rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
3015,ERR1396841,ERX1468100,ERS1051448,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 C7,SAMEA3864314,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#24,15616955,Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ATTCCT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#24.cram,cram,252742350.0,5054847.0,SC RUN 18732 2#24,0:50,A:72444190;C:64568625;G:62796637;T:52911792;N:21106,50,,,,72444190,64568625,62796637,52911792,21106,ERX1468100,ERS1051448,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.61824,,0.09608,,0.8842,,0.56978,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Embryo Imprecise,All anatomical structures
3039,ERR1396817,ERX1468076,ERS1051448,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 C7,SAMEA3864314,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#24,15616955,Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ATTCCT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#24.cram,cram,258624300.0,5172486.0,SC RUN 18732 1#24,0:50,A:74123846;C:66047722;G:64286422;T:54141623;N:24687,50,,,,74123846,66047722,64286422,54141623,24687,ERX1468076,ERS1051448,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.62009,,0.09612,,0.88434,,0.55718,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Embryo Imprecise,All anatomical structures
8055,ERR022484,ERX008924,ERS017427,ERP000400,PRJEB2333,Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer,E-MTAB-434,Other,,,,,E MTAB 434:ZF 2cells,SAMEA898400,Wellcome Sanger Institute,Alias:E MTAB 434:ZF 2cells|Broker name:ArrayExpress|Description:Protocols: Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was made into an RNAseq Illumina library following the manufacturer's protocol including a DNase treatment between to 2 rounds of polyA pull down. The libraries have fragment size of 250 to 300 bp.|DevelopmentalStage:embryo|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2011 03 10T17:55:05Z|INSDC last update:2018 03 08T15:25:14Z|INSDC status:public|SRA accession:ERS017427|Sample Name:ERS017427|Sex:mixed|StrainOrLine:Tuebingen|Title:ZF 2cells,,,,,,,,,Illumina Genome Analyzer II paired end sequencing; Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer,E MTAB 434:sequencing of Zebrafish embryo 2cells,RNA from Zebrafish embryo 2cells,Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer,Zebrafish embyos or tissues were collected from a Tuebingen strain incross and grown at 28 C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were resuspended RNase free 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was made into an RNAseq Illumina library following the manufacturer's protocol including a DNase treatment between to 2 rounds of polyA pull down. The libraries have fragment size of 250 to 300 bp.,Experimental Factor: DEVELPOMENTAL STAGE:embryo|Experimental Factor: ORGANISM PART:cell,FL-cDNA,TRANSCRIPTOMIC,unspecified,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP000400,Illumina Genome Analyzer II paired end sequencing; Sequencing the Zebrafish transcriptome form a range of tissues and developmental stages using the Illumina Genome Analyzer,ENA FIRST PUBLIC:2011 03 10|ENA LAST UPDATE:2018 11 16,4946_5.srf,srf,3947547008.0,25970704.0,E MTAB 434:4946 5.srf,0:76 1:76,A:1069302461;C:914233601;G:902631356;T:1055986090;N:5393500,76,76,,,1069302461,914233601,902631356,1055986090,5393500,ERX008924,ERS017427,ERA015179,SC|Wellcome Trust Sanger Institute,SC|Wellcome Trust Sanger Institute,2,0.93356,0.93346,0.03988,0.04022,0.79135,0.79198,0.48864,0.48464,76,76,B,B,biological fallback assumption,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United Kingdom,2011-03-10,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
8088,ERR034127,ERX012653,ERS032268,ERP000635,PRJEB2512,The Zebrafish transcriptome during early development,KI-BN-JKE-DRERIO-RNASEQ-2011,Transcriptome Analysis,Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions.,,,RNA extracted from zebrafish embryo at 50% epiboly stage,zebrafish embryo 50 epiboly,SAMEA791629,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791629|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 50epiboly|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 50epiboly|sex:mixed|strain:Tuebingen,,,,,,,,,Transcriptome profiling of early zebrafish development,KI BN JKE DRERIO RNASEQ 2011 50epiboly,JKE Drerio rna seq,Transcriptome profiling of 50% epiboly stages of zebrafish embryos.,Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems.,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ABI_SOLID,AB SOLiD System 3.0,500Application ReadForward1,ERP000635,AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development,ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-50epiboly_QV.qual.gz,SOLiD_native SOLiD_native,3929903550.0,78598071.0,KI BN JKE DRERIO RNASEQ 2011 50epiboly,0:50,,50,,,,,,,,,ERX012653,ERS032268,ERA029959,KI-BN|Department of Biosciences and Nutrition,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",1,0.60757,,0.09893,,0.94899,,0.77821,,50,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,unknown,unknown,,Sweden,2011-06-09,Gastrula,Embryo,Embryo Imprecise,All anatomical structures
8089,ERR034126,ERX012652,ERS032267,ERP000635,PRJEB2512,The Zebrafish transcriptome during early development,KI-BN-JKE-DRERIO-RNASEQ-2011,Transcriptome Analysis,Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions.,,,RNA extracted from zebrafish embryo at 512 cell stage,zebrafish embryo 512 cell,SAMEA791632,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791632|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 512cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 512cell|sex:mixed|strain:Tuebingen,,,,,,,,,Transcriptome profiling of early zebrafish development,KI BN JKE DRERIO RNASEQ 2011 512cell,JKE Drerio rna seq,Transcriptome profiling of 512 cell stage of zebrafish embryos.,Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems.,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ABI_SOLID,AB SOLiD System 3.0,500Application ReadForward1,ERP000635,AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development,ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-2011-512cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-512cell_QV.qual.gz,SOLiD_native SOLiD_native,3918756250.0,78375125.0,KI BN JKE DRERIO RNASEQ 2011 512cell,0:50,,50,,,,,,,,,ERX012652,ERS032267,ERA029959,KI-BN|Department of Biosciences and Nutrition,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",1,0.63824,,0.09111,,0.91969,,0.73496,,50,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,unknown,unknown,,Sweden,2011-06-09,Blastula,Embryo,Embryo Imprecise,All anatomical structures
8090,ERR034125,ERX012651,ERS032266,ERP000635,PRJEB2512,The Zebrafish transcriptome during early development,KI-BN-JKE-DRERIO-RNASEQ-2011,Transcriptome Analysis,Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions.,,,RNA extracted from zebrafish embryo at 16 cell stage,zebrafish embryo 16 cell,SAMEA791631,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791631|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 16cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 16cell|sex:mixed|strain:Tuebingen,,,,,,,,,Transcriptome profiling of early zebrafish development,KI BN JKE DRERIO RNASEQ 2011 16cell,JKE Drerio rna seq,Transcriptome profiling of 16 cell stage of zebrafish embryos.,Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems.,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ABI_SOLID,AB SOLiD System 3.0,500Application ReadForward1,ERP000635,AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development,ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-2011-16cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-16cell_QV.qual.gz,SOLiD_native SOLiD_native,4256756500.0,85135130.0,KI BN JKE DRERIO RNASEQ 2011 16cell,0:50,,50,,,,,,,,,ERX012651,ERS032266,ERA029959,KI-BN|Department of Biosciences and Nutrition,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",1,0.57946,,0.08115,,0.91896,,0.72164,,50,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,unknown,unknown,,Sweden,2011-06-09,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
8091,ERR034124,ERX012650,ERS032265,ERP000635,PRJEB2512,The Zebrafish transcriptome during early development,KI-BN-JKE-DRERIO-RNASEQ-2011,Transcriptome Analysis,Background: Zebrafish Danio rerio is an important model for the study of early vertebrate development. The transition from fertilized egg to embryo is accompanied by a multitude of changes in gene expression and the transcriptional events that underlie these processes have not been fully characterized. In this study we use RNA Seq to characterize and compare the transcriptome of four early developmental stages in zebrafish on a global scale. Results: An average of 79M total reads were detected from the different stages. Out of the total number of reads 65% 73% reads were successfully mapped to the zebrafish genome and 36% 44% out of those were uniquely mapped. The total number of detected unique gene transcripts was 11187 of which 10096 of these were already present at 1 cell stage. The largest number of common transcripts was observed between 1 cell stage and 16 cell stage. An enrichment of gene transcripts with molecular functions of DNA binding protein folding and processing as well as metal ion binding was observed with progression of development. To confirm our RNA Seq results and to further investigate the developmental expression of specific genes the transcript levels of a subset of genes were analyzed using TaqMan® array micro fluidic card TLDA. Conclusion: Clustering analysis of the detected transcripts show a majority of gene transcripts being present at steady levels with a minority of the gene transcripts clustering as increasing or decreasing in expression during development. Developmental stages pre MBT were similar when comparing highly expressed genes whereas 50% epiboly stage differed from the earlier three stages in highly expressed genes number of uniquely expressed genes and enrichment of GO molecular functions.,,,RNA extracted from zebrafish embryo at 1 cell stage,zebrafish embryo 1 cell,SAMEA791630,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",ENA first public:2011 06 09|ENA last update:2018 03 08|External Id:SAMEA791630|INSDC center alias:KI BN|INSDC center name:Department of Biosciences and Nutrition Karolinska Institutet Sweden|INSDC first public:2011 06 09T11:04:10Z|INSDC last update:2018 03 08T15:26:39Z|INSDC status:public|Submitter Id:KI BN JKE DRERIO RNASEQ 2011 1cell|common name:zebrafish|sample name:KI BN JKE DRERIO RNASEQ 2011 1cell|sex:mixed|strain:Tuebingen,,,,,,,,,Transcriptome profiling of early zebrafish development,KI BN JKE DRERIO RNASEQ 2011 1cell,JKE Drerio rna seq,Transcriptome profiling of 1 cell stage of zebrafish embryos.,Total RNA was extracted from approximately 150 embryos per developmental stage using Trireagent Sigma Aldrich. The total RNA was then processed further according to the Small RNA Expression Kit Applied Biosystems.,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ABI_SOLID,AB SOLiD System 3.0,500Application ReadForward1,ERP000635,AB SOLiD System 3.0 sequencing; Transcriptome profiling of early zebrafish development,ENA FIRST PUBLIC:2011 06 09|ENA LAST UPDATE:2018 11 16,KI-BN-JKE-DRERIO-RNASEQ-2011-1cell.csfasta.gz KI-BN-JKE-DRERIO-RNASEQ-2011-1cell_QV.qual.gz,SOLiD_native SOLiD_native,3676380950.0,73527619.0,KI BN JKE DRERIO RNASEQ 2011 1cell,0:50,,50,,,,,,,,,ERX012650,ERS032265,ERA029959,KI-BN|Department of Biosciences and Nutrition,"Department of Biosciences and Nutrition, Karolinska Institutet, Sweden",1,0.64855,,0.08432,,0.9052,,0.74223,,50,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,unknown,unknown,,Sweden,2011-06-09,Zygote,Embryo,Embryo Imprecise,All anatomical structures
9361,ERR3011947,ERX3014407,ERS2994081,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Flutamide 2,SAMEA5186582,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186582|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 2|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Flutamide 2 s,Flutamide 2 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:flutamide|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Flutamide_2_R1.fastq.gz,fastq,1754963940.0,23552243.0,E MTAB 7283:Flutamide 2,0:74.51 1:0,A:455444321;C:410713896;G:385640226;T:503155736;N:9761,74,0,,,455444321,410713896,385640226,503155736,9761,ERX3014407,ERS2994081,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94351,,0.11595,,0.67483,,0.48762,,73,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures
9362,ERR3011946,ERX3014406,ERS2994080,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Flutamide 1,SAMEA5186581,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186581|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 1|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Flutamide 1 s,Flutamide 1 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:flutamide|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Flutamide_1_R1.fastq.gz,fastq,1631102863.0,21898245.0,E MTAB 7283:Flutamide 1,0:74.49 1:0,A:424378341;C:380806325;G:358128992;T:467779945;N:9260,74,0,,,424378341,380806325,358128992,467779945,9260,ERX3014406,ERS2994080,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94332,,0.11797,,0.67596,,0.48847,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures
9363,ERR3011945,ERX3014405,ERS2994079,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,DMSO 2,SAMEA5186580,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186580|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 2|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:DMSO 2 s,DMSO 2 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_DMSO_2_R1.fastq.gz,fastq,1811573293.0,24316929.0,E MTAB 7283:DMSO 2,0:74.50 1:0,A:470888315;C:423635861;G:396796840;T:520242179;N:10098,74,0,,,470888315,423635861,396796840,520242179,10098,ERX3014405,ERS2994079,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94219,,0.12305,,0.67184,,0.47704,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures
9364,ERR3011944,ERX3014404,ERS2994078,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,DMSO 1,SAMEA5186579,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186579|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 1|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:DMSO 1 s,DMSO 1 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_DMSO_1_R1.fastq.gz,fastq,1609807409.0,21611475.0,E MTAB 7283:DMSO 1,0:74.49 1:0,A:420253680;C:374436301;G:352526427;T:462581933;N:9068,74,0,,,420253680,374436301,352526427,462581933,9068,ERX3014404,ERS2994078,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94094,,0.12292,,0.67006,,0.48442,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures
9365,ERR3011943,ERX3014403,ERS2994077,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Cyproter1 2,SAMEA5186578,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186578|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 2|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Cyproterone 2 s,Cyproterone 2 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:cyproter1|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Cyproterone_2_R1.fastq.gz,fastq,1823142918.0,24468337.0,E MTAB 7283:Cyproterone 2,0:74.51 1:0,A:469387174;C:428783310;G:403791044;T:521171021;N:10369,74,0,,,469387174,428783310,403791044,521171021,10369,ERX3014403,ERS2994077,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.9432,,0.11718,,0.67389,,0.4768,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures
9366,ERR3011942,ERX3014402,ERS2994076,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Cyproter1 1,SAMEA5186577,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186577|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 1|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Cyproterone 1 s,Cyproterone 1 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:cyproter1|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Cyproterone_1_R1.fastq.gz,fastq,1901027130.0,25512731.0,E MTAB 7283:Cyproterone 1,0:74.51 1:0,A:487302419;C:449208827;G:422183780;T:542321577;N:10527,74,0,,,487302419,449208827,422183780,542321577,10527,ERX3014402,ERS2994076,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94427,,0.11318,,0.67294,,0.47183,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures
9419,ERR273825,ERX248101,ERS092357,ERP001559,PRJEB3118,Zebrafish transcript profiling,Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82,Transcriptome Analysis,Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.,,,,,SAMEA1888984,SC,ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:14Z|ENA LAST UPDATE:2018 03 08T15:36:21Z|External Id:SAMEA1888984|INSDC center name:SC|INSDC first public:2013 05 13T11:13:14Z|INSDC last update:2018 03 08T15:36:21Z|INSDC status:public|Submitter Id:hu2117 mutant vs wild type sc 2012 02 06T13:11:11Z 1107268|common name:zebrafish|sample description:3 prime end enriched mRNA from 3 morphological mutant hu2117 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:hu2117 mutant vs wild type sc 2012 02 06T13:11:11Z 1107268|scientific name:Danio rerio,,,,,,,,,1,SC EXP 6316 8,2387558,Illumina sequencing of library 2387558 constructed from sample accession ERS092357 for study accession ERP001559.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001559,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16,6316_8.bam,bam,12715227300.0,84768182.0,SC RUN 6316 8,0:75 1:75,A:3986328155;C:1983554902;G:2466211000;T:4277430579;N:1702664,75,75,,,3986328155,1983554902,2466211000,4277430579,1702664,ERX248101,ERS092357,ERA212579,SC,Wellcome Sanger Institute,2,0.06657,0.60346,0.04569,0.19203,0.9767,0.82014,0.52373,0.4048,75,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-05-13,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
9420,ERR273824,ERX248100,ERS092356,ERP001559,PRJEB3118,Zebrafish transcript profiling,Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82,Transcriptome Analysis,Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.,,,,,SAMEA1889000,SC,ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:13Z|ENA LAST UPDATE:2018 03 08T15:36:25Z|External Id:SAMEA1889000|INSDC center name:SC|INSDC first public:2013 05 13T11:13:13Z|INSDC last update:2018 03 08T15:36:25Z|INSDC status:public|Submitter Id:e48 mutant vs wild type sc 2012 02 06T13:11:09Z 1107267|common name:zebrafish|sample description:3 prime end enriched mRNA from 3 morphological mutant e48 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:e48 mutant vs wild type sc 2012 02 06T13:11:09Z 1107267|scientific name:Danio rerio,,,,,,,,,1,SC EXP 6316 7,2387557,Illumina sequencing of library 2387557 constructed from sample accession ERS092356 for study accession ERP001559.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001559,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16,6316_7.bam,bam,17475932100.0,116506214.0,SC RUN 6316 7,0:75 1:75,A:5548228936;C:2693024343;G:3365940794;T:5867204994;N:1533033,75,75,,,5548228936,2693024343,3365940794,5867204994,1533033,ERX248100,ERS092356,ERA212579,SC,Wellcome Sanger Institute,2,0.05939,0.59457,0.04089,0.19671,0.98068,0.838,0.46304,0.62741,75,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-05-13,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
9421,ERR273823,ERX248099,ERS092354,ERP001559,PRJEB3118,Zebrafish transcript profiling,Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82,Transcriptome Analysis,Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.,,,,,SAMEA1889008,SC,ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:13Z|ENA LAST UPDATE:2018 03 08T15:36:21Z|External Id:SAMEA1889008|INSDC center name:SC|INSDC first public:2013 05 13T11:13:13Z|INSDC last update:2018 03 08T15:36:21Z|INSDC status:public|Submitter Id:hu3332 mutant vs wild type sc 2012 02 06T13:11:07Z 1107265|common name:zebrafish|sample description:3 prime end enriched mRNA from 3 morphological mutant hu3332 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:hu3332 mutant vs wild type sc 2012 02 06T13:11:07Z 1107265|scientific name:Danio rerio,,,,,,,,,1,SC EXP 6316 5,2387555,Illumina sequencing of library 2387555 constructed from sample accession ERS092354 for study accession ERP001559.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001559,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16,6316_5.bam,bam,13995917850.0,93306119.0,SC RUN 6316 5,0:75 1:75,A:4367273029;C:2176748810;G:2714026832;T:4736121060;N:1748119,75,75,,,4367273029,2176748810,2714026832,4736121060,1748119,ERX248099,ERS092354,ERA212579,SC,Wellcome Sanger Institute,2,0.06401,0.62019,0.04224,0.18728,0.97723,0.81071,0.461,0.55379,75,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-05-13,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
9422,ERR273822,ERX248098,ERS092063,ERP001559,PRJEB3118,Zebrafish transcript profiling,Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82,Transcriptome Analysis,Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.,,,,,SAMEA1888996,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:13Z|ENA LAST UPDATE:2018 03 08T15:36:13Z|External Id:SAMEA1888996|INSDC center name:SC|INSDC first public:2013 05 13T11:13:13Z|INSDC last update:2018 03 08T15:36:13Z|INSDC status:public|Submitter Id:sa0058 mutant vs wild type sc 2012 02 06T13:05:07Z 265521|common name:zebrafish|sample description:33 prime end enriched mRNA from 3 morphological mutant sa0058 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:sa0058 mutant vs wild type sc 2012 02 06T13:05:07Z 265521|scientific name:Danio rerio,,,,,,,,,1,SC EXP 5287 7,449230,Illumina sequencing of library 449230 constructed from sample accession ERS092063 for study accession ERP001559.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001559,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16,5287_7.bam,bam,2216402460.0,20522245.0,SC RUN 5287 7,0:54 1:54,A:646882787;C:346392353;G:394060191;T:827745173;N:1321956,54,54,,,646882787,346392353,394060191,827745173,1321956,ERX248098,ERS092063,ERA212579,SC,Wellcome Sanger Institute,2,0.02565,0.72009,0.01691,0.21429,0.98725,0.78944,0.62084,0.61278,54,54,T,B,mate1 technical by mapping diff,illumina,early_illumina,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-05-13,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
9651,ERR3266392,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L001_R1_001.fastq.gz,fastq,603238067.0,8014716.0,E MTAB 7846:sponge tdr gfp positive rep2 lane1,0:75.27 1:0,A:164797697;C:136552121;G:141138007;T:160737152;N:13090,75,0,,,164797697,136552121,141138007,160737152,13090,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95083,,0.06432,,0.71532,,0.50098,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9652,ERR3266393,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L002_R1_001.fastq.gz,fastq,603749720.0,8021069.0,E MTAB 7846:sponge tdr gfp positive rep2 lane2,0:75.27 1:0,A:164972969;C:136661417;G:141205792;T:160896264;N:13278,75,0,,,164972969,136661417,141205792,160896264,13278,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.951,,0.06542,,0.71768,,0.50051,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9653,ERR3266394,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L003_R1_001.fastq.gz,fastq,608154053.0,8079704.0,E MTAB 7846:sponge tdr gfp positive rep2 lane3,0:75.27 1:0,A:166117918;C:137731172;G:142320339;T:161970092;N:14532,75,0,,,166117918,137731172,142320339,161970092,14532,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95155,,0.0657,,0.71634,,0.49493,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9654,ERR3266395,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L004_R1_001.fastq.gz,fastq,599143392.0,7959897.0,E MTAB 7846:sponge tdr gfp positive rep2 lane4,0:75.27 1:0,A:163706904;C:135622453;G:140192351;T:159605249;N:16435,75,0,,,163706904,135622453,140192351,159605249,16435,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95061,,0.06431,,0.71764,,0.50166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9655,ERR3266388,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L001_R1_001.fastq.gz,fastq,616761505.0,8202480.0,E MTAB 7846:sponge tdr gfp positive rep1 lane1,0:75.19 1:0,A:168679238;C:139548565;G:143969797;T:164545362;N:18543,75,0,,,168679238,139548565,143969797,164545362,18543,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95019,,0.06806,,0.7097,,0.50337,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9656,ERR3266389,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L002_R1_001.fastq.gz,fastq,617529482.0,8212485.0,E MTAB 7846:sponge tdr gfp positive rep1 lane2,0:75.19 1:0,A:168925757;C:139655387;G:144096837;T:164831236;N:20265,75,0,,,168925757,139655387,144096837,164831236,20265,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9492,,0.06753,,0.712,,0.49881,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9657,ERR3266390,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L003_R1_001.fastq.gz,fastq,624156883.0,8300861.0,E MTAB 7846:sponge tdr gfp positive rep1 lane3,0:75.19 1:0,A:170696950;C:141302376;G:145759286;T:166377781;N:20490,75,0,,,170696950,141302376,145759286,166377781,20490,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94917,,0.06724,,0.71291,,0.50783,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9658,ERR3266391,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L004_R1_001.fastq.gz,fastq,615013615.0,8179180.0,E MTAB 7846:sponge tdr gfp positive rep1 lane4,0:75.19 1:0,A:168237742;C:139106952;G:143535658;T:164110735;N:22528,75,0,,,168237742,139106952,143535658,164110735,22528,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94892,,0.06723,,0.71206,,0.50775,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9659,ERR3266384,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L001_R1_001.fastq.gz,fastq,659562366.0,8762947.0,E MTAB 7846:sponge tdr gfp negative rep2 lane1,0:75.27 1:0,A:178744772;C:150091912;G:155092318;T:175619332;N:14032,75,0,,,178744772,150091912,155092318,175619332,14032,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9517,,0.06908,,0.70822,,0.48025,,73,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9660,ERR3266385,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L002_R1_001.fastq.gz,fastq,658688825.0,8751176.0,E MTAB 7846:sponge tdr gfp negative rep2 lane2,0:75.27 1:0,A:178540155;C:149844100;G:154850294;T:175438757;N:15519,75,0,,,178540155,149844100,154850294,175438757,15519,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95059,,0.06748,,0.70806,,0.48177,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9661,ERR3266386,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L003_R1_001.fastq.gz,fastq,665901310.0,8846927.0,E MTAB 7846:sponge tdr gfp negative rep2 lane3,0:75.27 1:0,A:180412445;C:151589489;G:156677030;T:177206192;N:16154,75,0,,,180412445,151589489,156677030,177206192,16154,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95095,,0.06855,,0.7082,,0.4787,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9662,ERR3266387,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L004_R1_001.fastq.gz,fastq,655674573.0,8711278.0,E MTAB 7846:sponge tdr gfp negative rep2 lane4,0:75.27 1:0,A:177658097;C:149188009;G:154201531;T:174609176;N:17760,75,0,,,177658097,149188009,154201531,174609176,17760,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9503,,0.06838,,0.70926,,0.47475,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9663,ERR3266380,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L001_R1_001.fastq.gz,fastq,634491637.0,8440052.0,E MTAB 7846:sponge tdr gfp negative rep1 lane1,0:75.18 1:0,A:170881257;C:145535643;G:150561786;T:167495156;N:17795,75,0,,,170881257,145535643,150561786,167495156,17795,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94996,,0.05672,,0.70571,,0.48691,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9664,ERR3266381,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L002_R1_001.fastq.gz,fastq,632900752.0,8418846.0,E MTAB 7846:sponge tdr gfp negative rep1 lane2,0:75.18 1:0,A:170454908;C:145141392;G:150172752;T:167112562;N:19138,75,0,,,170454908,145141392,150172752,167112562,19138,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94905,,0.05627,,0.70457,,0.4865,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9665,ERR3266382,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L003_R1_001.fastq.gz,fastq,638530115.0,8494045.0,E MTAB 7846:sponge tdr gfp negative rep1 lane3,0:75.17 1:0,A:171907482;C:146526309;G:151612209;T:168464163;N:19952,75,0,,,171907482,146526309,151612209,168464163,19952,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94919,,0.05578,,0.70849,,0.48073,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9666,ERR3266383,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L004_R1_001.fastq.gz,fastq,627433322.0,8346505.0,E MTAB 7846:sponge tdr gfp negative rep1 lane4,0:75.17 1:0,A:169016383;C:143886824;G:148914725;T:165593528;N:21862,75,0,,,169016383,143886824,148914725,165593528,21862,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94993,,0.05721,,0.7052,,0.48878,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9667,ERR3266376,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L001_R1_001.fastq.gz,fastq,618672195.0,8218047.0,E MTAB 7846:sponge isl gfp positive rep2 lane1,0:75.28 1:0,A:166422886;C:142212204;G:146857539;T:163167819;N:11747,75,0,,,166422886,142212204,146857539,163167819,11747,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94979,,0.08351,,0.70863,,0.47581,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9668,ERR3266377,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L002_R1_001.fastq.gz,fastq,618709102.0,8218295.0,E MTAB 7846:sponge isl gfp positive rep2 lane2,0:75.28 1:0,A:166470432;C:142189977;G:146819280;T:163216323;N:13090,75,0,,,166470432,142189977,146819280,163216323,13090,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94977,,0.08255,,0.70644,,0.47228,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9669,ERR3266378,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L003_R1_001.fastq.gz,fastq,625353059.0,8306375.0,E MTAB 7846:sponge isl gfp positive rep2 lane3,0:75.29 1:0,A:168233274;C:143793178;G:148510556;T:164802476;N:13575,75,0,,,168233274,143793178,148510556,164802476,13575,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95014,,0.08368,,0.70743,,0.47846,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9670,ERR3266379,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L004_R1_001.fastq.gz,fastq,615204990.0,8171748.0,E MTAB 7846:sponge isl gfp positive rep2 lane4,0:75.28 1:0,A:165565861;C:141380152;G:146028839;T:162214263;N:15875,75,0,,,165565861,141380152,146028839,162214263,15875,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94954,,0.08233,,0.70834,,0.48166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9671,ERR3266372,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L001_R1_001.fastq.gz,fastq,626474467.0,8318996.0,E MTAB 7846:sponge isl gfp positive rep1 lane1,0:75.31 1:0,A:170186220;C:142441110;G:147048643;T:166786401;N:12093,75,0,,,170186220,142441110,147048643,166786401,12093,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94907,,0.08132,,0.69684,,0.4736,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9672,ERR3266373,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L002_R1_001.fastq.gz,fastq,626477579.0,8318750.0,E MTAB 7846:sponge isl gfp positive rep1 lane2,0:75.31 1:0,A:170185337;C:142396801;G:147032265;T:166850532;N:12644,75,0,,,170185337,142396801,147032265,166850532,12644,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.08253,,0.6957,,0.47554,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9673,ERR3266374,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L003_R1_001.fastq.gz,fastq,632098509.0,8393388.0,E MTAB 7846:sponge isl gfp positive rep1 lane3,0:75.31 1:0,A:171699353;C:143766296;G:148442110;T:168177264;N:13486,75,0,,,171699353,143766296,148442110,168177264,13486,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94866,,0.08247,,0.69601,,0.48009,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9674,ERR3266375,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L004_R1_001.fastq.gz,fastq,622997479.0,8272752.0,E MTAB 7846:sponge isl gfp positive rep1 lane4,0:75.31 1:0,A:169306677;C:141586415;G:146241288;T:165847752;N:15347,75,0,,,169306677,141586415,146241288,165847752,15347,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9483,,0.08034,,0.69662,,0.47868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9675,ERR3266368,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L001_R1_001.fastq.gz,fastq,707454819.0,9395082.0,E MTAB 7846:sponge isl gfp negative rep2 lane1,0:75.30 1:0,A:194991862;C:157927850;G:163280639;T:191241488;N:12980,75,0,,,194991862,157927850,163280639,191241488,12980,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93871,,0.08926,,0.70806,,0.46501,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9676,ERR3266369,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L002_R1_001.fastq.gz,fastq,704791838.0,9359668.0,E MTAB 7846:sponge isl gfp negative rep2 lane2,0:75.30 1:0,A:194317422;C:157276895;G:162624670;T:190558322;N:14529,75,0,,,194317422,157276895,162624670,190558322,14529,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93816,,0.08859,,0.70999,,0.4661,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9677,ERR3266370,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L003_R1_001.fastq.gz,fastq,715991833.0,9508323.0,E MTAB 7846:sponge isl gfp negative rep2 lane3,0:75.30 1:0,A:197297222;C:159913026;G:165363927;T:193402765;N:14893,75,0,,,197297222,159913026,165363927,193402765,14893,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93844,,0.08854,,0.70828,,0.46042,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9678,ERR3266371,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L004_R1_001.fastq.gz,fastq,703723869.0,9345669.0,E MTAB 7846:sponge isl gfp negative rep2 lane4,0:75.30 1:0,A:194029886;C:157050176;G:162432310;T:190193608;N:17889,75,0,,,194029886,157050176,162432310,190193608,17889,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93897,,0.08993,,0.70863,,0.45707,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9679,ERR3266364,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L001_R1_001.fastq.gz,fastq,676581458.0,8983758.0,E MTAB 7846:sponge isl gfp negative rep1 lane1,0:75.31 1:0,A:184297337;C:153352193;G:158268476;T:180651038;N:12414,75,0,,,184297337,153352193,158268476,180651038,12414,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94981,,0.07715,,0.69138,,0.47243,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9680,ERR3266365,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L002_R1_001.fastq.gz,fastq,676876555.0,8987445.0,E MTAB 7846:sponge isl gfp negative rep1 lane2,0:75.31 1:0,A:184435129;C:153332402;G:158323789;T:180770978;N:14257,75,0,,,184435129,153332402,158323789,180770978,14257,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94901,,0.07805,,0.69179,,0.47182,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9681,ERR3266366,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L003_R1_001.fastq.gz,fastq,681771213.0,9052615.0,E MTAB 7846:sponge isl gfp negative rep1 lane3,0:75.31 1:0,A:185717696;C:154552039;G:159567102;T:181919781;N:14595,75,0,,,185717696,154552039,159567102,181919781,14595,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94923,,0.07768,,0.69167,,0.47219,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9682,ERR3266367,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L004_R1_001.fastq.gz,fastq,671169917.0,8911624.0,E MTAB 7846:sponge isl gfp negative rep1 lane4,0:75.31 1:0,A:182910490;C:152045814;G:157010053;T:179186548;N:17012,75,0,,,182910490,152045814,157010053,179186548,17012,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.07612,,0.69106,,0.47736,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9683,ERR3266360,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L001_R1_001.fastq.gz,fastq,745666738.0,9917771.0,E MTAB 7846:sponge ccn gfp positive rep2 lane1,0:75.18 1:0,A:207714377;C:163732420;G:169037726;T:205161925;N:20290,75,0,,,207714377,163732420,169037726,205161925,20290,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94006,,0.17809,,0.68166,,0.48912,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9684,ERR3266361,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L002_R1_001.fastq.gz,fastq,747693645.0,9944395.0,E MTAB 7846:sponge ccn gfp positive rep2 lane2,0:75.19 1:0,A:208257288;C:164106384;G:169478025;T:205830399;N:21549,75,0,,,208257288,164106384,169478025,205830399,21549,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93873,,0.17738,,0.68296,,0.49656,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9685,ERR3266362,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L003_R1_001.fastq.gz,fastq,756134124.0,10056818.0,E MTAB 7846:sponge ccn gfp positive rep2 lane3,0:75.19 1:0,A:210573012;C:166089133;G:171475300;T:207973232;N:23447,75,0,,,210573012,166089133,171475300,207973232,23447,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94077,,0.18001,,0.68004,,0.49812,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9686,ERR3266363,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L004_R1_001.fastq.gz,fastq,747687619.0,9944417.0,E MTAB 7846:sponge ccn gfp positive rep2 lane4,0:75.19 1:0,A:208315943;C:164104155;G:169484250;T:205757712;N:25559,75,0,,,208315943,164104155,169484250,205757712,25559,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94025,,0.17965,,0.68124,,0.49249,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9687,ERR3266356,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L001_R1_001.fastq.gz,fastq,600153564.0,7972767.0,E MTAB 7846:sponge ccn gfp positive rep1 lane1,0:75.28 1:0,A:165075878;C:133961511;G:138306424;T:162797903;N:11848,75,0,,,165075878,133961511,138306424,162797903,11848,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95367,,0.14146,,0.69154,,0.46621,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9688,ERR3266357,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L002_R1_001.fastq.gz,fastq,600790169.0,7981038.0,E MTAB 7846:sponge ccn gfp positive rep1 lane2,0:75.28 1:0,A:165262968;C:133988329;G:138458635;T:163066854;N:13383,75,0,,,165262968,133988329,138458635,163066854,13383,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95365,,0.14116,,0.69301,,0.46836,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9689,ERR3266358,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L003_R1_001.fastq.gz,fastq,608611085.0,8084904.0,E MTAB 7846:sponge ccn gfp positive rep1 lane3,0:75.28 1:0,A:167402055;C:135871708;G:140314669;T:165009252;N:13401,75,0,,,167402055,135871708,140314669,165009252,13401,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95403,,0.14167,,0.69311,,0.4702,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9690,ERR3266359,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L004_R1_001.fastq.gz,fastq,599558663.0,7964718.0,E MTAB 7846:sponge ccn gfp positive rep1 lane4,0:75.28 1:0,A:164965131;C:133749666;G:138194884;T:162633558;N:15424,75,0,,,164965131,133749666,138194884,162633558,15424,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95285,,0.14085,,0.69037,,0.47345,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9691,ERR3266352,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L001_R1_001.fastq.gz,fastq,599599608.0,7970460.0,E MTAB 7846:sponge ccn gfp negative rep2 lane1,0:75.23 1:0,A:162236409;C:136907675;G:141538730;T:158902520;N:14274,75,0,,,162236409,136907675,141538730,158902520,14274,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95404,,0.05923,,0.69737,,0.48627,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9692,ERR3266353,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L002_R1_001.fastq.gz,fastq,600057776.0,7976438.0,E MTAB 7846:sponge ccn gfp negative rep2 lane2,0:75.23 1:0,A:162367410;C:136994919;G:141577782;T:159102194;N:15471,75,0,,,162367410,136994919,141577782,159102194,15471,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.953,,0.06085,,0.6952,,0.48868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9693,ERR3266354,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L003_R1_001.fastq.gz,fastq,607089697.0,8069901.0,E MTAB 7846:sponge ccn gfp negative rep2 lane3,0:75.23 1:0,A:164235344;C:138684000;G:143335680;T:160819270;N:15403,75,0,,,164235344,138684000,143335680,160819270,15403,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95245,,0.06055,,0.69589,,0.48813,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9694,ERR3266355,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L004_R1_001.fastq.gz,fastq,598098243.0,7950223.0,E MTAB 7846:sponge ccn gfp negative rep2 lane4,0:75.23 1:0,A:161836808;C:136564804;G:141157424;T:158521860;N:17347,75,0,,,161836808,136564804,141157424,158521860,17347,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95299,,0.06032,,0.69501,,0.48928,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9695,ERR3266348,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L001_R1_001.fastq.gz,fastq,668175990.0,8872549.0,E MTAB 7846:sponge ccn gfp negative rep1 lane1,0:75.31 1:0,A:179859350;C:153483169;G:158360605;T:176462088;N:10778,75,0,,,179859350,153483169,158360605,176462088,10778,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95955,,0.07154,,0.69696,,0.46425,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9696,ERR3266349,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L002_R1_001.fastq.gz,fastq,668154755.0,8872093.0,E MTAB 7846:sponge ccn gfp negative rep1 lane2,0:75.31 1:0,A:179811687;C:153454931;G:158314391;T:176560936;N:12810,75,0,,,179811687,153454931,158314391,176560936,12810,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96029,,0.06969,,0.69684,,0.46725,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9697,ERR3266350,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L003_R1_001.fastq.gz,fastq,676984426.0,8989004.0,E MTAB 7846:sponge ccn gfp negative rep1 lane3,0:75.31 1:0,A:182159685;C:155578195;G:160511499;T:178722363;N:12684,75,0,,,182159685,155578195,160511499,178722363,12684,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96012,,0.07159,,0.69554,,0.46811,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9698,ERR3266351,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L004_R1_001.fastq.gz,fastq,666031892.0,8843695.0,E MTAB 7846:sponge ccn gfp negative rep1 lane4,0:75.31 1:0,A:179243298;C:152946459;G:157873912;T:175953752;N:14471,75,0,,,179243298,152946459,157873912,175953752,14471,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96014,,0.07169,,0.69493,,0.47058,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9892,ERR4172795,ERX4136409,ERS4580819,ERP121885,PRJEB38455,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E-MTAB-9113,Transcriptome Analysis,RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 05 22,,Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,sibling 3,SAMEA6853229,Centre for Developmental Neurobiology King's College London,ENA FIRST PUBLIC:2020 12 01T04:08:08Z|ENA LAST UPDATE:2020 05 22T17:13:15Z|External Id:SAMEA6853229|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2020 12 01T04:08:08Z|INSDC last update:2020 05 22T17:13:15Z|INSDC status:public|Submitter Id:E MTAB 9113:sibling 3|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|sample name:E MTAB 9113:sibling 3|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E MTAB 9113:sibling 3 p,sibling 3 p,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP121885,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 06 19,UCLGNS1141-gfp-sibs-3_S6_R1.fastq.gz UCLGNS1141-gfp-sibs-3_S6_R2.fastq.gz,fastq fastq,,,E MTAB 9113:UCLGNS1141 gfp sibs 3 S6 R,0:81 1:81,A:1144578958;C:1113109875;G:1138809559;T:1117038434;N:213932,81,81,,,1144578958,1113109875,1138809559,1117038434,213932,ERX4136409,ERS4580819,ERA2625401,Centre for Developmental Neurobiology King,Centre for Developmental Neurobiology King,2,0.96684,0.96492,0.03244,0.0317,0.71236,0.71514,0.45871,0.46189,81,81,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,United Kingdom,2020-05-22,Multi-stage,Multi-stage,Embryo Imprecise,All anatomical structures
9893,ERR4172794,ERX4136408,ERS4580818,ERP121885,PRJEB38455,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E-MTAB-9113,Transcriptome Analysis,RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 05 22,,Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,sibling 2,SAMEA6853228,Centre for Developmental Neurobiology King's College London,ENA FIRST PUBLIC:2020 12 01T04:08:08Z|ENA LAST UPDATE:2020 05 22T17:13:15Z|External Id:SAMEA6853228|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2020 12 01T04:08:08Z|INSDC last update:2020 05 22T17:13:15Z|INSDC status:public|Submitter Id:E MTAB 9113:sibling 2|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|sample name:E MTAB 9113:sibling 2|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E MTAB 9113:sibling 2 p,sibling 2 p,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP121885,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 06 19,UCLGNS1141-gfp-sibs-2_S4_R1.fastq.gz UCLGNS1141-gfp-sibs-2_S4_R2.fastq.gz,fastq fastq,,,E MTAB 9113:UCLGNS1141 gfp sibs 2 S4 R,0:81 1:81,A:1056280368;C:1036355469;G:1045429486;T:1035773622;N:189389,81,81,,,1056280368,1036355469,1045429486,1035773622,189389,ERX4136408,ERS4580818,ERA2625401,Centre for Developmental Neurobiology King,Centre for Developmental Neurobiology King,2,0.95511,0.95696,0.02941,0.02903,0.71492,0.71628,0.45765,0.46537,81,81,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,United Kingdom,2020-05-22,Multi-stage,Multi-stage,Embryo Imprecise,All anatomical structures
9894,ERR4172793,ERX4136407,ERS4580817,ERP121885,PRJEB38455,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E-MTAB-9113,Transcriptome Analysis,RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 05 22,,Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,sibling 1,SAMEA6853227,Centre for Developmental Neurobiology King's College London,ENA FIRST PUBLIC:2020 12 01T04:08:08Z|ENA LAST UPDATE:2020 05 22T17:13:15Z|External Id:SAMEA6853227|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2020 12 01T04:08:08Z|INSDC last update:2020 05 22T17:13:15Z|INSDC status:public|Submitter Id:E MTAB 9113:sibling 1|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|sample name:E MTAB 9113:sibling 1|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E MTAB 9113:sibling 1 p,sibling 1 p,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP121885,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 06 19,UCLGNS1141-gfp-sibs-1_S2_R1.fastq.gz UCLGNS1141-gfp-sibs-1_S2_R2.fastq.gz,fastq fastq,,,E MTAB 9113:UCLGNS1141 gfp sibs 1 S2 R,0:81 1:81,A:1121176859;C:1093927654;G:1108608188;T:1101082277;N:209264,81,81,,,1121176859,1093927654,1108608188,1101082277,209264,ERX4136407,ERS4580817,ERA2625401,Centre for Developmental Neurobiology King,Centre for Developmental Neurobiology King,2,0.95795,0.96004,0.02885,0.02854,0.71648,0.71756,0.44348,0.43956,81,81,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,United Kingdom,2020-05-22,Multi-stage,Multi-stage,Embryo Imprecise,All anatomical structures
9895,ERR4172792,ERX4136406,ERS4580816,ERP121885,PRJEB38455,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E-MTAB-9113,Transcriptome Analysis,RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 05 22,,Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,sfpq 3,SAMEA6853226,Centre for Developmental Neurobiology King's College London,ENA FIRST PUBLIC:2020 12 01T04:08:08Z|ENA LAST UPDATE:2020 05 22T17:13:15Z|External Id:SAMEA6853226|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2020 12 01T04:08:08Z|INSDC last update:2020 05 22T17:13:15Z|INSDC status:public|Submitter Id:E MTAB 9113:sfpq 3|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:sfpq / |sample name:E MTAB 9113:sfpq 3|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E MTAB 9113:sfpq 3 p,sfpq 3 p,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,Experimental Factor: genotype:sfpq / ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP121885,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 06 19,UCLGNS1141-gfp-neg_3_S5_R1.fastq.gz UCLGNS1141-gfp-neg_3_S5_R2.fastq.gz,fastq fastq,,,E MTAB 9113:UCLGNS1141 gfp neg 3 S5 R,0:81 1:81,A:845849249;C:772302798;G:911660213;T:787409272;N:154042,81,81,,,845849249,772302798,911660213,787409272,154042,ERX4136406,ERS4580816,ERA2625401,Centre for Developmental Neurobiology King,Centre for Developmental Neurobiology King,2,0.96298,0.95486,0.03415,0.03476,0.7167,0.73503,0.4665,0.45947,81,81,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,United Kingdom,2020-05-22,Multi-stage,Multi-stage,Embryo Imprecise,All anatomical structures
9896,ERR4172791,ERX4136405,ERS4580815,ERP121885,PRJEB38455,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E-MTAB-9113,Transcriptome Analysis,RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 05 22,,Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,sfpq 2,SAMEA6853225,Centre for Developmental Neurobiology King's College London,ENA FIRST PUBLIC:2020 12 01T04:08:08Z|ENA LAST UPDATE:2020 05 22T17:13:15Z|External Id:SAMEA6853225|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2020 12 01T04:08:08Z|INSDC last update:2020 05 22T17:13:15Z|INSDC status:public|Submitter Id:E MTAB 9113:sfpq 2|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:sfpq / |sample name:E MTAB 9113:sfpq 2|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E MTAB 9113:sfpq 2 p,sfpq 2 p,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,Experimental Factor: genotype:sfpq / ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP121885,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 06 19,UCLGNS1141-gfp-neg-2_S3_R1.fastq.gz UCLGNS1141-gfp-neg-2_S3_R2.fastq.gz,fastq fastq,,,E MTAB 9113:UCLGNS1141 gfp neg 2 S3 R,0:81 1:81,A:961156886;C:917011292;G:942713581;T:936109877;N:157724,81,81,,,961156886,917011292,942713581,936109877,157724,ERX4136405,ERS4580815,ERA2625401,Centre for Developmental Neurobiology King,Centre for Developmental Neurobiology King,2,0.96276,0.96147,0.03436,0.03382,0.71892,0.72021,0.4581,0.46402,81,81,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,United Kingdom,2020-05-22,Multi-stage,Multi-stage,Embryo Imprecise,All anatomical structures
9897,ERR4172790,ERX4136404,ERS4580814,ERP121885,PRJEB38455,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E-MTAB-9113,Transcriptome Analysis,RNA was extracted from whole zebrafish embryos at 24 hpf to examine changes in gene expression and splicing in sfpq null mutants,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 05 22,,Protocols: Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,sfpq 1,SAMEA6853224,Centre for Developmental Neurobiology King's College London,ENA FIRST PUBLIC:2020 12 01T04:08:08Z|ENA LAST UPDATE:2020 05 22T17:13:15Z|External Id:SAMEA6853224|INSDC center name:Centre for Developmental Neurobiology King's College London|INSDC first public:2020 12 01T04:08:08Z|INSDC last update:2020 05 22T17:13:15Z|INSDC status:public|Submitter Id:E MTAB 9113:sfpq 1|age:24|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:sfpq / |sample name:E MTAB 9113:sfpq 1|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,E MTAB 9113:sfpq 1 p,sfpq 1 p,RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,Embryos were collected from in crosses of sfpq+/ adult zebrafish RNA was extracted using the RNEasy Mini Kit Qiagen Library constructed with ribodepletion,Experimental Factor: genotype:sfpq / ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP121885,Illumina HiSeq 2500 paired end sequencing; RNA seq of sfpq / zebrafish embryos and siblings at 24 hpf,ENA FIRST PUBLIC:2021 01 27|ENA LAST UPDATE:2020 06 19,UCLGNS1141-gfp-neg-1_S1_R1.fastq.gz UCLGNS1141-gfp-neg-1_S1_R2.fastq.gz,fastq fastq,,,E MTAB 9113:UCLGNS1141 gfp neg 1 S1 R,0:81 1:81,A:1046317524;C:1014946275;G:1036910299;T:1023619857;N:185237,81,81,,,1046317524,1014946275,1036910299,1023619857,185237,ERX4136404,ERS4580814,ERA2625401,Centre for Developmental Neurobiology King,Centre for Developmental Neurobiology King,2,0.96015,0.96173,0.03114,0.03098,0.7175,0.71865,0.46666,0.46399,81,81,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,United Kingdom,2020-05-22,Multi-stage,Multi-stage,Embryo Imprecise,All anatomical structures
10285,ERR7132868,ERX6700306,ERS8071630,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 6,SAMEA10418786,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418786|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Oxy 6|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 6 p,Oxy 6 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.B11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2330698400.0,23306984.0,E MTAB 11086:SLX 19351.B11.HMLG7DRXX.s 2.r ,0:50 1:50,A:619569172;C:544582535;G:551543197;T:614938437;N:65059,50,50,,,619569172,544582535,551543197,614938437,65059,ERX6700306,ERS8071630,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.9448,0.95044,0.1029,0.09965,0.67152,0.66864,0.46844,0.47553,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10286,ERR7132867,ERX6700305,ERS8071629,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 5,SAMEA10418785,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418785|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Oxy 5|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 5 p,Oxy 5 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.H9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2005314000.0,20053140.0,E MTAB 11086:SLX 19351.H9.HMLG7DRXX.s 2.r ,0:50 1:50,A:533671597;C:466449227;G:473126638;T:532010412;N:56126,50,50,,,533671597,466449227,473126638,532010412,56126,ERX6700305,ERS8071629,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94406,0.94793,0.11192,0.10798,0.66184,0.66074,0.4603,0.4683,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10287,ERR7132866,ERX6700304,ERS8071628,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 4,SAMEA10418784,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418784|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Oxy 4|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 4 p,Oxy 4 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.A9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2036392600.0,20363926.0,E MTAB 11086:SLX 19351.A9.HMLG7DRXX.s 2.r ,0:50 1:50,A:547586305;C:468797712;G:476477515;T:543474510;N:56558,50,50,,,547586305,468797712,476477515,543474510,56558,ERX6700304,ERS8071628,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94235,0.94873,0.11388,0.11054,0.67655,0.67294,0.47135,0.47234,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10288,ERR7132865,ERX6700303,ERS8071627,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 3,SAMEA10418783,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418783|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Oxy 3|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 3 p,Oxy 3 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.B9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2409819000.0,24098190.0,E MTAB 11086:SLX 19351.B9.HMLG7DRXX.s 2.r ,0:50 1:50,A:641053989;C:561685242;G:569693271;T:637320302;N:66196,50,50,,,641053989,561685242,569693271,637320302,66196,ERX6700303,ERS8071627,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94407,0.94902,0.10789,0.10496,0.66478,0.66387,0.47154,0.47373,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10289,ERR7132864,ERX6700302,ERS8071626,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 2,SAMEA10418782,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418782|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Oxy 2|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 2 p,Oxy 2 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.A11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2068575200.0,20685752.0,E MTAB 11086:SLX 19351.A11.HMLG7DRXX.s 2.r ,0:50 1:50,A:547986796;C:484533693;G:490663629;T:545334125;N:56957,50,50,,,547986796,484533693,490663629,545334125,56957,ERX6700302,ERS8071626,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94539,0.95188,0.10373,0.10116,0.66718,0.66584,0.46991,0.47611,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10290,ERR7132863,ERX6700301,ERS8071625,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 1,SAMEA10418781,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418781|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Oxy 1|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 1 p,Oxy 1 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.G9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.G9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2101607900.0,21016079.0,E MTAB 11086:SLX 19351.G9.HMLG7DRXX.s 2.r ,0:50 1:50,A:557420271;C:491161431;G:497494262;T:555471610;N:60326,50,50,,,557420271,491161431,497494262,555471610,60326,ERX6700301,ERS8071625,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94378,0.94916,0.10779,0.10431,0.66507,0.66377,0.45477,0.4679,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10291,ERR7132862,ERX6700300,ERS8071624,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 6,SAMEA10418780,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418780|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Nic 6|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 6 p,Nic 6 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.H11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2236235700.0,22362357.0,E MTAB 11086:SLX 19351.H11.HMLG7DRXX.s 2.r ,0:50 1:50,A:597573047;C:518264376;G:525314754;T:595021334;N:62189,50,50,,,597573047,518264376,525314754,595021334,62189,ERX6700300,ERS8071624,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94255,0.94893,0.11268,0.10955,0.66819,0.66687,0.46882,0.47485,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10292,ERR7132861,ERX6700299,ERS8071623,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 5,SAMEA10418779,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418779|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Nic 5|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 5 p,Nic 5 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.D10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1904348300.0,19043483.0,E MTAB 11086:SLX 19351.D10.HMLG7DRXX.s 2.r ,0:50 1:50,A:506678821;C:443756285;G:450118827;T:503742221;N:52146,50,50,,,506678821,443756285,450118827,503742221,52146,ERX6700299,ERS8071623,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94468,0.95019,0.10313,0.10023,0.66762,0.66513,0.47749,0.47611,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10293,ERR7132860,ERX6700298,ERS8071622,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 4,SAMEA10418778,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418778|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Nic 4|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 4 p,Nic 4 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.C10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2134565600.0,21345656.0,E MTAB 11086:SLX 19351.C10.HMLG7DRXX.s 2.r ,0:50 1:50,A:568799307;C:496480840;G:503115671;T:566109163;N:60619,50,50,,,568799307,496480840,503115671,566109163,60619,ERX6700298,ERS8071622,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94279,0.94878,0.11466,0.1122,0.66291,0.66176,0.46991,0.47168,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10294,ERR7132859,ERX6700297,ERS8071621,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 3,SAMEA10418777,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418777|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Nic 3|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 3 p,Nic 3 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.B10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2409355400.0,24093554.0,E MTAB 11086:SLX 19351.B10.HMLG7DRXX.s 2.r ,0:50 1:50,A:643046449;C:559571909;G:567748411;T:638920943;N:67688,50,50,,,643046449,559571909,567748411,638920943,67688,ERX6700297,ERS8071621,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94305,0.94796,0.11097,0.10766,0.66149,0.65888,0.46643,0.47512,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10295,ERR7132858,ERX6700296,ERS8071620,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 2,SAMEA10418776,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418776|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Nic 2|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 2 p,Nic 2 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.F10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2046910800.0,20469108.0,E MTAB 11086:SLX 19351.F10.HMLG7DRXX.s 2.r ,0:50 1:50,A:547096034;C:475610002;G:481041169;T:543104402;N:59193,50,50,,,547096034,475610002,481041169,543104402,59193,ERX6700296,ERS8071620,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94391,0.94965,0.10824,0.10557,0.66241,0.65963,0.47747,0.47375,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10296,ERR7132857,ERX6700295,ERS8071619,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 1,SAMEA10418775,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418775|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Nic 1|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 1 p,Nic 1 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.G10.HMLG7DRXX.s_2.r_2.fq.gz SLX-19351.G10.HMLG7DRXX.s_2.r_1.fq.gz,fastq fastq,2001312600.0,20013126.0,E MTAB 11086:SLX 19351.G10.HMLG7DRXX.s 2.r ,0:50 1:50,A:535065614;C:463328218;G:468900497;T:533963156;N:55115,50,50,,,535065614,463328218,468900497,533963156,55115,ERX6700295,ERS8071619,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94179,0.9477,0.11455,0.11139,0.66697,0.66569,0.45749,0.47217,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10297,ERR7132856,ERX6700294,ERS8071618,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 6,SAMEA10418774,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418774|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Cnt 6|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 6 p,Cnt 6 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.C11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2311609400.0,23116094.0,E MTAB 11086:SLX 19351.C11.HMLG7DRXX.s 2.r ,0:50 1:50,A:616569709;C:538286683;G:545161394;T:611525546;N:66068,50,50,,,616569709,538286683,545161394,611525546,66068,ERX6700294,ERS8071618,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94486,0.95028,0.1097,0.10661,0.66703,0.6644,0.47311,0.47453,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10298,ERR7132855,ERX6700293,ERS8071617,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 5,SAMEA10418773,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418773|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Cnt 5|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 5 p,Cnt 5 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.G11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.G11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1590322800.0,15903228.0,E MTAB 11086:SLX 19351.G11.HMLG7DRXX.s 2.r ,0:50 1:50,A:407583907;C:385496371;G:392945463;T:404250386;N:46673,50,50,,,407583907,385496371,392945463,404250386,46673,ERX6700293,ERS8071617,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94942,0.95571,0.10693,0.10576,0.69329,0.69063,0.46419,0.4826,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10299,ERR7132854,ERX6700292,ERS8071616,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 4,SAMEA10418772,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418772|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Cnt 4|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 4 p,Cnt 4 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.C9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2079441500.0,20794415.0,E MTAB 11086:SLX 19351.C9.HMLG7DRXX.s 2.r ,0:50 1:50,A:555430147;C:483109623;G:489773903;T:551069513;N:58314,50,50,,,555430147,483109623,489773903,551069513,58314,ERX6700292,ERS8071616,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94258,0.9491,0.10928,0.10545,0.66561,0.66279,0.46967,0.47237,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10300,ERR7132853,ERX6700291,ERS8071615,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 3,SAMEA10418771,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418771|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Cnt 3|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 3 p,Cnt 3 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.H10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2606680900.0,26066809.0,E MTAB 11086:SLX 19351.H10.HMLG7DRXX.s 2.r ,0:50 1:50,A:698010494;C:604285893;G:612505273;T:691805693;N:73547,50,50,,,698010494,604285893,612505273,691805693,73547,ERX6700291,ERS8071615,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94271,0.94917,0.11288,0.10987,0.67115,0.66827,0.4729,0.4736,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10301,ERR7132852,ERX6700290,ERS8071614,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 2,SAMEA10418770,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418770|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Cnt 2|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 2 p,Cnt 2 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.E11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2248468400.0,22484684.0,E MTAB 11086:SLX 19351.E11.HMLG7DRXX.s 2.r ,0:50 1:50,A:601914808;C:521501189;G:527610060;T:597380501;N:61842,50,50,,,601914808,521501189,527610060,597380501,61842,ERX6700290,ERS8071614,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94347,0.94939,0.11234,0.10984,0.66689,0.66342,0.46711,0.46831,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10302,ERR7132851,ERX6700289,ERS8071613,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 1,SAMEA10418769,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418769|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Cnt 1|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 1 p,Cnt 1 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.D11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1958517300.0,19585173.0,E MTAB 11086:SLX 19351.D11.HMLG7DRXX.s 2.r ,0:50 1:50,A:523101436;C:454540970;G:459925156;T:520895141;N:54597,50,50,,,523101436,454540970,459925156,520895141,54597,ERX6700289,ERS8071613,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94413,0.95047,0.10482,0.10253,0.67044,0.66782,0.47233,0.4771,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10303,ERR7132850,ERX6700288,ERS8071612,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 6,SAMEA10418768,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418768|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Amp 6|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 6 p,Amp 6 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.E9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1712505000.0,17125050.0,E MTAB 11086:SLX 19351.E9.HMLG7DRXX.s 2.r ,0:50 1:50,A:455641002;C:398314392;G:404466444;T:454036255;N:46907,50,50,,,455641002,398314392,404466444,454036255,46907,ERX6700288,ERS8071612,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94358,0.94966,0.10681,0.1037,0.66665,0.66373,0.46688,0.47225,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10304,ERR7132849,ERX6700287,ERS8071611,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 5,SAMEA10418767,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418767|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Amp 5|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 5 p,Amp 5 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.A10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2007519200.0,20075192.0,E MTAB 11086:SLX 19351.A10.HMLG7DRXX.s 2.r ,0:50 1:50,A:534568558;C:467539630;G:473805079;T:531550688;N:55245,50,50,,,534568558,467539630,473805079,531550688,55245,ERX6700287,ERS8071611,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94408,0.9499,0.10888,0.10604,0.66797,0.66458,0.46039,0.46669,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10305,ERR7132848,ERX6700286,ERS8071610,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 4,SAMEA10418766,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418766|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Amp 4|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 4 p,Amp 4 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.F11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1845345300.0,18453453.0,E MTAB 11086:SLX 19351.F11.HMLG7DRXX.s 2.r ,0:50 1:50,A:490920758;C:430637266;G:435667744;T:488067453;N:52079,50,50,,,490920758,430637266,435667744,488067453,52079,ERX6700286,ERS8071610,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94484,0.9504,0.10472,0.10237,0.66618,0.66336,0.46903,0.47774,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10306,ERR7132847,ERX6700285,ERS8071609,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 3,SAMEA10418765,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418765|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Amp 3|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 3 p,Amp 3 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.F9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2195415300.0,21954153.0,E MTAB 11086:SLX 19351.F9.HMLG7DRXX.s 2.r ,0:50 1:50,A:583956682;C:511927452;G:518373455;T:581095379;N:62332,50,50,,,583956682,511927452,518373455,581095379,62332,ERX6700285,ERS8071609,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94571,0.95178,0.10567,0.10288,0.6688,0.66661,0.4677,0.47288,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10307,ERR7132846,ERX6700284,ERS8071608,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 2,SAMEA10418764,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418764|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Amp 2|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 2 p,Amp 2 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.D9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2093635000.0,20936350.0,E MTAB 11086:SLX 19351.D9.HMLG7DRXX.s 2.r ,0:50 1:50,A:556451381;C:488314672;G:495691630;T:553118514;N:58803,50,50,,,556451381,488314672,495691630,553118514,58803,ERX6700284,ERS8071608,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94407,0.95012,0.11198,0.10872,0.66651,0.66352,0.46901,0.47198,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
10308,ERR7132845,ERX6700283,ERS8071607,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 1,SAMEA10418763,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418763|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Amp 1|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 1 p,Amp 1 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.E10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2254130000.0,22541300.0,E MTAB 11086:SLX 19351.E10.HMLG7DRXX.s 2.r ,0:50 1:50,A:599784010;C:525655199;G:531849347;T:596777643;N:63801,50,50,,,599784010,525655199,531849347,596777643,63801,ERX6700283,ERS8071607,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94449,0.95026,0.10608,0.10323,0.66758,0.66257,0.46869,0.47045,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures
11041,ERR9995536,ERX9536682,ERS12521224,ERP138294,PRJEB53494,Nano3P seq: transcriptome wide analysis of gene expression and tail dynamics using end capture nanopore cDNA sequencing,94bf5509-4622-4d5f-b7c5-6a14bdfac340,Other,RNA polyadenylation plays a central role in RNA maturation fate and stability. In response to developmental cues polyA tail lengths can vary affecting the translation efficiency and stability of mRNAs. Here we develop Nanopore three prime end capture sequencing Nano3P seq a novel method that relies on nanopore cDNA sequencing to simultaneously quantify RNA abundance tail composition and tail length dynamics at per read resolution. By employing a template switching based sequencing protocol Nano3P seq can sequence any given RNA molecule from its three prime end regardless of its polyadenylation status without xxx need for PCR amplification or ligation of RNA adapters. We demonstrate that Nano3P seq captures a wide diversity of RNA biotypes providing quantitative estimates of RNA abundance and tail lengths in mRNA lncRNA sn/snoRNA scaRNA and rRNA molecules. We find that in addition to mRNA and lncRNA polyA tails can be identified in 16S mitochondrial rRNA in both mouse and zebrafish models. Moreover we show that mRNA tail lengths are dynamically regulated during vertebrate embryogenesis at an isoform specific level correlating with mRNA decay. Finally we identify non A bases within polyA tails of various lengths and reveal their distribution during vertebrate embryogenesis. Overall Nano3P seq is a simple and robust method for accurately estimating transcript levels tail lengths and tail composition heterogeneity in individual reads with minimal library preparation biases both in the coding and non coding transcriptome.,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10,,dRNA seq of 4hpf Zebrafish embryos,Zebrafish dRNA 4hpf,SAMEA110422854,CENTER FOR GENOMIC REGULATION (CRG),ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|External Id:SAMEA110422854|INSDC center alias:CENTER FOR GENOMIC REGULATION CRG|INSDC center name:CENTER FOR GENOMIC REGULATION CRG|INSDC first public:2022 10 10T00:21:01Z|INSDC last update:2022 10 10T00:21:01Z|INSDC status:public|Submitter Id:Zebrafish dRNA 4hpf|common name:zebrafish|sample name:Zebrafish dRNA 4hpf,,,,,,,,,MinION sequencing,ena EXPERIMENT TAB 27 07 2022 11:41:43:673 3,Zebrafish dRNA 4hpf,1,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,OXFORD_NANOPORE,MinION,,ERP138294,MinION sequencing,ENA FIRST PUBLIC:2022 10 10|ENA LAST UPDATE:2022 10 10|instrument model:PromethION,PDBN042841_dRNA_4hpf.tar.gz,nanopore,772304625.0,897768.0,ena RUN TAB 27 07 2022 11:41:43:690 4,0:860.25,A:224977035;C:165273397;G:156659356;T:225394837;N:0,860,,,,224977035,165273397,156659356,225394837,0,ERX9536682,ERS12521224,ERA16500713,CENTER FOR GENOMIC REGULATION (CRG)|European Nucleotide Archive,CENTER FOR GENOMIC REGULATION (CRG),,,,,,,,,,,,,,,ont,ont,3prime,poly_a,unknown,bulk,unknown,unknown,,Spain,2022-10-10,Blastula,Embryo,Embryo Imprecise,All anatomical structures
11245,ERR10851251,ERX10296231,ERS14601258,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,WT3 cd41pflt1p48hpf,SAMEA112483908,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483908|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:WT3 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 1|organism part:liver|sample name:E MTAB 12577:WT3 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP WT,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:WT3 cd41pflt1p48hpf p,WT3 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,WT3_cd41pflt1p48hpf_R1.fastq.gz WT3_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,2865896816.0,14187608.0,E MTAB 12577:WT3 cd41pflt1p48hpf R,0:101 1:101,A:766433553;C:631932872;G:660672891;T:806849737;N:7763,101,101,,,766433553,631932872,660672891,806849737,7763,ERX10296231,ERS14601258,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.90501,0.85042,0.09405,0.09335,0.87286,0.87943,0.48423,0.47904,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
11246,ERR10851250,ERX10296230,ERS14601257,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,WT2 cd41pflt1p48hpf,SAMEA112483907,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483907|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:WT2 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 5|organism part:liver|sample name:E MTAB 12577:WT2 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP WT,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:WT2 cd41pflt1p48hpf p,WT2 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,WT2_cd41pflt1p48hpf_R1.fastq.gz WT2_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,2929743360.0,14503680.0,E MTAB 12577:WT2 cd41pflt1p48hpf R,0:101 1:101,A:803775344;C:639485652;G:661899077;T:824575679;N:7608,101,101,,,803775344,639485652,661899077,824575679,7608,ERX10296230,ERS14601257,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.94558,0.90768,0.09379,0.09399,0.79058,0.79833,0.48216,0.47743,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
11247,ERR10851249,ERX10296229,ERS14601256,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,WT1 cd41pflt1p48hpf,SAMEA112483906,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483906|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:WT1 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:wild type genotype|immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 4|organism part:liver|sample name:E MTAB 12577:WT1 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP WT,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:WT1 cd41pflt1p48hpf p,WT1 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:wild type genotype,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,WT1_cd41pflt1p48hpf_R1.fastq.gz WT1_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,3248647426.0,16082413.0,E MTAB 12577:WT1 cd41pflt1p48hpf R,0:101 1:101,A:883030193;C:725566673;G:750551574;T:889489774;N:9212,101,101,,,883030193,725566673,750551574,889489774,9212,ERX10296229,ERS14601256,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.91568,0.8915,0.09819,0.09602,0.86634,0.8706,0.48887,0.48731,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
11248,ERR10851248,ERX10296228,ERS14601255,ERP144652,PRJEB59599,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E-MTAB-12577,Transcriptome Analysis,Comparison between wildtype and Gata2b heterozygous zebrafish HSPCs,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,,Protocols: Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Het3 cd41pflt1p48hpf,SAMEA112483905,Department of Hematology cancer institute ErasmusMC,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17|External Id:SAMEA112483905|INSDC center alias:Department of Hematology cancer institute ErasmusMC|INSDC center name:Department of Hematology cancer institute ErasmusMC|INSDC first public:2023 02 17T00:21:53Z|INSDC last update:2023 02 17T00:21:53Z|INSDC status:public|Submitter Id:E MTAB 12577:Het3 cd41pflt1p48hpf|age:48|broker name:ArrayExpress|cell type:hematopoietic stem cell|common name:zebrafish|developmental stage:embryo|genotype:Gata2b +/ |immunophenotype:CD41:GFP+ Flt1:RFP+|individual:pools of 3 embryos 3|organism part:liver|sample name:E MTAB 12577:Het3 cd41pflt1p48hpf|scientific name:Danio rerio|strain:TgCD41:GFP TgFlt1:RFP Gata2b KO,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,E MTAB 12577:Het3 cd41pflt1p48hpf p,Het3 cd41pflt1p48hpf p,Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,Embryos were dissociated using Collagenase 1 2 and 4 and sorted using a FACS Aria III in trizol RNA was isolated from trizol RNA was smarter amplified,Experimental Factor: genotype:Gata2b +/ ,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP144652,Illumina NovaSeq 6000 paired end sequencing; Heterozygous Gata2b versus wildtype Gata2b zebrafish embryo HSPC CD41,ENA FIRST PUBLIC:2023 02 17|ENA LAST UPDATE:2023 02 17,Het3_cd41pflt1p48hpf_R1.fastq.gz Het3_cd41pflt1p48hpf_R2.fastq.gz,fastq fastq,2826011512.0,13990156.0,E MTAB 12577:Het3 cd41pflt1p48hpf R,0:101 1:101,A:777245323;C:622387331;G:640520737;T:785850577;N:7544,101,101,,,777245323,622387331,640520737,785850577,7544,ERX10296228,ERS14601255,ERA20429817,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,Department of Hematology cancer institute ErasmusMC|European Nucleotide Archive,2,0.92716,0.90121,0.10896,0.10895,0.76739,0.77628,0.47007,0.46569,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Netherlands,2023-02-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures