate2.fastq.gz,fastq fastq,5882974802.0,25612144.0,GSM7989704 r1,0:79.69 1:150.00,A:1784390197;C:1112846767;G:1392719296;T:1587227818;N:5790724,79,150,,,1784390197,1112846767,1392719296,1587227818,5790724,SRX23006265,SRS19970077,SRA1774740,"Heisenberg group, Institute of Science and Technology Austria (ISTA)","Heisenberg group, Institute of Science and Technology Austria (ISTA)",2,0.72169,0.51947,0.04749,0.0244,0.89061,0.91007,0.76259,0.75355,90,150,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,Austria,2023-12-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 29207,SRR27329262,SRX23006264,SRS19970076,SRP479683,PRJNA1055904,BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation,GSE251904,Transcriptome Analysis,Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.,,pubmed:40057955,,Zebrafish Animal Ectoderm 7.5 hpf 3,GSM7989703,,source name:Animal Ectoderm|tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing,Zebrafish Animal Ectoderm 7.5 hpf 3,FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample,Animal Ectoderm,Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,Embryos were kept at 28.5 C until dissociation,tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS,GSM7989703,GSM7989703: Zebrafish Animal Ectoderm 7.5 hpf 3; Danio rerio; RNA Seq,GSM7989703 r1,GSM7989703,1,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP479683,,,Animal_Ectoderm_3.mate1.fastq.gz Animal_Ectoderm_3.mate2.fastq.gz,fastq fastq,6802628678.0,29741168.0,GSM7989703 r1,0:78.73 1:150,A:1935418861;C:1362666541;G:1651315180;T:1846520380;N:6707716,78,150,,,1935418861,1362666541,1651315180,1846520380,6707716,SRX23006264,SRS19970076,SRA1774740,"Heisenberg group, Institute of Science and Technology Austria (ISTA)","Heisenberg group, Institute of Science and Technology Austria (ISTA)",2,0.74265,0.48713,0.04983,0.02636,0.87771,0.90335,0.72388,0.71557,68,150,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,Austria,2023-12-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 29208,SRR27329263,SRX23006263,SRS19970075,SRP479683,PRJNA1055904,BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation,GSE251904,Transcriptome Analysis,Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.,,pubmed:40057955,,Zebrafish Animal Ectoderm 7.5 hpf 2,GSM7989702,,source name:Animal Ectoderm|tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing,Zebrafish Animal Ectoderm 7.5 hpf 2,FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample,Animal Ectoderm,Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,Embryos were kept at 28.5 C until dissociation,tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS,GSM7989702,GSM7989702: Zebrafish Animal Ectoderm 7.5 hpf 2; Danio rerio; RNA Seq,GSM7989702 r1,GSM7989702,1,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP479683,,,Animal_Ectoderm_2.mate1.fastq.gz Animal_Ectoderm_2.mate2.fastq.gz,fastq fastq,6083410864.0,26183986.0,GSM7989702 r1,0:82.33 1:150,A:1976903262;C:1110974120;G:1376486325;T:1613990197;N:5056960,82,150,,,1976903262,1110974120,1376486325,1613990197,5056960,SRX23006263,SRS19970075,SRA1774740,"Heisenberg group, Institute of Science and Technology Austria (ISTA)","Heisenberg group, Institute of Science and Technology Austria (ISTA)",2,0.73078,0.55778,0.04052,0.02684,0.89509,0.91106,0.77391,0.7649,68,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,Austria,2023-12-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 29209,SRR27329264,SRX23006262,SRS19970074,SRP479683,PRJNA1055904,BMP dependent patterning of ectoderm tissue material properties modulates lateral mesendoderm cell migration during early zebrafish gastrulation,GSE251904,Transcriptome Analysis,Cell migration is a fundamental process during embryonic development. Most studies in vivo have focussed on the migration of cells using the extracellular matrix ECM as their substrate for migration. In contrast much less is known about how cells migrate on other cells as found in early embryos when the ECM has not yet formed. Here we show that lateral mesendoderm LME cells in the early zebrafish gastrula use the ectoderm as their substrate for migration. We show that the lateral ectoderm is permissive for the animal pole directed migration of LME cells while the ectoderm at the animal pole halts it. These differences in the permissiveness depend on the lateral ectoderm being more cohesive than the animal ectoderm a property controlled by BMP signalling within the ectoderm. Collectively these findings identify ectoderm tissue cohesion as one critical factor regulating LME migration during zebrafish gastrulation. Overall design: To investigate the differences in gene expression between animal and lateral ectoderm causing the difference in material properties between the two ectodermal tissues.,,pubmed:40057955,,Zebrafish Animal Ectoderm 7.5 hpf 1,GSM7989701,,source name:Animal Ectoderm|tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS|geo loc name:missing|collection date:missing,Zebrafish Animal Ectoderm 7.5 hpf 1,FastQC quality control Trimmomatic adapter & quality trimming; parameters: 2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:19 FastQC controlling trimming results salmon Alignment; used flags: seqBias qcBias R DESeq2 differential gene expression analysis; DESEq2 apeglm tximport genefilter GenomicRanges R EnhancedVolcano & biomaRt visualization Assembly: Danio rerio GRCz11 Supplementary files format and content: tab delimited text file with gene name gene length effective length tpm and number of reads for each sample,Animal Ectoderm,Embryo were injected with 125 pg of PAmCherry1 mRNA at xxx cell stage. At 6 hpf embryos were mounted for up right imaging and a 444 x 220 x 58.5 µm volume was photoactivated using a 405 nm laser either at the animal pole or on the lateral side. The photoactivation process was composed of 10 cycles of 28 sec per embryo in a time window of approximately 90 min. post photoactivation embryos were transferred in Ca2+ free Ringer solution and dissociated by gently pipetting using a P 1000 pipette to obtain a single cell suspension. 5000 PAmCherry1+ cells were sorted in 150 µl of RTL plus lysis buffer RNeasy Plus Micro Kit QIAGEN with 1% of 2 mercaptoethanol.,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,Embryos were kept at 28.5 C until dissociation,tissue:Animal Ectoderm|genotype:WT TgSebox::eGFP embryos|treatment:1 cell stage injection of PAmCherry1 mRNA Photoactivation FACS,GSM7989701,GSM7989701: Zebrafish Animal Ectoderm 7.5 hpf 1; Danio rerio; RNA Seq,GSM7989701 r1,GSM7989701,1,Cells were subjected to RNA extraction using RNeasy Plus Micro Kit QIAGEN according to the manufacturer instructions Complete cDNA synthesis and library preparation were performed using SMART Seq v3 protocol with Nextera UDI adapters. Libraries were then quantified by qPCR KAPA Biosysytems.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP479683,,,Animal_Ectoderm_1.mate1.fastq.gz Animal_Ectoderm_1.mate2.fastq.gz,fastq fastq,7195859200.0,31306406.0,GSM7989701 r1,0:79.85 1:150,A:2025250331;C:1450062111;G:1771726396;T:1941745747;N:7074615,79,150,,,2025250331,1450062111,1771726396,1941745747,7074615,SRX23006262,SRS19970074,SRA1774740,"Heisenberg group, Institute of Science and Technology Austria (ISTA)","Heisenberg group, Institute of Science and Technology Austria (ISTA)",2,0.74201,0.52197,0.04312,0.02595,0.87941,0.9013,0.74298,0.71509,68,150,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,Austria,2023-12-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 31773,SRR28590145,SRX24189497,SRS20963520,SRP500320,PRJNA1097627,GPI transamidase complex is required for primordial germ cell migration and development in zebrafish,GSE263481,Transcriptome Analysis,Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.,,pubmed:39741393,,WT shield PGCs RNA rep2,GSM8193374,,source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing,WT shield PGCs RNA rep2,RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples,embryo,GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 214 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.,tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type,GSM8193374,GSM8193374: WT shield PGCs RNA rep2; Danio rerio; RNA Seq,GSM8193374 r1,GSM8193374,1,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP500320,,,WT_shield_PGCs_RNA_rep2_r1.fq.gz WT_shield_PGCs_RNA_rep2_r2.fq.gz,fastq fastq,1476298800.0,4920996.0,GSM8193374 r1,0:150 1:150,A:364072227;C:345274481;G:387289011;T:379660776;N:2305,150,150,,,364072227,345274481,387289011,379660776,2305,SRX24189497,SRS20963520,SRA1842063,Tsinghua University,Tsinghua University,2,0.9277,0.92845,0.26727,0.2672,0.86803,0.86969,0.75933,0.75985,150,150,B,B,biological fallback assumption,illumina,nextseq,unknown,poly_a,unknown,sc,single_cell_plate,smartseq,,China,2024-04-08,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 31774,SRR28590146,SRX24189496,SRS20963519,SRP500320,PRJNA1097627,GPI transamidase complex is required for primordial germ cell migration and development in zebrafish,GSE263481,Transcriptome Analysis,Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.,,pubmed:39741393,,WT shield PGCs RNA rep1,GSM8193373,,source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing,WT shield PGCs RNA rep1,RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples,embryo,GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 212 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.,tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type,GSM8193373,GSM8193373: WT shield PGCs RNA rep1; Danio rerio; RNA Seq,GSM8193373 r1,GSM8193373,1,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP500320,,,WT_shield_PGCs_RNA_rep1_r2.fq.gz WT_shield_PGCs_RNA_rep1_r1.fq.gz,fastq fastq,2758778100.0,9195927.0,GSM8193373 r1,0:150 1:150,A:769058521;C:582931819;G:614181069;T:792602904;N:3787,150,150,,,769058521,582931819,614181069,792602904,3787,SRX24189496,SRS20963519,SRA1842063,Tsinghua University,Tsinghua University,2,0.93691,0.91581,0.06844,0.06665,0.7683,0.76995,0.53645,0.52363,150,150,B,B,biological fallback assumption,illumina,nextseq,unknown,poly_a,unknown,sc,single_cell_plate,smartseq,,China,2024-04-08,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 31775,SRR28590147,SRX24189495,SRS20963518,SRP500320,PRJNA1097627,GPI transamidase complex is required for primordial germ cell migration and development in zebrafish,GSE263481,Transcriptome Analysis,Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.,,pubmed:39741393,,WT bud PGCs RNA rep2,GSM8193372,,source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing,WT bud PGCs RNA rep2,RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples,embryo,GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 210 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.,tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type,GSM8193372,GSM8193372: WT bud PGCs RNA rep2; Danio rerio; RNA Seq,GSM8193372 r1,GSM8193372,1,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP500320,,,WT_bud_PGCs_RNA_rep2_r1.fq.gz WT_bud_PGCs_RNA_rep2_r2.fq.gz,fastq fastq,3111261300.0,10370871.0,GSM8193372 r1,0:150 1:150,A:817262319;C:691724200;G:751270343;T:850999265;N:5173,150,150,,,817262319,691724200,751270343,850999265,5173,SRX24189495,SRS20963518,SRA1842063,Tsinghua University,Tsinghua University,2,0.90729,0.9053,0.11596,0.1166,0.79963,0.79981,0.60276,0.59912,150,150,B,B,biological fallback assumption,illumina,nextseq,unknown,poly_a,unknown,sc,single_cell_plate,smartseq,,China,2024-04-08,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 31776,SRR28590148,SRX24189494,SRS20963517,SRP500320,PRJNA1097627,GPI transamidase complex is required for primordial germ cell migration and development in zebrafish,GSE263481,Transcriptome Analysis,Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.,,pubmed:39741393,,WT bud PGCs RNA rep1,GSM8193371,,source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type|geo loc name:missing|collection date:missing,WT bud PGCs RNA rep1,RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples,embryo,GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 208 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.,tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:Wile type,GSM8193371,GSM8193371: WT bud PGCs RNA rep1; Danio rerio; RNA Seq,GSM8193371 r1,GSM8193371,1,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP500320,,,WT_bud_PGCs_RNA_rep1_r1.fq.gz WT_bud_PGCs_RNA_rep1_r2.fq.gz,fastq fastq,3758269200.0,12527564.0,GSM8193371 r1,0:150 1:150,A:1041649283;C:801966468;G:845188264;T:1069459832;N:5353,150,150,,,1041649283,801966468,845188264,1069459832,5353,SRX24189494,SRS20963517,SRA1842063,Tsinghua University,Tsinghua University,2,0.93714,0.91161,0.07974,0.07673,0.75785,0.76037,0.52906,0.52822,150,150,B,B,biological fallback assumption,illumina,nextseq,unknown,poly_a,unknown,sc,single_cell_plate,smartseq,,China,2024-04-08,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 31777,SRR28590149,SRX24189493,SRS20963516,SRP500320,PRJNA1097627,GPI transamidase complex is required for primordial germ cell migration and development in zebrafish,GSE263481,Transcriptome Analysis,Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.,,pubmed:39741393,,pigu homo shield PGCs RNA rep2,GSM8193370,,source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing,pigu homo shield PGCs RNA rep2,RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples,embryo,GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 206 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.,tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo,GSM8193370,GSM8193370: pigu homo shield PGCs RNA rep2; Danio rerio; RNA Seq,GSM8193370 r1,GSM8193370,1,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP500320,,,pigu_homo_shield_PGCs_RNA_rep2_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep2_r1.fq.gz,fastq fastq,875630700.0,2918769.0,GSM8193370 r1,0:150 1:150,A:229625544;C:190227589;G:217096984;T:238679075;N:1508,150,150,,,229625544,190227589,217096984,238679075,1508,SRX24189493,SRS20963516,SRA1842063,Tsinghua University,Tsinghua University,2,0.81852,0.81643,0.19346,0.19329,0.89852,0.89897,0.83525,0.83082,150,150,B,B,biological fallback assumption,illumina,nextseq,unknown,poly_a,unknown,sc,single_cell_plate,smartseq,,China,2024-04-08,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 31778,SRR28590150,SRX24189492,SRS20963515,SRP500320,PRJNA1097627,GPI transamidase complex is required for primordial germ cell migration and development in zebrafish,GSE263481,Transcriptome Analysis,Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.,,pubmed:39741393,,pigu homo shield PGCs RNA rep1,GSM8193369,,source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing,pigu homo shield PGCs RNA rep1,RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples,embryo,GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 204 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.,tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo,GSM8193369,GSM8193369: pigu homo shield PGCs RNA rep1; Danio rerio; RNA Seq,GSM8193369 r1,GSM8193369,1,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP500320,,,pigu_homo_shield_PGCs_RNA_rep1_r2.fq.gz pigu_homo_shield_PGCs_RNA_rep1_r1.fq.gz,fastq fastq,2204383800.0,7347946.0,GSM8193369 r1,0:150 1:150,A:618947181;C:459789570;G:491705141;T:633938869;N:3039,150,150,,,618947181,459789570,491705141,633938869,3039,SRX24189492,SRS20963515,SRA1842063,Tsinghua University,Tsinghua University,2,0.91971,0.9203,0.0732,0.07256,0.77512,0.77516,0.53347,0.53419,150,150,B,B,biological fallback assumption,illumina,nextseq,unknown,poly_a,unknown,sc,single_cell_plate,smartseq,,China,2024-04-08,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 31779,SRR28590151,SRX24189491,SRS20963514,SRP500320,PRJNA1097627,GPI transamidase complex is required for primordial germ cell migration and development in zebrafish,GSE263481,Transcriptome Analysis,Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.,,pubmed:39741393,,pigu homo bud PGCs RNA rep2,GSM8193368,,source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing,pigu homo bud PGCs RNA rep2,RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples,embryo,GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 202 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.,tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo,GSM8193368,GSM8193368: pigu homo bud PGCs RNA rep2; Danio rerio; RNA Seq,GSM8193368 r1,GSM8193368,1,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP500320,,,pigu_homo_bud_PGCs_RNA_rep2_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep2_r2.fq.gz,fastq fastq,2137638000.0,7125460.0,GSM8193368 r1,0:150 1:150,A:588045273;C:460739300;G:496293927;T:592556088;N:3412,150,150,,,588045273,460739300,496293927,592556088,3412,SRX24189491,SRS20963514,SRA1842063,Tsinghua University,Tsinghua University,2,0.36533,0.36278,0.05703,0.057,0.87754,0.87811,0.60206,0.59677,150,150,B,B,biological fallback assumption,illumina,nextseq,unknown,poly_a,unknown,sc,single_cell_plate,smartseq,,China,2024-04-08,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 31780,SRR28590152,SRX24189490,SRS20963513,SRP500320,PRJNA1097627,GPI transamidase complex is required for primordial germ cell migration and development in zebrafish,GSE263481,Transcriptome Analysis,Proteins without xxx domains could be anchored to the cell surface for regulating various biological processes when covalently linked to glycosylphosphatidylinositol GPI molecules by the GPI transamidase GPIT complex. However it remains poorly understood whether and how the GPIT complex affects primordial germ cell PGC development. In this study we report the important roles of GPI transamidase in PGC migration and development in zebrafish embryos. Mutation of pigu or pigk both encoding essential GPIT complex subunits resulted in defective PGC migration with ectopically located PGCs and reduction of PGC counts. Notably a detailed analysis of filopodia in PGCs reveals the attenuated polarity of filopodia distribution along the migration direction in mutant embryos. PGC transplantation and PGC specific rescue experiments demonstrate that both PGC and somatic cell expressed Pigu are required for PGC migration. Furthermore expression levels of PGC specific genes are decreased in pigu mutant PGCs with the derepression of somatic cell genes. Hence we propose that the GPIT complex plays a critical role during PGC migration and development. Overall design: To reveal molecular mechanisms underlying GPI transamidase mediated PGC migration regulation we performed RNA seq of PGCs in wild type and pigu / embryos at the shield and bud stages. We manually picked GFP positive PGCs post cell dissociation of embryos at the shield and bud stages. Then post genotyping of rest somatic cells PGCs with the same genotypes were pooled together and lysed for Smart seq of two biological replicates.,,pubmed:39741393,,pigu homo bud PGCs RNA rep1,GSM8193367,,source name:embryo|tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo|geo loc name:missing|collection date:missing,pigu homo bud PGCs RNA rep1,RNA seq data were firstly processed using Trim Galore! with default parameters to trim the adapter containing and low quality reads. The filtered data were then mapped to the zebrafish reference genome danRer11 by STAR version: STAR 2.5.3a modified. The gene expression level was normalized to fragments per kilobase of transcript per million mapped FPKM values using Cufflinks version 2.2.1. Assembly: danRer11 Supplementary files format and content: tab delimited ext file includes FPKM values for each samples,embryo,GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette. GFP nanos1 3’UTR mRNA was injected into WT and pigu / zygotes respectively to label PGCs. Then the embryos at shield or bud stages were dechorionated and deyolked manually by forceps and transferred to a 1.5 ml Eppendorf tube with 50 µl PBS. Dissections were performed for up to 5 min. The volume of PBS containing embryos was adjusted to 200 µl and then cells were mechanically dissociated by flicking the tube 30 times and pipetting the mixture 10 times through a 200 µl tip. Cells were then transported into a clear Petri dish and GFP labeled PGCs were manually picked under fluorescence microscope with mouth pipette.,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer’s instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,The wild type Tuebingen Tu and India strains were used throughout the experiments. The transgenic line Tgkop:EGFP nanos 3’UTR citation was described before. Unless stated all embryos were raised in Holtfreter’s solution at 28.5°C and staged as described previously.,tissue:embryo|cell line:germ cell|cell type:PGCs|genotype:pigu homo,GSM8193367,GSM8193367: pigu homo bud PGCs RNA rep1; Danio rerio; RNA Seq,GSM8193367 r1,GSM8193367,1,Total RNA of oocytes were purified using RNeasy Mini kit QIAGEN 74104 as recommended protocols. Total RNA 5 μg was DNase I Fermentas EN0521 treated at 37°C for 1 h. Poly A tailed mRNA was collected using DynabeadsTM mRNA Purification Kit Invitrogen 61006. RNA seq was carried out with the SMART seq2 protocol as previously described and subjected to paired end sequencing on the Nextseq 500 Illumina platform according to the manufacturer's instructions. Notably SMART seq2 of low input RNA seq relies on polyA based amplification.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP500320,,,pigu_homo_bud_PGCs_RNA_rep1_r1.fq.gz pigu_homo_bud_PGCs_RNA_rep1_r2.fq.gz,fastq fastq,2734187100.0,9113957.0,GSM8193367 r1,0:150 1:150,A:729072634;C:614811431;G:644751435;T:745548063;N:3537,150,150,,,729072634,614811431,644751435,745548063,3537,SRX24189490,SRS20963513,SRA1842063,Tsinghua University,Tsinghua University,2,0.94018,0.93763,0.11685,0.1143,0.77749,0.78204,0.50988,0.50832,150,150,B,B,biological fallback assumption,illumina,nextseq,unknown,poly_a,unknown,sc,single_cell_plate,smartseq,,China,2024-04-08,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35474,SRR32818793,SRX28102226,SRS24458273,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4,GSM8863184,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf,GSM8863184,GSM8863184: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq,GSM8863184 r1,GSM8863184,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p48-4-READ1-Sequences.txt p48-4-READ2-Sequences.txt,fastq fastq,6624217400.0,33121087.0,GSM8863184 r1,0:100 1:100,A:1723006485;C:1604147349;G:1556891221;T:1739763662;N:408683,100,100,,,1723006485,1604147349,1556891221,1739763662,408683,SRX28102226,SRS24458273,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35475,SRR32818794,SRX28102225,SRS24458272,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3,GSM8863183,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf,GSM8863183,GSM8863183: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq,GSM8863183 r1,GSM8863183,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p48-3-READ1-Sequences.txt p48-3-READ2-Sequences.txt,fastq fastq,5127128400.0,25635642.0,GSM8863183 r1,0:100 1:100,A:1321647066;C:1250868808;G:1210591826;T:1343703952;N:316748,100,100,,,1321647066,1250868808,1210591826,1343703952,316748,SRX28102225,SRS24458272,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35476,SRR32818795,SRX28102224,SRS24458271,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2,GSM8863182,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf,GSM8863182,GSM8863182: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq,GSM8863182 r1,GSM8863182,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p48-2-READ1-Sequences.txt p48-2-READ2-Sequences.txt,fastq fastq,6832644200.0,34163221.0,GSM8863182 r1,0:100 1:100,A:1762283242;C:1668293067;G:1612470421;T:1789177247;N:420223,100,100,,,1762283242,1668293067,1612470421,1789177247,420223,SRX28102224,SRS24458271,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35477,SRR32818796,SRX28102223,SRS24458270,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1,GSM8863181,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:48 hpf,GSM8863181,GSM8863181: sorted mCherry+ tenocytes from 48 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq,GSM8863181 r1,GSM8863181,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p48-1-READ1-Sequences.txt p48-1-READ2-Sequences.txt,fastq fastq,6861200200.0,34306001.0,GSM8863181 r1,0:100 1:100,A:1765390165;C:1682522416;G:1623224185;T:1789639564;N:423870,100,100,,,1765390165,1682522416,1623224185,1789639564,423870,SRX28102223,SRS24458270,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35478,SRR32818797,SRX28102222,SRS24458269,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7,GSM8863180,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf,GSM8863180,GSM8863180: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 7; Danio rerio; RNA Seq,GSM8863180 r1,GSM8863180,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p36-7-READ1-Sequences.txt p36-7-READ2-Sequences.txt,fastq fastq,5620392000.0,28101960.0,GSM8863180 r1,0:100 1:100,A:1445709762;C:1377367138;G:1310017425;T:1486952834;N:344841,100,100,,,1445709762,1377367138,1310017425,1486952834,344841,SRX28102222,SRS24458269,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35479,SRR32818798,SRX28102221,SRS24458268,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6,GSM8863179,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf,GSM8863179,GSM8863179: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 6; Danio rerio; RNA Seq,GSM8863179 r1,GSM8863179,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p36-6-READ1-Sequences.txt p36-6-READ2-Sequences.txt,fastq fastq,7568489000.0,37842445.0,GSM8863179 r1,0:100 1:100,A:1969395695;C:1827574975;G:1754405241;T:2016644374;N:468715,100,100,,,1969395695,1827574975,1754405241,2016644374,468715,SRX28102221,SRS24458268,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35480,SRR32818799,SRX28102220,SRS24458267,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5,GSM8863178,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf,GSM8863178,GSM8863178: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 5; Danio rerio; RNA Seq,GSM8863178 r1,GSM8863178,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p36-5-READ1-Sequences.txt p36-5-READ2-Sequences.txt,fastq fastq,6657832800.0,33289164.0,GSM8863178 r1,0:100 1:100,A:1726677355;C:1613449895;G:1548951675;T:1768343661;N:410214,100,100,,,1726677355,1613449895,1548951675,1768343661,410214,SRX28102220,SRS24458267,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35481,SRR32818800,SRX28102219,SRS24458266,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4,GSM8863177,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf,GSM8863177,GSM8863177: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 4; Danio rerio; RNA Seq,GSM8863177 r1,GSM8863177,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p36-4-READ1-Sequences.txt p36-4-READ2-Sequences.txt,fastq fastq,5153263800.0,25766319.0,GSM8863177 r1,0:100 1:100,A:1334474056;C:1251026482;G:1191417010;T:1376027996;N:318256,100,100,,,1334474056,1251026482,1191417010,1376027996,318256,SRX28102219,SRS24458266,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35482,SRR32818801,SRX28102218,SRS24458265,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3,GSM8863176,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf,GSM8863176,GSM8863176: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 3; Danio rerio; RNA Seq,GSM8863176 r1,GSM8863176,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p36-3-READ1-Sequences.txt p36-3-READ2-Sequences.txt,fastq fastq,6089823000.0,30449115.0,GSM8863176 r1,0:100 1:100,A:1565216204;C:1493655703;G:1438012972;T:1592561753;N:376368,100,100,,,1565216204,1493655703,1438012972,1592561753,376368,SRX28102218,SRS24458265,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35483,SRR32818802,SRX28102217,SRS24458264,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2,GSM8863175,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf,GSM8863175,GSM8863175: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 2; Danio rerio; RNA Seq,GSM8863175 r1,GSM8863175,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p36-2-READ1-Sequences.txt p36-2-READ2-Sequences.txt,fastq fastq,5575798600.0,27878993.0,GSM8863175 r1,0:100 1:100,A:1443367045;C:1355595610;G:1298738880;T:1477753374;N:343691,100,100,,,1443367045,1355595610,1298738880,1477753374,343691,SRX28102217,SRS24458264,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 35484,SRR32818803,SRX28102216,SRS24458263,SRP572438,PRJNA1240805,Transcriptome profiling of tendon fibroblasts at the onset of embryonic muscle contraction reveals novel force responsive genes. FAC sorted tenocytes from 36 hpf vs. 48 hpf zebrafish embryos bulk RNAseq dataset,GSE292682,Transcriptome Analysis,Mechanical forces play a critical role in tendon development and function influencing cell behavior through mechanotransduction signaling pathways and subsequent extracellular matrix ECM remodeling. Here we investigate the molecular mechanisms by which tenocytes in developing zebrafish embryos respond to muscle contraction forces during the onset of swimming and cranial muscle activity. Using genome wide bulk RNA sequencing of FAC sorted tenocytes we identify novel tenocyte markers and genes involved in tendon mechanotransduction. Overall design: FAC sorted mCherry+ cells from 36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts tenocytes. 36 hpf embryos have not yet begun active muscle contraction and 48 hpf embryos are freely swimming indicating active muscle contraction onset.,,pubmed:40145570,,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1,GSM8863174,,source name:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf|geo loc name:missing|collection date:missing,sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1,Reads were mapped to zebrafish GRCz10 and quantified using STAR v2.5.2A and RSEM 1.2.31. Differential expression analysis were performed using DESeq2 v.1.30.1 Assembly: GRCz10 Supplementary files format and content: csv file includes DESeq2 normalized counts for all samples,FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos,,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,tissue:FAC sorted mCherry+ tenocytes from whole Tgscxa:mCherry embryos|cell type:mCherry+ tenocytes|genotype:WT Tgscxa:mCherry background|treatment:36 hpf,GSM8863174,GSM8863174: sorted mCherry+ tenocytes from 36 hpf Tgscxa:mCherry zebrafish embryos replicate 1; Danio rerio; RNA Seq,GSM8863174 r1,GSM8863174,1,36 hpf and 48 hpf Tgscxa:mCherry zebrafish embryos labeling tendon fibroblasts/tenocytes were dissociated with Collagenase IV Gibco 17104019 at a concentration of 6.24 mg/ml without xxx addition at a temperature of 28C for roughly 40 min homogenizing every 5 min with a P1000 pipette. Cells were filtered through a 40um filter Pluriselect usa 43 10040 50. Dissociated cell suspensions were sorted on a Bio Rad FACS Aria II cell sorter. mCherry positive cells were gated and sorted for those expressing at high levels. RNEasy Micro Kit Qiagen 74004 was used for RNA extraction of cell lysates from FAC sorted cells and the Smart seq2 protocol was utilized for cDNA library construction. Libraries were sequenced using a Hi seq 4000 sequencer Illumina at a read depth of 35M reads per replicate.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP572438,,,p36-1-READ1-Sequences.txt p36-1-READ2-Sequences.txt,fastq fastq,6686065200.0,33430326.0,GSM8863174 r1,0:100 1:100,A:1705825267;C:1656952667;G:1564381164;T:1758493189;N:412913,100,100,,,1705825267,1656952667,1564381164,1758493189,412913,SRX28102216,SRS24458263,SRA2098458,UC Irvine,UC Irvine,,,,,,,,,,,,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,United States,2025-03-23,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38457,SRR1873001,SRX914893,SRS869409,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S366,GSM1629126,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S366,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629126,GSM1629126: zf3 dis S366; Danio rerio; RNA Seq,GSM1629126,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629126,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S366.R2.fq zf3_dis_S366.R1.fq,fastq fastq,13953150.0,279063.0,GSM1629126 r1,0:25 1:25,A:3638478;C:3221565;G:3250022;T:3754586;N:88499,25,25,,,3638478,3221565,3250022,3754586,88499,SRX914893,SRS869409,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.68547,0.72347,0.17435,0.1776,0.89883,0.87645,0.78642,0.70697,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38458,SRR1873000,SRX914892,SRS869415,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S365,GSM1629125,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S365,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629125,GSM1629125: zf3 dis S365; Danio rerio; RNA Seq,GSM1629125,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629125,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S365.R1.fq zf3_dis_S365.R2.fq,fastq fastq,18319750.0,366395.0,GSM1629125 r1,0:25 1:25,A:4713431;C:4306960;G:4405843;T:4784636;N:108880,25,25,,,4713431,4306960,4405843,4784636,108880,SRX914892,SRS869415,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.45031,0.41097,0.17574,0.16675,0.91098,0.92383,0.57619,0.61898,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38459,SRR1872999,SRX914891,SRS869411,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S364,GSM1629124,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S364,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629124,GSM1629124: zf3 dis S364; Danio rerio; RNA Seq,GSM1629124,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629124,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S364.R1.fq zf3_dis_S364.R2.fq,fastq fastq,16291400.0,325828.0,GSM1629124 r1,0:25 1:25,A:4127905;C:3884549;G:3934831;T:4281925;N:62190,25,25,,,4127905,3884549,3934831,4281925,62190,SRX914891,SRS869411,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.64233,0.58456,0.18268,0.16828,0.89079,0.91056,0.69046,0.76873,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38460,SRR1872998,SRX914890,SRS869413,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S363,GSM1629123,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S363,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629123,GSM1629123: zf3 dis S363; Danio rerio; RNA Seq,GSM1629123,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629123,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S363.R1.fq zf3_dis_S363.R2.fq,fastq fastq,24979500.0,499590.0,GSM1629123 r1,0:25 1:25,A:6522125;C:5838067;G:5906327;T:6630372;N:82609,25,25,,,6522125,5838067,5906327,6630372,82609,SRX914890,SRS869413,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.78356,0.7193,0.35183,0.32737,0.85096,0.86953,0.65229,0.72787,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38461,SRR1872997,SRX914889,SRS869410,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S362,GSM1629122,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S362,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629122,GSM1629122: zf3 dis S362; Danio rerio; RNA Seq,GSM1629122,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629122,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S362.R1.fq zf3_dis_S362.R2.fq,fastq fastq,25961150.0,519223.0,GSM1629122 r1,0:25 1:25,A:6513860;C:6274276;G:6330224;T:6742925;N:99865,25,25,,,6513860,6274276,6330224,6742925,99865,SRX914889,SRS869410,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.64392,0.70212,0.20822,0.2179,0.90449,0.88544,0.7447,0.66953,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38462,SRR1872996,SRX914888,SRS869414,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S361,GSM1629121,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S361,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629121,GSM1629121: zf3 dis S361; Danio rerio; RNA Seq,GSM1629121,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629121,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S361.R1.fq zf3_dis_S361.R2.fq,fastq fastq,31158400.0,623168.0,GSM1629121 r1,0:25 1:25,A:8003929;C:7345167;G:7419409;T:8283464;N:106431,25,25,,,8003929,7345167,7419409,8283464,106431,SRX914888,SRS869414,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.69021,0.64535,0.18688,0.18054,0.86624,0.88789,0.69784,0.78517,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38463,SRR1872995,SRX914887,SRS869416,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S360,GSM1629120,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S360,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629120,GSM1629120: zf3 dis S360; Danio rerio; RNA Seq,GSM1629120,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629120,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S360.R1.fq zf3_dis_S360.R2.fq,fastq fastq,65650.0,1313.0,GSM1629120 r1,0:25 1:25,A:16756;C:15635;G:13912;T:19083;N:264,25,25,,,16756,15635,13912,19083,264,SRX914887,SRS869416,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.6792,0.7566,0.21098,0.22718,0.99823,0.99667,0.76729,0.68093,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38464,SRR1872994,SRX914886,SRS869408,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S359,GSM1629119,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S359,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629119,GSM1629119: zf3 dis S359; Danio rerio; RNA Seq,GSM1629119,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629119,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S359.R1.fq zf3_dis_S359.R2.fq,fastq fastq,11699050.0,233981.0,GSM1629119 r1,0:25 1:25,A:3029078;C:2720012;G:2748834;T:3147149;N:53977,25,25,,,3029078,2720012,2748834,3147149,53977,SRX914886,SRS869408,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.73706,0.69089,0.16704,0.16123,0.88795,0.90696,0.71161,0.78714,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38465,SRR1872993,SRX914885,SRS869417,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S358,GSM1629118,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S358,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629118,GSM1629118: zf3 dis S358; Danio rerio; RNA Seq,GSM1629118,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629118,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S358.R2.fq zf3_dis_S358.R1.fq,fastq fastq,9555800.0,191116.0,GSM1629118 r1,0:25 1:25,A:2455617;C:2236174;G:2275012;T:2547459;N:41538,25,25,,,2455617,2236174,2275012,2547459,41538,SRX914885,SRS869417,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.71513,0.67049,0.20389,0.18909,0.90289,0.91758,0.72281,0.78587,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38466,SRR1872992,SRX914884,SRS869420,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S357,GSM1629117,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S357,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629117,GSM1629117: zf3 dis S357; Danio rerio; RNA Seq,GSM1629117,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629117,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S357.R1.fq zf3_dis_S357.R2.fq,fastq fastq,6685400.0,133708.0,GSM1629117 r1,0:25 1:25,A:1794401;C:1506998;G:1499676;T:1830754;N:53571,25,25,,,1794401,1506998,1499676,1830754,53571,SRX914884,SRS869420,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.51579,0.51107,0.13925,0.12582,0.95089,0.95828,0.33071,0.8304,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38467,SRR1872991,SRX914883,SRS869418,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S356,GSM1629116,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S356,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629116,GSM1629116: zf3 dis S356; Danio rerio; RNA Seq,GSM1629116,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629116,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S356.R2.fq zf3_dis_S356.R1.fq,fastq fastq,11637750.0,232755.0,GSM1629116 r1,0:25 1:25,A:2892151;C:2796777;G:2856920;T:3041989;N:49913,25,25,,,2892151,2796777,2856920,3041989,49913,SRX914883,SRS869418,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.78167,0.71632,0.23745,0.21955,0.89262,0.91054,0.67329,0.74109,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38468,SRR1872990,SRX914882,SRS869419,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S355,GSM1629115,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S355,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629115,GSM1629115: zf3 dis S355; Danio rerio; RNA Seq,GSM1629115,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629115,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S355.R2.fq zf3_dis_S355.R1.fq,fastq fastq,16269550.0,325391.0,GSM1629115 r1,0:25 1:25,A:4085539;C:3887330;G:3971738;T:4261948;N:62995,25,25,,,4085539,3887330,3971738,4261948,62995,SRX914882,SRS869419,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.67445,0.74201,0.22487,0.24114,0.90473,0.88637,0.73772,0.66677,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38469,SRR1872989,SRX914881,SRS869421,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S354,GSM1629114,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S354,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629114,GSM1629114: zf3 dis S354; Danio rerio; RNA Seq,GSM1629114,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629114,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S354.R1.fq zf3_dis_S354.R2.fq,fastq fastq,17585450.0,351709.0,GSM1629114 r1,0:25 1:25,A:4659589;C:4039300;G:4045812;T:4733042;N:107707,25,25,,,4659589,4039300,4045812,4733042,107707,SRX914881,SRS869421,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.4878,0.45754,0.15743,0.15052,0.91849,0.9321,0.70142,0.77697,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38470,SRR1872988,SRX914880,SRS869422,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S353,GSM1629113,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S353,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629113,GSM1629113: zf3 dis S353; Danio rerio; RNA Seq,GSM1629113,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629113,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S353.R2.fq zf3_dis_S353.R1.fq,fastq fastq,14485550.0,289711.0,GSM1629113 r1,0:25 1:25,A:3738800;C:3399635;G:3435347;T:3844352;N:67416,25,25,,,3738800,3399635,3435347,3844352,67416,SRX914880,SRS869422,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.62055,0.56082,0.17925,0.17361,0.88698,0.90761,0.63705,0.72713,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38471,SRR1872987,SRX914879,SRS869427,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S352,GSM1629112,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S352,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629112,GSM1629112: zf3 dis S352; Danio rerio; RNA Seq,GSM1629112,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629112,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S352.R1.fq zf3_dis_S352.R2.fq,fastq fastq,20656250.0,413125.0,GSM1629112 r1,0:25 1:25,A:5409278;C:4778324;G:4823018;T:5565607;N:80023,25,25,,,5409278,4778324,4823018,5565607,80023,SRX914879,SRS869427,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.7596,0.69086,0.29648,0.27453,0.84843,0.87265,0.65665,0.73501,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38472,SRR1872986,SRX914878,SRS869407,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S351,GSM1629111,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S351,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629111,GSM1629111: zf3 dis S351; Danio rerio; RNA Seq,GSM1629111,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629111,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S351.R2.fq zf3_dis_S351.R1.fq,fastq fastq,18878500.0,377570.0,GSM1629111 r1,0:25 1:25,A:4794224;C:4526355;G:4554783;T:4925799;N:77339,25,25,,,4794224,4526355,4554783,4925799,77339,SRX914878,SRS869407,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.59735,0.65152,0.17597,0.18275,0.91204,0.89367,0.73252,0.66132,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38473,SRR1872985,SRX914877,SRS869426,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S350,GSM1629110,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S350,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629110,GSM1629110: zf3 dis S350; Danio rerio; RNA Seq,GSM1629110,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629110,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S350.R2.fq zf3_dis_S350.R1.fq,fastq fastq,18015150.0,360303.0,GSM1629110 r1,0:25 1:25,A:4757233;C:4120910;G:4152471;T:4865140;N:119396,25,25,,,4757233,4120910,4152471,4865140,119396,SRX914877,SRS869426,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.59623,0.55628,0.16688,0.15933,0.89016,0.90946,0.68088,0.39729,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38474,SRR1872984,SRX914876,SRS869425,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S349,GSM1629109,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S349,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629109,GSM1629109: zf3 dis S349; Danio rerio; RNA Seq,GSM1629109,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629109,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S349.R1.fq zf3_dis_S349.R2.fq,fastq fastq,18552750.0,371055.0,GSM1629109 r1,0:25 1:25,A:4713675;C:4414123;G:4487632;T:4865002;N:72318,25,25,,,4713675,4414123,4487632,4865002,72318,SRX914876,SRS869425,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.73956,0.66864,0.29185,0.26915,0.8728,0.89185,0.64518,0.71455,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38475,SRR1872983,SRX914875,SRS869424,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S348,GSM1629108,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S348,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629108,GSM1629108: zf3 dis S348; Danio rerio; RNA Seq,GSM1629108,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629108,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S348.R1.fq zf3_dis_S348.R2.fq,fastq fastq,18364000.0,367280.0,GSM1629108 r1,0:25 1:25,A:4467688;C:4489708;G:4651022;T:4688256;N:67326,25,25,,,4467688,4489708,4651022,4688256,67326,SRX914875,SRS869424,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.82371,0.74488,0.27118,0.25268,0.86758,0.8886,0.65639,0.72281,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38476,SRR1872982,SRX914874,SRS869429,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S347,GSM1629107,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S347,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629107,GSM1629107: zf3 dis S347; Danio rerio; RNA Seq,GSM1629107,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629107,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S347.R1.fq zf3_dis_S347.R2.fq,fastq fastq,21064200.0,421284.0,GSM1629107 r1,0:25 1:25,A:5412410;C:4977004;G:4997675;T:5572725;N:104386,25,25,,,5412410,4977004,4997675,5572725,104386,SRX914874,SRS869429,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.5825,0.54487,0.15602,0.14912,0.89053,0.91094,0.71218,0.79095,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38477,SRR1872981,SRX914873,SRS869428,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S346,GSM1629106,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S346,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629106,GSM1629106: zf3 dis S346; Danio rerio; RNA Seq,GSM1629106,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629106,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S346.R1.fq zf3_dis_S346.R2.fq,fastq fastq,14579650.0,291593.0,GSM1629106 r1,0:25 1:25,A:3652547;C:3477071;G:3552653;T:3844470;N:52909,25,25,,,3652547,3477071,3552653,3844470,52909,SRX914873,SRS869428,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.84569,0.77715,0.24465,0.23283,0.87651,0.89706,0.69586,0.77338,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38478,SRR1872980,SRX914872,SRS869430,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S345,GSM1629105,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S345,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629105,GSM1629105: zf3 dis S345; Danio rerio; RNA Seq,GSM1629105,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629105,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S345.R1.fq zf3_dis_S345.R2.fq,fastq fastq,19894100.0,397882.0,GSM1629105 r1,0:25 1:25,A:4978487;C:4785641;G:4877454;T:5178846;N:73672,25,25,,,4978487,4785641,4877454,5178846,73672,SRX914872,SRS869430,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.80074,0.73644,0.28821,0.27089,0.87452,0.89213,0.68194,0.75059,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38479,SRR1872979,SRX914871,SRS869433,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S344,GSM1629104,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S344,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629104,GSM1629104: zf3 dis S344; Danio rerio; RNA Seq,GSM1629104,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629104,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S344.R2.fq zf3_dis_S344.R1.fq,fastq fastq,21335200.0,426704.0,GSM1629104 r1,0:25 1:25,A:5277911;C:5144153;G:5264908;T:5565367;N:82861,25,25,,,5277911,5144153,5264908,5565367,82861,SRX914871,SRS869433,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.72171,0.80382,0.21052,0.21995,0.89061,0.86695,0.72932,0.64495,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38480,SRR1872978,SRX914870,SRS869431,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S343,GSM1629103,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S343,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629103,GSM1629103: zf3 dis S343; Danio rerio; RNA Seq,GSM1629103,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629103,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S343.R1.fq zf3_dis_S343.R2.fq,fastq fastq,19911000.0,398220.0,GSM1629103 r1,0:25 1:25,A:4923353;C:4815086;G:4933744;T:5166820;N:71997,25,25,,,4923353,4815086,4933744,5166820,71997,SRX914870,SRS869431,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.79232,0.71735,0.23984,0.22867,0.88943,0.91074,0.64925,0.73421,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 38481,SRR1872977,SRX914869,SRS869432,SRP055996,PRJNA277737,Spatial reconstruction of single cell gene expression,GSE66688,Transcriptome Analysis,Spatial localization is a key determinant of cellular fate and behavior but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast single cell RNA seq allows for deep profiling of cellular gene expression but established methods separate cells from their native spatial context. Here we present Seurat a computational strategy to infer cellular localization by integrating single cell RNA seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish Danio rerio embryos inferring a transcriptome wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches and used it to identify a set of archetypal expression patterns and spatial markers. Additionally Seurat correctly localizes rare subpopulations accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. Overall design: We generated single cell RNA seq profiles from dissociated cells from developing zebrafish embryos late blastula stage 50% epiboly,,pubmed:25867923,,zf3 dis S1800,GSM1629102,,tissue:50% Epiboly stage|group:experimental batch 3,zf3 dis S1800,To map reads we slightly modified the Zv9 reference transcriptome since our reads were expected to originate from the 5’ end of each mRNA molecule which could cause problems if the reference gene models had an incorrect annotation for the transcription start site TSS. To address this we extended the TSS for all Zv9 genes by 100 bases upstream to allow for minor fluctuations. We then aligned read pairs directly to this modified reference transcriptome using Bowtie with the following parameters: q phred33 quals n 2 l 25 I 1 X 2000 a m 200. As expected following mapping our reads overwhelmingly originated from near the TSS. To quantify gene expression we leveraged the 5 bp Random Molecular Tags RMTs that were associated with each sequencing read pair. For each annotated gene in Zv9 we identified all read pairs that mapped to the correct strand and collected each of the 5 bp RMTs that were associated with these reads. We collapsed duplicate RMT sequences together in order to calculate the number of distinct RMTs associated with each gene. We quantified gene expression for 1 152 single cell libraries and identified a subset of 207 failed/low quality libraries with poor transcriptome complexity < 2 000 genes detected per cell. post excluding these remaining dataset of 945 cells on average we identified 47 000 unique molecules per sequencing library corresponding to the detection of 3 400 genes per single cell. Supplementary files format and content: zdata.expMatrix.txt Expression matrix for all samples,50% Epiboly stage,,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,Fertilized eggs from TL/AB in crosses were incubated in 1 mg/ml pronase Protease from Streptomyces griseus Sigma Aldrich in a glass dish for 4–5 minutes until the chorion began to blister. The embryos were submerged in 200 ml of embryo medium in a glass beaker without xxx them to contact air or plastic both of which will cause the embryos to burst. The medium was poured off and new medium was vigorously added again without xxx embryos to contact air twice in order to mechanically remove the chorions. The embryos were cultured in petri dishes coated with 2% agarose to avoid contact with plastic either at 23°C or 28°C until they reached 50% epiboly about 6 hpf at 28°C. At 50% epiboly single embryos were visually confirmed to be at the correct stage,group:experimental batch 3,GSM1629102,GSM1629102: zf3 dis S1800; Danio rerio; RNA Seq,GSM1629102,,1,Two pairs of watchmaker forceps were used to dissect the blastula cap of the embryo away from the yolk. First one pair of forceps was used to hold and rotate the cap while the other was used to cut and pinch away the yolk that extended below the blastula cap. Then the blastula cap was cut slightly up the side which exposed the yolk that was inside of the blastula cap which could then be gently peeled away. The blastula cap was transferred by pipette into a microfuge tube that contained 60 μl of DMEM/F12 media. The cells were dissociated by vigorously flicking the tube 10 times and then pipetting the entire volume twice while visually confirming that dissociation had occurred. A timer was started at this time to track the amount of time the embryo had been dissociated. If cell clumps were still visible the tube was flicked again. 180 μl of DMEM/F12 was added to dilute the cell mixture then 120 μl of the diluted cell mixture was pipetted across the surface of a new agarose coated dish filled with DMEM/F12 media. To collect cells a P2 pipettor was used while observing the cells under the dissecting scope to collect 0.5 μl of media that contained a single cell. This was pipetted into 3 μl of TCL lysis buffer Qiagen in the lid of a PCR strip and mixed 3 times to ensure that lysis occurred. post collection of 8 cells the entire strip of lids was snapped into a 96 well plate and kept on dry ice. We used a modified strand specific single cell RNA seq protocol based on the SMART template switching method where the template switch oligonucleotide included a stretch of 5 randomized nucleotides thereby tagging each mRNA molecule with a random molecular tag RMT prior to PCR to mitigate amplification bias. Furthermore we used a modified library preparation protocol that shares similarities with Soumillon et al. and is based on the Nextera Sample Preparation Kit. It selectively amplifies the 5’ transcript end retains strand information and is compatible with standard Illumina sequencing primers.,GEO Accession:GSM1629102,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP055996,,loader:fastq load.py,zf3_dis_S1800.R1.fq zf3_dis_S1800.R2.fq,fastq fastq,10790700.0,215814.0,GSM1629102 r1,0:25 1:25,A:2721576;C:2556263;G:2606994;T:2865815;N:40052,25,25,,,2721576,2556263,2606994,2865815,40052,SRX914869,SRS869432,SRA246089,GEO,"Satija Lab, New York Genome Center",2,0.76882,0.8569,0.22815,0.24284,0.90851,0.88925,0.73921,0.67204,25,25,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,United States,2015-03-09,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures