rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 25162,SRR25655085,SRX21381122,SRS18622091,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 8 AU1038 STRSS4,GSM7712891,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 8 AU1038 STRSS4,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712891,GSM7712891: Sample 8 AU1038 STRSS4; Danio rerio; ncRNA Seq,GSM7712891 r1,GSM7712891,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS04_10932AAD_TGTCCTAC-ACATGAGT_R1_001.fastq.gz,fastq,641236400.0,12824728.0,GSM7712891 r1,0:50,A:183546979;C:159774155;G:156033079;T:141881902;N:285,50,,,,183546979,159774155,156033079,141881902,285,SRX21381122,SRS18622091,SRA1693666,CNAG,CNAG,1,0.4736,,0.03992,,0.96788,,0.87662,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined 25163,SRR25655086,SRX21381121,SRS18622090,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 7 AU1037 STRSS3,GSM7712890,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 7 AU1037 STRSS3,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712890,GSM7712890: Sample 7 AU1037 STRSS3; Danio rerio; ncRNA Seq,GSM7712890 r1,GSM7712890,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS03_10931AAD_GCACGATT-CGTCTGCA_R1_001.fastq.gz,fastq,434646850.0,8692937.0,GSM7712890 r1,0:50,A:126760670;C:102577685;G:109591447;T:95716876;N:172,50,,,,126760670,102577685,109591447,95716876,172,SRX21381121,SRS18622090,SRA1693666,CNAG,CNAG,1,0.52132,,0.04615,,0.96477,,0.85481,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined 25164,SRR25655087,SRX21381120,SRS18622089,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 6 AU1036 STRSS2,GSM7712889,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 6 AU1036 STRSS2,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712889,GSM7712889: Sample 6 AU1036 STRSS2; Danio rerio; ncRNA Seq,GSM7712889 r1,GSM7712889,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS02_10930AAD_ATGAAGCG-GCGGACAG_R1_001.fastq.gz,fastq,907610650.0,18152213.0,GSM7712889 r1,0:50,A:271494673;C:215304417;G:220608756;T:200202267;N:537,50,,,,271494673,215304417,220608756,200202267,537,SRX21381120,SRS18622089,SRA1693666,CNAG,CNAG,1,0.44189,,0.03477,,0.97335,,0.88092,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined 25165,SRR25655088,SRX21381119,SRS18622088,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 5 AU1035 STRSS1,GSM7712888,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 5 AU1035 STRSS1,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712888,GSM7712888: Sample 5 AU1035 STRSS1; Danio rerio; ncRNA Seq,GSM7712888 r1,GSM7712888,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS01_10929AAD_CACTTCGA-TAGGCTTC_R1_001.fastq.gz,fastq,711276100.0,14225522.0,GSM7712888 r1,0:50,A:207284968;C:173540770;G:172961619;T:157488473;N:270,50,,,,207284968,173540770,172961619,157488473,270,SRX21381119,SRS18622088,SRA1693666,CNAG,CNAG,1,0.47865,,0.03881,,0.97001,,0.87616,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined 25166,SRR25655089,SRX21381118,SRS18622087,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 4 AU1028 CTRL4,GSM7712887,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 4 AU1028 CTRL4,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712887,GSM7712887: Sample 4 AU1028 CTRL4; Danio rerio; ncRNA Seq,GSM7712887 r1,GSM7712887,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL04_10928AAD_GACTAGGC-GCCTCGAC_R1_001.fastq.gz,fastq,568037350.0,11360747.0,GSM7712887 r1,0:50,A:165826590;C:133109854;G:141956673;T:127143732;N:501,50,,,,165826590,133109854,141956673,127143732,501,SRX21381118,SRS18622087,SRA1693666,CNAG,CNAG,1,0.48051,,0.0347,,0.97268,,0.87465,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined 25167,SRR25655090,SRX21381117,SRS18622086,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 3 AU1027 CTRL3,GSM7712886,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 3 AU1027 CTRL3,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712886,GSM7712886: Sample 3 AU1027 CTRL3; Danio rerio; ncRNA Seq,GSM7712886 r1,GSM7712886,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL03_10927AAD_AGTATACT-CGAATCGG_R1_001.fastq.gz,fastq,651469300.0,13029386.0,GSM7712886 r1,0:50,A:191788726;C:154951271;G:161329211;T:143399936;N:156,50,,,,191788726,154951271,161329211,143399936,156,SRX21381117,SRS18622086,SRA1693666,CNAG,CNAG,1,0.45412,,0.04073,,0.96934,,0.88507,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined 25168,SRR25655091,SRX21381116,SRS18622085,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 2 AU1026 CTRL2,GSM7712885,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 2 AU1026 CTRL2,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712885,GSM7712885: Sample 2 AU1026 CTRL2; Danio rerio; ncRNA Seq,GSM7712885 r1,GSM7712885,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL02_10926AAD_CCGCGTAG-TTCTGATT_R1_001.fastq.gz,fastq,754615100.0,15092302.0,GSM7712885 r1,0:50,A:217013981;C:184328493;G:188964773;T:164307508;N:345,50,,,,217013981,184328493,188964773,164307508,345,SRX21381116,SRS18622085,SRA1693666,CNAG,CNAG,1,0.48926,,0.04654,,0.96418,,0.8889,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined 25169,SRR25655092,SRX21381115,SRS18622084,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 1 AU1024 CTRL1,GSM7712884,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 1 AU1024 CTRL1,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712884,GSM7712884: Sample 1 AU1024 CTRL1; Danio rerio; ncRNA Seq,GSM7712884 r1,GSM7712884,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL01_10925AAD_TTAGCCTA-AATCATCA_R1_001.fastq.gz,fastq,670580700.0,13411614.0,GSM7712884 r1,0:50,A:194653643;C:158916446;G:165941477;T:151068917;N:217,50,,,,194653643,158916446,165941477,151068917,217,SRX21381115,SRS18622084,SRA1693666,CNAG,CNAG,1,0.47093,,0.03457,,0.97187,,0.8867,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined 25277,SRR30160454,SRX25627658,SRS22272474,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf charged tRNA seqrep 3,GSM8441306,,tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing,WT bud 10 hpf charged tRNA seqrep 3,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions,10 hpf embryos,,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,cell type:10 hpf embryos,GSM8441306,GSM8441306: WT bud 10 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq,GSM8441306 r1,GSM8441306,1,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP457111,,,10hpf_aa_rep3.fastq.gz,fastq,193965330.0,3367323.0,GSM8441306 r1,0:57.60,A:36799299;C:55100074;G:53758955;T:48306966;N:36,57,,,,36799299,55100074,53758955,48306966,36,SRX25627658,SRS22272474,SRA1941998,Max Planck Institute of Biochemistry,Max Planck Institute of Biochemistry,1,0.34405,,0.05049,,0.89471,,0.46469,,88,,B,,usable mapping rate,illumina,novaseq_era,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2024-08-05,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 25278,SRR30160455,SRX25627657,SRS22272473,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf charged tRNA seqrep 2,GSM8441305,,tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing,WT bud 10 hpf charged tRNA seqrep 2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions,10 hpf embryos,,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,cell type:10 hpf embryos,GSM8441305,GSM8441305: WT bud 10 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq,GSM8441305 r1,GSM8441305,1,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP457111,,,10hpf_aa_rep2.fastq.gz,fastq,138524715.0,2369009.0,GSM8441305 r1,0:58.47,A:26396279;C:39139297;G:38459048;T:34530060;N:31,58,,,,26396279,39139297,38459048,34530060,31,SRX25627657,SRS22272473,SRA1941998,Max Planck Institute of Biochemistry,Max Planck Institute of Biochemistry,1,0.35458,,0.05179,,0.89424,,0.46401,,74,,B,,usable mapping rate,illumina,novaseq_era,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2024-08-05,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 25279,SRR30160456,SRX25627656,SRS22272472,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf charged tRNA seqrep 1,GSM8441304,,tissue:10 hpf embryos|cell type:10 hpf embryos|geo loc name:missing|collection date:missing,WT bud 10 hpf charged tRNA seqrep 1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions,10 hpf embryos,,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,cell type:10 hpf embryos,GSM8441304,GSM8441304: WT bud 10 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq,GSM8441304 r1,GSM8441304,1,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP457111,,,10hpf_aa_rep1.fastq.gz,fastq,54473618.0,946419.0,GSM8441304 r1,0:57.56,A:10345022;C:15413782;G:15135500;T:13579304;N:10,57,,,,10345022,15413782,15135500,13579304,10,SRX25627656,SRS22272472,SRA1941998,Max Planck Institute of Biochemistry,Max Planck Institute of Biochemistry,1,0.36103,,0.0515,,0.89227,,0.4748,,81,,B,,usable mapping rate,illumina,novaseq_era,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2024-08-05,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 25280,SRR30160457,SRX25627655,SRS22272471,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf charged tRNA seqrep 3,GSM8441303,,tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing,WT sphere 4 hpf charged tRNA seqrep 3,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions,4 hpf embryos,,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,cell type:4 hpf embryos,GSM8441303,GSM8441303: WT sphere 4 hpf charged tRNA seqrep 3; Danio rerio; ncRNA Seq,GSM8441303 r1,GSM8441303,1,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP457111,,,4hpf_aa_rep3.fastq.gz,fastq,100810543.0,1747597.0,GSM8441303 r1,0:57.69,A:20466558;C:28054923;G:26849246;T:25439798;N:18,57,,,,20466558,28054923,26849246,25439798,18,SRX25627655,SRS22272471,SRA1941998,Max Planck Institute of Biochemistry,Max Planck Institute of Biochemistry,1,0.36374,,0.06294,,0.87316,,0.54642,,39,,B,,usable mapping rate,illumina,novaseq_era,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2024-08-05,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 25281,SRR30160458,SRX25627654,SRS22272470,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf charged tRNA seqrep 2,GSM8441302,,tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing,WT sphere 4 hpf charged tRNA seqrep 2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions,4 hpf embryos,,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,cell type:4 hpf embryos,GSM8441302,GSM8441302: WT sphere 4 hpf charged tRNA seqrep 2; Danio rerio; ncRNA Seq,GSM8441302 r1,GSM8441302,1,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP457111,,,4hpf_aa_rep2.fastq.gz,fastq,121662759.0,2046536.0,GSM8441302 r1,0:59.45,A:24519095;C:33689156;G:32726095;T:30728382;N:31,59,,,,24519095,33689156,32726095,30728382,31,SRX25627654,SRS22272470,SRA1941998,Max Planck Institute of Biochemistry,Max Planck Institute of Biochemistry,1,0.3726,,0.06263,,0.87136,,0.55584,,31,,B,,usable mapping rate,illumina,novaseq_era,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2024-08-05,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 25282,SRR30160459,SRX25627653,SRS22272469,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf charged tRNA seqrep 1,GSM8441301,,tissue:4 hpf embryos|cell type:4 hpf embryos|geo loc name:missing|collection date:missing,WT sphere 4 hpf charged tRNA seqrep 1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.3.8 using the parameters: species Drer cluster id 0.93 threads 40 min cov 0.001 deconv cov ratio 0.4 max mismatches 0.075 remap remap mismatches 0.075 max multi 10 max multi 6 remap remap mismatches 0.075 crosstalks. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated CCA proportions,4 hpf embryos,,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,cell type:4 hpf embryos,GSM8441301,GSM8441301: WT sphere 4 hpf charged tRNA seqrep 1; Danio rerio; ncRNA Seq,GSM8441301 r1,GSM8441301,1,Total RNA from D.rerio embryos collected at the sphere 4 hpf or bud 10 hpf stage was extracted with TRIZOL under mild acidic conditions to preserve tRNA charging and subjected to oxidation and beta elimination Behrens and Nedialkova 2022. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens and Nedialkova 2022 and sequenced on an Illumina NovaSeq 6000 platform.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP457111,,,4hpf_aa_rep1.fastq.gz,fastq,124990980.0,2116213.0,GSM8441301 r1,0:59.06,A:25487542;C:34621140;G:33284460;T:31597816;N:22,59,,,,25487542,34621140,33284460,31597816,22,SRX25627653,SRS22272469,SRA1941998,Max Planck Institute of Biochemistry,Max Planck Institute of Biochemistry,1,0.36013,,0.05967,,0.87387,,0.55002,,44,,B,,usable mapping rate,illumina,novaseq_era,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2024-08-05,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures 25283,SRR25764121,SRX21486801,SRS18719093,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf tRNA seq rep2,GSM7734782,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT bud 10 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT,GSM7734782,GSM7734782: WT bud 10 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734782 r1,GSM7734782,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_bud_2.fastq.gz,fastq,278145656.0,4215107.0,GSM7734782 r1,0:65.99,A:52499947;C:77161357;G:79314034;T:69169753;N:565,65,,,,52499947,77161357,79314034,69169753,565,SRX21486801,SRS18719093,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.31888,,0.01661,,0.92348,,0.40156,,75,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25284,SRR25764122,SRX21486800,SRS18719092,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT bud 10 hpf tRNA seq rep1,GSM7734781,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT bud 10 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Bud 10 hpf|genotype:WT,GSM7734781,GSM7734781: WT bud 10 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734781 r1,GSM7734781,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_bud_1.fastq.gz,fastq,385514625.0,5770392.0,GSM7734781 r1,0:66.81,A:73305393;C:107155246;G:109793285;T:95259823;N:878,66,,,,73305393,107155246,109793285,95259823,878,SRX21486800,SRS18719092,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.33213,,0.01782,,0.92354,,0.42724,,39,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25285,SRR25764123,SRX21486799,SRS18719098,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT shield 6 hpf tRNA seq rep2,GSM7734780,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT shield 6 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT,GSM7734780,GSM7734780: WT shield 6 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734780 r1,GSM7734780,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_shield_2.fastq.gz,fastq,469031736.0,7421688.0,GSM7734780 r1,0:63.20,A:90257219;C:130440728;G:130549302;T:117783411;N:1076,63,,,,90257219,130440728,130549302,117783411,1076,SRX21486799,SRS18719098,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.29535,,0.02113,,0.91528,,0.43824,,37,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25286,SRR25764124,SRX21486798,SRS18719100,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT shield 6 hpf tRNA seq rep1,GSM7734779,,source name:Gastrula|strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT shield 6 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Gastrula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Gastrula|developmental stage:Shield 6 hpf|genotype:WT,GSM7734779,GSM7734779: WT shield 6 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734779 r1,GSM7734779,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_shield_1.fastq.gz,fastq,487207771.0,7521930.0,GSM7734779 r1,0:64.77,A:94654510;C:134893975;G:135716906;T:121941280;N:1100,64,,,,94654510,134893975,135716906,121941280,1100,SRX21486798,SRS18719100,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.30664,,0.02274,,0.91297,,0.46012,,79,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Gastrula,Embryo,Whole Organism,All anatomical structures 25287,SRR25764125,SRX21486797,SRS18719094,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf tRNA seq rep2,GSM7734778,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT sphere 4 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT,GSM7734778,GSM7734778: WT sphere 4 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734778 r1,GSM7734778,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_sphere_2.fastq.gz,fastq,196089572.0,2998867.0,GSM7734778 r1,0:65.39,A:39134451;C:53803100;G:53602781;T:49548779;N:461,65,,,,39134451,53803100,53602781,49548779,461,SRX21486797,SRS18719094,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.28808,,0.01959,,0.91553,,0.47742,,78,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25288,SRR25764126,SRX21486796,SRS18719096,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT sphere 4 hpf tRNA seq rep1,GSM7734777,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT sphere 4 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:Sphere 4 hpf|genotype:WT,GSM7734777,GSM7734777: WT sphere 4 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734777 r1,GSM7734777,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_sphere_1.fastq.gz,fastq,273027894.0,4080366.0,GSM7734777 r1,0:66.91,A:54678043;C:74713512;G:74872888;T:68762883;N:568,66,,,,54678043,74713512,74872888,68762883,568,SRX21486796,SRS18719096,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.30124,,0.01877,,0.9163,,0.49987,,79,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25289,SRR25764127,SRX21486795,SRS18719097,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT 1000 cell 3 hpf tRNA seq rep2,GSM7734776,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT 1000 cell 3 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT,GSM7734776,GSM7734776: WT 1000 cell 3 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734776 r1,GSM7734776,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_1Kcell_2.fastq.gz,fastq,240973473.0,3918764.0,GSM7734776 r1,0:61.49,A:48091658;C:66684510;G:65183534;T:61013184;N:587,61,,,,48091658,66684510,65183534,61013184,587,SRX21486795,SRS18719097,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.26629,,0.02297,,0.92305,,0.48525,,79,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25290,SRR25764128,SRX21486794,SRS18719095,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT 1000 cell 3 hpf tRNA seq rep1,GSM7734775,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT 1000 cell 3 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:1000 cell 3 hpf|genotype:WT,GSM7734775,GSM7734775: WT 1000 cell 3 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734775 r1,GSM7734775,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_1Kcell_1.fastq.gz,fastq,153597915.0,2445091.0,GSM7734775 r1,0:62.82,A:30905842;C:42377268;G:41639937;T:38674503;N:365,62,,,,30905842,42377268,41639937,38674503,365,SRX21486794,SRS18719095,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.27317,,0.02516,,0.92454,,0.49385,,77,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25291,SRR25764129,SRX21486793,SRS18719091,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT 256 cell 2.5 hpf tRNA seq rep2,GSM7734774,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT 256 cell 2.5 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT,GSM7734774,GSM7734774: WT 256 cell 2.5 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734774 r1,GSM7734774,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_256cell_2.fastq.gz,fastq,844659062.0,13660310.0,GSM7734774 r1,0:61.83,A:165996817;C:234451560;G:230230791;T:213977958;N:1936,61,,,,165996817,234451560,230230791,213977958,1936,SRX21486793,SRS18719091,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.26001,,0.01993,,0.92594,,0.45714,,61,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25292,SRR25764130,SRX21486792,SRS18719088,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT 256 cell 2.5 hpf tRNA seq rep1,GSM7734773,,source name:Blastula|strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT 256 cell 2.5 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Blastula,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Blastula|developmental stage:256 cell 2.5 hpf|genotype:WT,GSM7734773,GSM7734773: WT 256 cell 2.5 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734773 r1,GSM7734773,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_256cell_1.fastq.gz,fastq,215968508.0,3436266.0,GSM7734773 r1,0:62.85,A:43791388;C:59547637;G:58130851;T:54498124;N:508,62,,,,43791388,59547637,58130851,54498124,508,SRX21486792,SRS18719088,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.27383,,0.02205,,0.92748,,0.46217,,71,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Blastula,Embryo,Whole Organism,All anatomical structures 25293,SRR25764131,SRX21486791,SRS18719090,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT egg 0 hpf tRNA seq rep2,GSM7734772,,source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT egg 0 hpf tRNA seq rep2,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Unfertilized egg,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT,GSM7734772,GSM7734772: WT egg 0 hpf tRNA seq rep2; Danio rerio; ncRNA Seq,GSM7734772 r1,GSM7734772,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_egg_2.fastq.gz,fastq,206374994.0,3181706.0,GSM7734772 r1,0:64.86,A:41195250;C:56578032;G:56479855;T:52121365;N:492,64,,,,41195250,56578032,56479855,52121365,492,SRX21486791,SRS18719090,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.28659,,0.02017,,0.9207,,0.48536,,78,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Zygote,Embryo,Oocyte,Reproductive System 25294,SRR25764132,SRX21486790,SRS18719089,SRP457111,PRJNA1009808,Dynamics of the zebrafish tRNAome during the maternal to zygotic transition [tRNA Seq],GSE241754,Transcriptome Analysis,Time course analysis of tRNA abundance during zebrafish early embryonic development. Overall design: Wild type TLAB strain zebrafish embryos were grown in standard housing conditions.Unfertilized eggs 0 hpf were collected or embryos were staged and collected at consecutive developmental time points namelyat the 256 cell 2.5 hpf 1000 cell 3 hpf sphere 4 hpf shield 6 hpf and bud 10 hpf stages. Eggs and embryos were either flash frozen in liquid nitrogen or immediately processed. Samples were used for western blotting analysis polysome profiling ribosome profiling or mRNA and tRNA sequencing for investigating the regulation of tRNA gene expression and translational status during early zebrafish embryogenesis.,parent bioproject:PRJNA1009800,pubmed:39402326,,WT egg 0 hpf tRNA seq rep1,GSM7734771,,source name:Unfertilized egg|strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT|geo loc name:missing|collection date:missing,WT egg 0 hpf tRNA seq rep1,Read demultiplexing and adapter trimming performed with cutadapt v3.5 where bases were quality trimmed from five prime and three prime ends using a phred score cutoff of 30. Only trimmed reads were retained and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’ RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim tRNAseq computational pipeline v1.2 using the parameters species Drer cluster id 0.93 min cov 0.001 max mismatches 0.075 control condition Egg deconv cov ratio 0.4 remap mismatches 0.075. Additional DESeq2 analysis was performed by excluding unsplit tRNA clusters and on read counts summed by isotype. Assembly: GRCz11 Supplementary files format and content: csv; mim tRNAseq generated tRNA transcript resad counts,Unfertilized egg,unperturbed growth conditions in E3 medium for zebrafish embryos.,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,Embryos were grown in standard housing conditions namely28°C at a 14/10 hour light/dark cycle.,strain:TLAB strain|tissue:Unfertilized egg|developmental stage:unfertilized egg 0 hpf|genotype:WT,GSM7734771,GSM7734771: WT egg 0 hpf tRNA seq rep1; Danio rerio; ncRNA Seq,GSM7734771 r1,GSM7734771,1,50 whole embryos were collected per sample and immediately lysed in 800uL LiDS/LET buffer5% Lithium dodecyl sulfate in 20 mM Tris HCl pH=7.4 100 mM LiCl 2 mM EDTA 5 mM DTT pH 7.4. tRNA seq libraries were prepared using the mim tRNAseq workflow Behrens 2021 2022 and sequenced on an Illumina NextSeq 500 platform. mim tRNAseq,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP457111,,,WT_tRNA_egg_1.fastq.gz,fastq,86021968.0,1304769.0,GSM7734771 r1,0:65.93,A:17511521;C:23474625;G:23300759;T:21734864;N:199,65,,,,17511521,23474625,23300759,21734864,199,SRX21486790,SRS18719089,SRA1700461,"Mechanisms of Protein Biogenesis, Max Planck Institute for Biochemistry",Max Planck Institute of Biochemistry,1,0.29829,,0.02027,,0.92245,,0.48877,,74,,B,,usable mapping rate,illumina,nextseq,5prime,size_fractionation,unknown,bulk,unknown,unknown,,Germany,2023-08-28,Zygote,Embryo,Oocyte,Reproductive System 28985,SRR26936267,SRX22630108,SRS19628590,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 6,GSM7916507,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,La 6,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916507,GSM7916507: La 6; Danio rerio; ncRNA Seq,GSM7916507 r1,GSM7916507,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X32_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz,fastq,810705967.0,27544418.0,GSM7916507 r1,0:29.43,A:141437993;C:173890211;G:258408531;T:236922660;N:46572,29,,,,141437993,173890211,258408531,236922660,46572,SRX22630108,SRS19628590,SRA1756943,University of East Anglia,University of East Anglia,1,0.86832,,0.1884,,0.84735,,0.64657,,21,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28986,SRR26936231,SRX22630107,SRS19628589,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 5,GSM7916506,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,La 5,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916506,GSM7916506: La 5; Danio rerio; ncRNA Seq,GSM7916506 r1,GSM7916506,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X31_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz,fastq,1237906972.0,45149037.0,GSM7916506 r1,0:27.42,A:273044213;C:252818121;G:368519115;T:343444331;N:81192,27,,,,273044213,252818121,368519115,343444331,81192,SRX22630107,SRS19628589,SRA1756943,University of East Anglia,University of East Anglia,1,0.86015,,0.25463,,0.83798,,0.67166,,25,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28987,SRR26936232,SRX22630106,SRS19628588,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 2,GSM7916505,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,Hb 2,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916505,GSM7916505: Hb 2; Danio rerio; ncRNA Seq,GSM7916505 r1,GSM7916505,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X30_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz,fastq,214730387.0,7217086.0,GSM7916505 r1,0:29.75,A:42819722;C:48080032;G:67677978;T:56140049;N:12606,29,,,,42819722,48080032,67677978,56140049,12606,SRX22630106,SRS19628588,SRA1756943,University of East Anglia,University of East Anglia,1,0.85212,,0.1617,,0.86856,,0.69163,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28988,SRR26936233,SRX22630105,SRS19628587,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 1,GSM7916504,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,Hb 1,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916504,GSM7916504: Hb 1; Danio rerio; ncRNA Seq,GSM7916504 r1,GSM7916504,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X29_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz,fastq,595989272.0,21399963.0,GSM7916504 r1,0:27.85,A:128259525;C:125823294;G:181746588;T:160121380;N:38485,27,,,,128259525,125823294,181746588,160121380,38485,SRX22630105,SRS19628587,SRA1756943,University of East Anglia,University of East Anglia,1,0.85218,,0.22941,,0.83595,,0.6151,,30,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28989,SRR26936234,SRX22630104,SRS19628586,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 6,GSM7916503,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,Lb 6,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916503,GSM7916503: Lb 6; Danio rerio; ncRNA Seq,GSM7916503 r1,GSM7916503,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X28_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz,fastq,969307398.0,35511411.0,GSM7916503 r1,0:27.30,A:205174189;C:203840471;G:285952255;T:274278193;N:62290,27,,,,205174189,203840471,285952255,274278193,62290,SRX22630104,SRS19628586,SRA1756943,University of East Anglia,University of East Anglia,1,0.85414,,0.22608,,0.8505,,0.62202,,33,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28990,SRR26936235,SRX22630103,SRS19628585,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 6,GSM7916502,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,Ha 6,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916502,GSM7916502: Ha 6; Danio rerio; ncRNA Seq,GSM7916502 r1,GSM7916502,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X27_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz,fastq,1326612630.0,47094729.0,GSM7916502 r1,0:28.17,A:303455697;C:273680466;G:382978796;T:366416311;N:81360,28,,,,303455697,273680466,382978796,366416311,81360,SRX22630103,SRS19628585,SRA1756943,University of East Anglia,University of East Anglia,1,0.84786,,0.24696,,0.82946,,0.68975,,37,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28991,SRR26936236,SRX22630102,SRS19628584,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 5,GSM7916501,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,Ha 5,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916501,GSM7916501: Ha 5; Danio rerio; ncRNA Seq,GSM7916501 r1,GSM7916501,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X26_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz,fastq,471823428.0,16704799.0,GSM7916501 r1,0:28.24,A:103178860;C:100561292;G:155557190;T:112495106;N:30980,28,,,,103178860,100561292,155557190,112495106,30980,SRX22630102,SRS19628584,SRA1756943,University of East Anglia,University of East Anglia,1,0.61628,,0.14433,,0.91275,,0.6543,,28,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28992,SRR26936237,SRX22630101,SRS19628583,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 4,GSM7916500,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,La 4,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916500,GSM7916500: La 4; Danio rerio; ncRNA Seq,GSM7916500 r1,GSM7916500,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X25_160303_D00294_0224_AC95NJANXX_7.cutadapt.se.19_100.fastq.gz,fastq,713371286.0,25212566.0,GSM7916500 r1,0:28.29,A:155201946;C:151864186;G:207971547;T:198288220;N:45387,28,,,,155201946,151864186,207971547,198288220,45387,SRX22630101,SRS19628583,SRA1756943,University of East Anglia,University of East Anglia,1,0.8507,,0.2078,,0.83031,,0.62739,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28993,SRR26936238,SRX22630100,SRS19628582,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 5,GSM7916499,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,Hb 5,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916499,GSM7916499: Hb 5; Danio rerio; ncRNA Seq,GSM7916499 r1,GSM7916499,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X24_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz,fastq,1043060550.0,35761504.0,GSM7916499 r1,0:29.17,A:217942105;C:216398395;G:316456102;T:292217159;N:46789,29,,,,217942105,216398395,316456102,292217159,46789,SRX22630100,SRS19628582,SRA1756943,University of East Anglia,University of East Anglia,1,0.82114,,0.20881,,0.85622,,0.68486,,19,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28994,SRR26936239,SRX22630099,SRS19628581,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 4,GSM7916498,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,Hb 4,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916498,GSM7916498: Hb 4; Danio rerio; ncRNA Seq,GSM7916498 r1,GSM7916498,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X23_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz,fastq,1357956641.0,47869361.0,GSM7916498 r1,0:28.37,A:293740473;C:276333777;G:404639503;T:383181225;N:61663,28,,,,293740473,276333777,404639503,383181225,61663,SRX22630099,SRS19628581,SRA1756943,University of East Anglia,University of East Anglia,1,0.79885,,0.22306,,0.8425,,0.6656,,26,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28995,SRR26936240,SRX22630098,SRS19628580,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 5,GSM7916497,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,Lb 5,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916497,GSM7916497: Lb 5; Danio rerio; ncRNA Seq,GSM7916497 r1,GSM7916497,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X22_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz,fastq,669771811.0,23848259.0,GSM7916497 r1,0:28.08,A:132916986;C:135594797;G:198730347;T:202498953;N:30728,28,,,,132916986,135594797,198730347,202498953,30728,SRX22630098,SRS19628580,SRA1756943,University of East Anglia,University of East Anglia,1,0.80999,,0.24188,,0.84658,,0.68339,,20,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28996,SRR26936241,SRX22630097,SRS19628579,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 4,GSM7916496,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,Ha 4,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916496,GSM7916496: Ha 4; Danio rerio; ncRNA Seq,GSM7916496 r1,GSM7916496,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X21_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz,fastq,853803123.0,28538725.0,GSM7916496 r1,0:29.92,A:158220512;C:186146914;G:264519321;T:244878221;N:38155,29,,,,158220512,186146914,264519321,244878221,38155,SRX22630097,SRS19628579,SRA1756943,University of East Anglia,University of East Anglia,1,0.828,,0.18458,,0.85851,,0.6483,,32,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28997,SRR26936242,SRX22630096,SRS19628578,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 3,GSM7916495,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,Ha 3,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916495,GSM7916495: Ha 3; Danio rerio; ncRNA Seq,GSM7916495 r1,GSM7916495,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X20_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz,fastq,629106097.0,21383957.0,GSM7916495 r1,0:29.42,A:117216944;C:131994022;G:192623524;T:187243523;N:28084,29,,,,117216944,131994022,192623524,187243523,28084,SRX22630096,SRS19628578,SRA1756943,University of East Anglia,University of East Anglia,1,0.8166,,0.20457,,0.84112,,0.65357,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28998,SRR26936243,SRX22630095,SRS19628577,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 1,GSM7916494,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,La 1,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916494,GSM7916494: La 1; Danio rerio; ncRNA Seq,GSM7916494 r1,GSM7916494,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X19_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz,fastq,21178378.0,739280.0,GSM7916494 r1,0:28.65,A:4323144;C:4478932;G:6303136;T:6072190;N:976,28,,,,4323144,4478932,6303136,6072190,976,SRX22630095,SRS19628577,SRA1756943,University of East Anglia,University of East Anglia,1,0.85277,,0.21158,,0.87434,,0.62601,,26,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 28999,SRR26936244,SRX22630094,SRS19628576,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 4,GSM7916493,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,Lb 4,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916493,GSM7916493: Lb 4; Danio rerio; ncRNA Seq,GSM7916493 r1,GSM7916493,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X18_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz,fastq,959247745.0,33043430.0,GSM7916493 r1,0:29.03,A:225208425;C:212535680;G:284062577;T:237397072;N:43991,29,,,,225208425,212535680,284062577,237397072,43991,SRX22630094,SRS19628576,SRA1756943,University of East Anglia,University of East Anglia,1,0.82232,,0.22592,,0.87073,,0.6135,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29000,SRR26936245,SRX22630093,SRS19628575,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 3,GSM7916492,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,Lb 3,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916492,GSM7916492: Lb 3; Danio rerio; ncRNA Seq,GSM7916492 r1,GSM7916492,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X17_160303_D00294_0224_AC95NJANXX_6.cutadapt.se.19_100.fastq.gz,fastq,900287704.0,31947371.0,GSM7916492 r1,0:28.18,A:224093089;C:188919051;G:262824615;T:224407166;N:43783,28,,,,224093089,188919051,262824615,224407166,43783,SRX22630093,SRS19628575,SRA1756943,University of East Anglia,University of East Anglia,1,0.67003,,0.17024,,0.87095,,0.6869,,19,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29001,SRR26936246,SRX22630092,SRS19628574,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 3,GSM7916491,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,Hb 3,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916491,GSM7916491: Hb 3; Danio rerio; ncRNA Seq,GSM7916491 r1,GSM7916491,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X16_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz,fastq,80986783.0,3427704.0,GSM7916491 r1,0:23.63,A:18164838;C:19014879;G:24153410;T:19641723;N:11933,23,,,,18164838,19014879,24153410,19641723,11933,SRX22630092,SRS19628574,SRA1756943,University of East Anglia,University of East Anglia,1,0.83312,,0.24402,,0.88749,,0.63345,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29002,SRR26936247,SRX22630091,SRS19628573,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 3,GSM7916490,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,La 3,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916490,GSM7916490: La 3; Danio rerio; ncRNA Seq,GSM7916490 r1,GSM7916490,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X15_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz,fastq,148933985.0,6314805.0,GSM7916490 r1,0:23.58,A:39058546;C:30363738;G:44242466;T:35240575;N:28660,23,,,,39058546,30363738,44242466,35240575,28660,SRX22630091,SRS19628573,SRA1756943,University of East Anglia,University of East Anglia,1,0.41302,,0.13369,,0.89802,,0.57553,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29003,SRR26936248,SRX22630090,SRS19628572,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 2,GSM7916489,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,La 2,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916489,GSM7916489: La 2; Danio rerio; ncRNA Seq,GSM7916489 r1,GSM7916489,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X14_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz,fastq,538382421.0,23079847.0,GSM7916489 r1,0:23.33,A:119659971;C:112896468;G:162693210;T:143063074;N:69698,23,,,,119659971,112896468,162693210,143063074,69698,SRX22630090,SRS19628572,SRA1756943,University of East Anglia,University of East Anglia,1,0.81532,,0.23945,,0.8758,,0.62425,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29004,SRR26936249,SRX22630089,SRS19628571,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 1,GSM7916488,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,Ha 1,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916488,GSM7916488: Ha 1; Danio rerio; ncRNA Seq,GSM7916488 r1,GSM7916488,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X13_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz,fastq,761541737.0,32310434.0,GSM7916488 r1,0:23.57,A:182485471;C:173949932;G:214306916;T:190683160;N:116258,23,,,,182485471,173949932,214306916,190683160,116258,SRX22630089,SRS19628571,SRA1756943,University of East Anglia,University of East Anglia,1,0.82936,,0.23022,,0.85098,,0.59571,,19,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29005,SRR26936250,SRX22630088,SRS19628570,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 2,GSM7916487,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,Lb 2,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916487,GSM7916487: Lb 2; Danio rerio; ncRNA Seq,GSM7916487 r1,GSM7916487,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X12_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz,fastq,559417322.0,23757934.0,GSM7916487 r1,0:23.55,A:126286771;C:106333997;G:170445137;T:156287131;N:64286,23,,,,126286771,106333997,170445137,156287131,64286,SRX22630088,SRS19628570,SRA1756943,University of East Anglia,University of East Anglia,1,0.85098,,0.26224,,0.8608,,0.59344,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29006,SRR26936251,SRX22630087,SRS19628569,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 1,GSM7916486,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,Lb 1,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916486,GSM7916486: Lb 1; Danio rerio; ncRNA Seq,GSM7916486 r1,GSM7916486,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X11_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz,fastq,498695572.0,21269833.0,GSM7916486 r1,0:23.45,A:122716879;C:84997892;G:144626268;T:146292630;N:61903,23,,,,122716879,84997892,144626268,146292630,61903,SRX22630087,SRS19628569,SRA1756943,University of East Anglia,University of East Anglia,1,0.84251,,0.1958,,0.8591,,0.61008,,24,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29007,SRR26936252,SRX22630086,SRS19628568,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 10,GSM7916485,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,Hb 10,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916485,GSM7916485: Hb 10; Danio rerio; ncRNA Seq,GSM7916485 r1,GSM7916485,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X10_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz,fastq,686865211.0,29320389.0,GSM7916485 r1,0:23.43,A:156131568;C:132162427;G:201526230;T:196961742;N:83244,23,,,,156131568,132162427,201526230,196961742,83244,SRX22630086,SRS19628568,SRA1756943,University of East Anglia,University of East Anglia,1,0.85707,,0.27856,,0.85648,,0.59717,,28,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29008,SRR26936253,SRX22630085,SRS19628567,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 9,GSM7916484,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,La 9,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916484,GSM7916484: La 9; Danio rerio; ncRNA Seq,GSM7916484 r1,GSM7916484,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X9_160303_D00294_0224_AC95NJANXX_5.cutadapt.se.19_100.fastq.gz,fastq,561289514.0,23860643.0,GSM7916484 r1,0:23.52,A:140848879;C:98838555;G:161520871;T:160013845;N:67364,23,,,,140848879,98838555,161520871,160013845,67364,SRX22630085,SRS19628567,SRA1756943,University of East Anglia,University of East Anglia,1,0.85507,,0.17768,,0.86969,,0.64792,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29009,SRR26936254,SRX22630084,SRS19628566,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 8,GSM7916483,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,La 8,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916483,GSM7916483: La 8; Danio rerio; ncRNA Seq,GSM7916483 r1,GSM7916483,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X8_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz,fastq,458491681.0,16224249.0,GSM7916483 r1,0:28.26,A:99631677;C:90884289;G:139467457;T:128470855;N:37403,28,,,,99631677,90884289,139467457,128470855,37403,SRX22630084,SRS19628566,SRA1756943,University of East Anglia,University of East Anglia,1,0.81704,,0.21909,,0.84762,,0.6293,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29010,SRR26936255,SRX22630083,SRS19628565,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 9,GSM7916482,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,Ha 9,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916482,GSM7916482: Ha 9; Danio rerio; ncRNA Seq,GSM7916482 r1,GSM7916482,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X7_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz,fastq,574511047.0,20295283.0,GSM7916482 r1,0:28.31,A:134481373;C:122719422;G:169313406;T:147944946;N:51900,28,,,,134481373,122719422,169313406,147944946,51900,SRX22630083,SRS19628565,SRA1756943,University of East Anglia,University of East Anglia,1,0.81932,,0.19984,,0.85987,,0.58268,,23,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29011,SRR26936256,SRX22630082,SRS19628564,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 8,GSM7916481,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,Lb 8,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916481,GSM7916481: Lb 8; Danio rerio; ncRNA Seq,GSM7916481 r1,GSM7916481,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X6_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz,fastq,1086899780.0,37486748.0,GSM7916481 r1,0:28.99,A:219996636;C:232899819;G:335644980;T:298269921;N:88424,28,,,,219996636,232899819,335644980,298269921,88424,SRX22630082,SRS19628564,SRA1756943,University of East Anglia,University of East Anglia,1,0.86943,,0.2105,,0.84461,,0.67703,,44,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29012,SRR26936257,SRX22630081,SRS19628563,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 9,GSM7916480,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,Hb 9,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916480,GSM7916480: Hb 9; Danio rerio; ncRNA Seq,GSM7916480 r1,GSM7916480,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X5_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz,fastq,1144093618.0,39048750.0,GSM7916480 r1,0:29.30,A:223769668;C:238953593;G:358148504;T:323130325;N:91528,29,,,,223769668,238953593,358148504,323130325,91528,SRX22630081,SRS19628563,SRA1756943,University of East Anglia,University of East Anglia,1,0.87445,,0.1906,,0.87237,,0.70919,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29013,SRR26936258,SRX22630080,SRS19628562,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 7,GSM7916515,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,Hb 7,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916515,GSM7916515: Hb 7; Danio rerio; ncRNA Seq,GSM7916515 r1,GSM7916515,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X40_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz,fastq,263782568.0,9802454.0,GSM7916515 r1,0:26.91,A:59378855;C:53589034;G:83219251;T:67574216;N:21212,26,,,,59378855,53589034,83219251,67574216,21212,SRX22630080,SRS19628562,SRA1756943,University of East Anglia,University of East Anglia,1,0.80146,,0.31524,,0.81008,,0.47305,,30,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29014,SRR26936260,SRX22630079,SRS19628561,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 8,GSM7916514,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,Ha 8,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916514,GSM7916514: Ha 8; Danio rerio; ncRNA Seq,GSM7916514 r1,GSM7916514,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X39_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz,fastq,252119227.0,9309447.0,GSM7916514 r1,0:27.08,A:53293803;C:51577689;G:79148986;T:68078043;N:20706,27,,,,53293803,51577689,79148986,68078043,20706,SRX22630079,SRS19628561,SRA1756943,University of East Anglia,University of East Anglia,1,0.75593,,0.29042,,0.83412,,0.59657,,21,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29015,SRR26936261,SRX22630078,SRS19628560,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 6,GSM7916513,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,Hb 6,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916513,GSM7916513: Hb 6; Danio rerio; ncRNA Seq,GSM7916513 r1,GSM7916513,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X38_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz,fastq,516408240.0,19719085.0,GSM7916513 r1,0:26.19,A:112791146;C:102652986;G:160354602;T:140566375;N:43131,26,,,,112791146,102652986,160354602,140566375,43131,SRX22630078,SRS19628560,SRA1756943,University of East Anglia,University of East Anglia,1,0.80401,,0.31982,,0.83765,,0.57755,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29016,SRR26936262,SRX22630077,SRS19628559,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 7,GSM7916512,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,Ha 7,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916512,GSM7916512: Ha 7; Danio rerio; ncRNA Seq,GSM7916512 r1,GSM7916512,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X37_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz,fastq,554171558.0,20779285.0,GSM7916512 r1,0:26.67,A:125256371;C:111354628;G:172197000;T:145317427;N:46132,26,,,,125256371,111354628,172197000,145317427,46132,SRX22630077,SRS19628559,SRA1756943,University of East Anglia,University of East Anglia,1,0.81035,,0.28326,,0.82933,,0.62525,,35,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29017,SRR26936263,SRX22630076,SRS19628558,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 10,GSM7916511,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,Lb 10,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916511,GSM7916511: Lb 10; Danio rerio; ncRNA Seq,GSM7916511 r1,GSM7916511,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X36_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz,fastq,983846643.0,32513493.0,GSM7916511 r1,0:30.26,A:181840038;C:211101778;G:320659770;T:270174775;N:70282,30,,,,181840038,211101778,320659770,270174775,70282,SRX22630076,SRS19628558,SRA1756943,University of East Anglia,University of East Anglia,1,0.88133,,0.15829,,0.86324,,0.67761,,37,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29018,SRR26936264,SRX22630075,SRS19628557,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 9,GSM7916510,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low2|geo loc name:missing|collection date:missing,Lb 9,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low2,GSM7916510,GSM7916510: Lb 9; Danio rerio; ncRNA Seq,GSM7916510 r1,GSM7916510,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X35_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz,fastq,1077131964.0,37869598.0,GSM7916510 r1,0:28.44,A:210508796;C:220304812;G:327237157;T:319001223;N:79976,28,,,,210508796,220304812,327237157,319001223,79976,SRX22630075,SRS19628557,SRA1756943,University of East Anglia,University of East Anglia,1,0.84871,,0.22867,,0.83968,,0.66027,,35,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29019,SRR26936265,SRX22630074,SRS19628556,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Lb 7,GSM7916509,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,Lb 7,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916509,GSM7916509: Lb 7; Danio rerio; ncRNA Seq,GSM7916509 r1,GSM7916509,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X34_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz,fastq,1203153474.0,42565421.0,GSM7916509 r1,0:28.27,A:269760359;C:263088083;G:348288367;T:321910116;N:106549,28,,,,269760359,263088083,348288367,321910116,106549,SRX22630074,SRS19628556,SRA1756943,University of East Anglia,University of East Anglia,1,0.82319,,0.21661,,0.82432,,0.65954,,33,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29020,SRR26936266,SRX22630073,SRS19628555,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 7,GSM7916508,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,La 7,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916508,GSM7916508: La 7; Danio rerio; ncRNA Seq,GSM7916508 r1,GSM7916508,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X33_160303_D00294_0224_AC95NJANXX_8.cutadapt.se.19_100.fastq.gz,fastq,1137464666.0,42434385.0,GSM7916508 r1,0:26.81,A:240256314;C:218420241;G:336730784;T:341968066;N:89261,26,,,,240256314,218420241,336730784,341968066,89261,SRX22630073,SRS19628555,SRA1756943,University of East Anglia,University of East Anglia,1,0.84647,,0.26357,,0.85313,,0.67665,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29021,SRR26936259,SRX22630072,SRS19628554,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Hb 8,GSM7916479,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High2|geo loc name:missing|collection date:missing,Hb 8,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High2,GSM7916479,GSM7916479: Hb 8; Danio rerio; ncRNA Seq,GSM7916479 r1,GSM7916479,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X4_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz,fastq,1014850001.0,36540733.0,GSM7916479 r1,0:27.77,A:205870762;C:199482442;G:294628769;T:314783528;N:84500,27,,,,205870762,199482442,294628769,314783528,84500,SRX22630072,SRS19628554,SRA1756943,University of East Anglia,University of East Anglia,1,0.84303,,0.28884,,0.81692,,0.66059,,26,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29022,SRR26936268,SRX22630071,SRS19628553,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,La 10,GSM7916478,,tissue:sperm|cell line:sperm|genotype:WT|treatment:Low1|geo loc name:missing|collection date:missing,La 10,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:Low1,GSM7916478,GSM7916478: La 10; Danio rerio; ncRNA Seq,GSM7916478 r1,GSM7916478,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X3_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz,fastq,916186556.0,32659639.0,GSM7916478 r1,0:28.05,A:216314501;C:191651870;G:267047552;T:241092719;N:79914,28,,,,216314501,191651870,267047552,241092719,79914,SRX22630071,SRS19628553,SRA1756943,University of East Anglia,University of East Anglia,1,0.84312,,0.23836,,0.83132,,0.57754,,33,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29023,SRR26936269,SRX22630070,SRS19628552,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 10,GSM7916477,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,Ha 10,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916477,GSM7916477: Ha 10; Danio rerio; ncRNA Seq,GSM7916477 r1,GSM7916477,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X2_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz,fastq,858990742.0,30463457.0,GSM7916477 r1,0:28.20,A:182799146;C:179417249;G:265490509;T:231201694;N:82144,28,,,,182799146,179417249,265490509,231201694,82144,SRX22630070,SRS19628552,SRA1756943,University of East Anglia,University of East Anglia,1,0.67221,,0.19137,,0.87986,,0.67831,,33,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 29024,SRR26936270,SRX22630069,SRS19628551,SRP473892,PRJNA1044439,Social stress in fathers affects sperm small RNA and offspring transcriptome profiles,GSE248535,Transcriptome Analysis,Environmental changes may affect paternal condition and following generations but the underlying mechanisms are poorly understood. Male male competition induces a physiological stress response and affects male hormone levels ejaculate traits and development in their offspring. Here we investigated the role of sperm mediated small RNAs in the transmission of male condition to the next generation. We exposed male zebrafish Danio rerio to high and low male male competition environments for two weeks and collected sperm samples at the end. We also performed IVFs using a split clutch design to distinguish between paternal and maternal effects and collected embryos at 24 hours to test for differentially expressed genes and transposable elements TEs at this key developmental stage. We sequenced micro mi and Piwi interacting piRNAs in sperm and the full transcriptome in the embryos and ran differential expression analyses. We identified differentially expressed sperm mi and piRNAs with the strongest effects observed in sperm of males switching from high to low competition environments. We identified 612 differentially expressed genes in the embryos. These results confirm that the social environment does not only affect males but also the molecular ecology of their sperm and the gene expression in their offspring suggesting a putative role of sRNAs. Overall design: This data deposit includes the small RNA seq data for this research. Male zebrafish were subject to high and low social stress environments with sperm samples collected RNA extracted and sent for small RNA sequencing.,,pubmed:40121340,,Ha 2,GSM7916476,,tissue:sperm|cell line:sperm|genotype:WT|treatment:High1|geo loc name:missing|collection date:missing,Ha 2,Reads were trimmed aligned with PatMan and then count matrices assembled before DESeq2 analyses Assembly: GRCz10 Supplementary files format and content: piRNA raw counts.csv raw counts of a subset of 24 out of the 40 samples that were analysed. These 24 were chosen due to noise observed in PCA clustering. Supplementary files format and content: mirna raw counts.csv raw counts for 39/40 samples as one sample failed to progress through our pipeline to the same high quality as the other 39 so this sample was omitted from analyses.,sperm,,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,cell line:sperm|genotype:WT|treatment:High1,GSM7916476,GSM7916476: Ha 2; Danio rerio; ncRNA Seq,GSM7916476 r1,GSM7916476,1,Total RNA extraction New England BioLabs kit NEBNext®Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 NEB #E7300 and NEB #E7580 small RNA library prep for Illumina,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP473892,,,12235X1_160303_D00294_0224_AC95NJANXX_4.cutadapt.se.19_100.fastq.gz,fastq,262855265.0,9317037.0,GSM7916476 r1,0:28.21,A:59555006;C:56655912;G:79385169;T:67236972;N:22206,28,,,,59555006,56655912,79385169,67236972,22206,SRX22630069,SRS19628551,SRA1756943,University of East Anglia,University of East Anglia,1,0.85088,,0.21543,,0.84102,,0.63415,,28,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,United Kingdom,2023-11-23,Undetermined,Embryo,Cell Line,Cell Line 36266,SRR953577,SRX336218,SRS471213,SRP028895,PRJNA138095,Transcriptome wide analysis of small RNA expression in early zebrafish development,GSE27722,Transcriptome Analysis,During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing,,pubmed:22408181,,embryo 1dpf rep1,GSM686385,,source name:the whole embryo|strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos,embryo 1dpf rep1,"fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a "" x"" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements",the whole embryo,,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development,strain:AB*WT|developmental stage:1dpf|tissue:the whole embryos,GSM686385,GSM686385: embryo 1dpf rep1; Danio rerio; ncRNA Seq,GSM686385,,1,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,GEO Accession:GSM686385,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP028895,,,GSM686385_1dpf_Raw.txt,fastq,293700240.0,8158340.0,GSM686385 r1,0:36,A:74642033;C:62153879;G:83836688;T:69542606;N:3525034,36,,,,74642033,62153879,83836688,69542606,3525034,SRX336218,SRS471213,SRA098146,GEO,"Lee Lab, Molecular Biology, Mass General Hospital",1,0.00386,,0.00274,,0.99758,,0.53623,,36,,T,,under 1.2% mapping rate,illumina,early_illumina,5prime,size_fractionation,unknown,bulk,unknown,unknown,,United States,2011-03-07,Pharyngula,Embryo,Whole Organism,All anatomical structures 36267,SRR953576,SRX336217,SRS471211,SRP028895,PRJNA138095,Transcriptome wide analysis of small RNA expression in early zebrafish development,GSE27722,Transcriptome Analysis,During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing,,pubmed:22408181,,embryo Shield rep1,GSM686384,,source name:the whole embryo|strain:AB*WT|developmental stage:Shield|tissue:the whole embryos,embryo Shield rep1,"fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a "" x"" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements",the whole embryo,,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development,strain:AB*WT|developmental stage:Shield|tissue:the whole embryos,GSM686384,GSM686384: embryo Shield rep1; Danio rerio; ncRNA Seq,GSM686384,,1,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,GEO Accession:GSM686384,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP028895,,,GSM686384_Shield_Raw.txt,fastq,115067916.0,3196331.0,GSM686384 r1,0:36,A:28435718;C:21893278;G:31779352;T:26635839;N:6323729,36,,,,28435718,21893278,31779352,26635839,6323729,SRX336217,SRS471211,SRA098146,GEO,"Lee Lab, Molecular Biology, Mass General Hospital",1,0.00278,,0.00217,,0.99933,,0.60606,,36,,T,,under 1.2% mapping rate,illumina,early_illumina,5prime,size_fractionation,unknown,bulk,unknown,unknown,,United States,2011-03-07,Gastrula,Embryo,Whole Organism,All anatomical structures 36268,SRR953575,SRX336216,SRS471212,SRP028895,PRJNA138095,Transcriptome wide analysis of small RNA expression in early zebrafish development,GSE27722,Transcriptome Analysis,During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing,,pubmed:22408181,,embryo sphere rep2,GSM686383,,source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos,embryo sphere rep2,"fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a "" x"" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements",the whole embryo,,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development,strain:AB*WT|developmental stage:sphere|tissue:the whole embryos,GSM686383,GSM686383: embryo sphere rep2; Danio rerio; ncRNA Seq,GSM686383,,1,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,GEO Accession:GSM686383,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP028895,,,GSM686383_Sphere_2_Raw.txt,fastq,369741456.0,10270596.0,GSM686383 r1,0:36,A:89854472;C:70044086;G:109552597;T:100266590;N:23711,36,,,,89854472,70044086,109552597,100266590,23711,SRX336216,SRS471212,SRA098146,GEO,"Lee Lab, Molecular Biology, Mass General Hospital",1,0.00421,,0.00367,,0.99924,,0.51111,,36,,T,,under 1.2% mapping rate,illumina,early_illumina,5prime,size_fractionation,unknown,bulk,unknown,unknown,,United States,2011-03-07,Blastula,Embryo,Whole Organism,All anatomical structures 36269,SRR953574,SRX336215,SRS471209,SRP028895,PRJNA138095,Transcriptome wide analysis of small RNA expression in early zebrafish development,GSE27722,Transcriptome Analysis,During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing,,pubmed:22408181,,embryo sphere rep1,GSM686382,,source name:the whole embryo|strain:AB*WT|developmental stage:sphere|tissue:the whole embryos,embryo sphere rep1,"fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a "" x"" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements",the whole embryo,,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development,strain:AB*WT|developmental stage:sphere|tissue:the whole embryos,GSM686382,GSM686382: embryo sphere rep1; Danio rerio; ncRNA Seq,GSM686382,,1,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,GEO Accession:GSM686382,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP028895,,,GSM686382_Sphere_1_Raw.txt,fastq,492502284.0,13680619.0,GSM686382 r1,0:36,A:114418890;C:99502519;G:142841794;T:135061742;N:677339,36,,,,114418890,99502519,142841794,135061742,677339,SRX336215,SRS471209,SRA098146,GEO,"Lee Lab, Molecular Biology, Mass General Hospital",1,0.00828,,0.00636,,0.9964,,0.54822,,36,,T,,under 1.2% mapping rate,illumina,early_illumina,5prime,size_fractionation,unknown,bulk,unknown,unknown,,United States,2011-03-07,Blastula,Embryo,Whole Organism,All anatomical structures 36270,SRR953573,SRX336214,SRS471210,SRP028895,PRJNA138095,Transcriptome wide analysis of small RNA expression in early zebrafish development,GSE27722,Transcriptome Analysis,During early vertebrate development a large number of noncoding RNAs are maternally inherited or expressed upon activation of zygotic transcription. The exact identity expression levels and function during early vertebrate development for most of these noncoding RNAs remains largely unknown. miRNAs microRNAs and piRNAs piwi interacting RNAs are two classes of small non coding RNAs that play important roles in gene regulation during early embryonic development. Here we utilized Illumina next generation sequencing technology to determine temporal expression patterns for both miRNAs and piRNAs during four distinct stages of early vertebrate development using zebrafish as a model system. For miRNAs the expression patterns for 192 known miRNAs and 12 novel miRNAs within 123 different miRNA families were determined. Significant sequence variation was observed at the five prime' and three prime' ends of miRNAs with a large number of extra nucleotides added in a non template directed manner. We also identified a large and diverse set of piRNAs expressed during early development far beyond that expected if piRNA expression is restricted to germ cells. Our analyses represent the deepest investigation to date of small RNA expression during early vertebrate development and suggest important novel functions for small RNAs during embryogenesis. Overall design: Identify the expression of small RNAs in zebrafish embryos of four different developmental stages using high through put sequencing,,pubmed:22408181,,embryo 256 cell rep1,GSM686381,,source name:the whole embryo|strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos,embryo 256 cell rep1,"fasta: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. All the sequence with N inside was removed as well. The unique sequences were retained with the counts indicating thier abundance. The header of each sequence is composed of a unique sequence ID followed by a "" x"" and the reads counts. e.g. unique ID x counts. alignment: Initial reads were processed to remove linker sequences using a dynamic alignment algorithm which allows one mismatch in the linker sequences. Small RNAs with perfect matches to the zebrafish genome Zv8 from Ensembl http://www.ensembl.org were retrieved using megaBLAST http://www.ncbi.nlm.nih.gov/blast/megablast.shtml and Bowtie http://bowtie bio.sourceforge.net/tutorial.shtml. To identify piRNAs consensus sequences from zebrafish repetitive elements were retrieved from Repbase http://www.girinst.org/repbase/index.html and Repeat Maskers using the UCSC genome browser http://genome.ucsc.edu. Small RNAs perfectly mapping to these consensus sequences and their genomic flanking regions were sorted into piRNA libraries with up to 3 genomic mapping positions for each unique RNA sequence. fasta files description: small RNA 15 30 nt alignment file description: piRNA map to repetitive elements",the whole embryo,,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,Embryos were raised at 28°C in egg water 0.03% Instant Ocean marine salt mix for the initial several hours of development,strain:AB* WT|developmental stage:256 cell|tissue:the whole embryos,GSM686381,GSM686381: embryo 256 cell rep1; Danio rerio; ncRNA Seq,GSM686381,,1,Zebrafish embryos were collected at the 256 cell stage sphere stage shield stage and 1dpf. Total RNA was isolated from embryos using Trizol. RNAs were fractionated on 15% denaturing polyacrylamide gels and small RNAs between 15 30 nucleotides were excised and purified. cDNA libraries were generated using specific linkers and RT/PCR as previously described. Libraries were sequenced in the Genome Technology Core of Vanderbilt University using the Illumina sequencing platform.,GEO Accession:GSM686381,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP028895,,,GSM686381_256-cell_Raw.txt,fastq,177430716.0,4928631.0,GSM686381 r1,0:36,A:46047586;C:39494059;G:46591098;T:42305117;N:2992856,36,,,,46047586,39494059,46591098,42305117,2992856,SRX336214,SRS471210,SRA098146,GEO,"Lee Lab, Molecular Biology, Mass General Hospital",1,0.01914,,0.01515,,0.99164,,0.52579,,36,,B,,usable mapping rate,illumina,early_illumina,5prime,size_fractionation,unknown,bulk,unknown,unknown,,United States,2011-03-07,Blastula,Embryo,Whole Organism,All anatomical structures 37985,SRR1216351,SRX510531,SRS588958,SRP040940,PRJNA243510,Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish,GSE56498,Transcriptome Analysis,ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,parent bioproject:PRJNA541472,pubmed:24874946,,nls Cherry Ethanol #2,GSM1362715,,tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf,nls Cherry Ethanol #2,Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.,Zebrafish 5 dpf liver,,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,,tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf,GSM1362715,GSM1362715: nls Cherry Ethanol #2; Danio rerio; ncRNA Seq,GSM1362715,,1,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,GEO Accession:GSM1362715,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,,SRP040940,,,Cherry2-ethanol_raw.txt.gz,fastq,2547597500.0,25475975.0,GSM1362715 r1,0:100,A:667878423;C:617022069;G:603019059;T:656604341;N:3073608,100,,,,667878423,617022069,603019059,656604341,3073608,SRX510531,SRS588958,SRA156310,GEO,"sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai",1,0.903,,0.06203,,0.78173,,0.47105,,100,,B,,usable mapping rate,illumina,early_illumina,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2014-04-03,Larval,Larval,Liver,Liver and Biliary System 37986,SRR1216350,SRX510530,SRS588959,SRP040940,PRJNA243510,Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish,GSE56498,Transcriptome Analysis,ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,parent bioproject:PRJNA541472,pubmed:24874946,,nls Cherry Ethanol #1,GSM1362714,,tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf,nls Cherry Ethanol #1,Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.,Zebrafish 5 dpf liver,,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,,tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf,GSM1362714,GSM1362714: nls Cherry Ethanol #1; Danio rerio; ncRNA Seq,GSM1362714,,1,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,GEO Accession:GSM1362714,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,,SRP040940,,,Cherry1-ethanol_raw.txt.gz,fastq,2848772300.0,28487723.0,GSM1362714 r1,0:100,A:754173668;C:673034180;G:669171787;T:748900638;N:3492027,100,,,,754173668,673034180,669171787,748900638,3492027,SRX510530,SRS588959,SRA156310,GEO,"sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai",1,0.93424,,0.04344,,0.80365,,0.45184,,100,,B,,usable mapping rate,illumina,early_illumina,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2014-04-03,Larval,Larval,Liver,Liver and Biliary System 37987,SRR1216349,SRX510529,SRS588957,SRP040940,PRJNA243510,Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish,GSE56498,Transcriptome Analysis,ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,parent bioproject:PRJNA541472,pubmed:24874946,,nAtf6 Cherry #1,GSM1362713,,tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf,nAtf6 Cherry #1,Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.,Zebrafish 5 dpf liver,,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,,tissue type:liver|genotype:Tgfabp10:nAtf6 cherry; cmlc2:GFP|developmental stage:5 dpf,GSM1362713,GSM1362713: nAtf6 Cherry #1; Danio rerio; ncRNA Seq,GSM1362713,,1,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,GEO Accession:GSM1362713,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,,SRP040940,,,nAtf61_raw.txt.gz,fastq,2259581400.0,22595814.0,GSM1362713 r1,0:100,A:577752854;C:550694305;G:551105918;T:577235877;N:2792446,100,,,,577752854,550694305,551105918,577235877,2792446,SRX510529,SRS588957,SRA156310,GEO,"sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai",1,0.94581,,0.04947,,0.80375,,0.52352,,100,,B,,usable mapping rate,illumina,early_illumina,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2014-04-03,Larval,Larval,Liver,Liver and Biliary System 37988,SRR1216348,SRX510528,SRS588956,SRP040940,PRJNA243510,Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish,GSE56498,Transcriptome Analysis,ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,parent bioproject:PRJNA541472,pubmed:24874946,,nls Cherry #2,GSM1362712,,tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf,nls Cherry #2,Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.,Zebrafish 5 dpf liver,,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,,tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf,GSM1362712,GSM1362712: nls Cherry #2; Danio rerio; ncRNA Seq,GSM1362712,,1,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,GEO Accession:GSM1362712,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,,SRP040940,,,Cherry2_raw.txt.gz,fastq,2132003100.0,21320031.0,GSM1362712 r1,0:100,A:536532013;C:533562250;G:522685362;T:536641910;N:2581565,100,,,,536532013,533562250,522685362,536641910,2581565,SRX510528,SRS588956,SRA156310,GEO,"sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai",1,0.88352,,0.04379,,0.81947,,0.52367,,100,,B,,usable mapping rate,illumina,early_illumina,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2014-04-03,Larval,Larval,Liver,Liver and Biliary System 37989,SRR1216347,SRX510527,SRS588955,SRP040940,PRJNA243510,Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish,GSE56498,Transcriptome Analysis,ATF6 is a key regulator of the unfolded protein response. Through use of zebrafish and cultured cells we demonstrate that ATF6 drives fatty liver disease by interaction with fatty acid synthase FASN. Overall design: Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,parent bioproject:PRJNA541472,pubmed:24874946,,nls Cherry #1,GSM1362711,,tissue:Zebrafish 5 dpf liver|tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf,nls Cherry #1,Illumina CASAVA version 1.7 used for basecalling ? Mapped to the Danio rerio genome build Zv9/danRer7 Genome annotation from UCSC was used to identify exon expression and expression values for each gene were assigned by normalizing to the median of the coverage at each position of genes with non zero expression Values were quantile normalized allowing comparisons of the two sets using custom built software and algorithms as described Aravin et al. 2008; Olson et al. 2008; Tam et al. 2008 Genome build: Zv9/danRer7 Supplementary files format and content: Tab delimted text file includes reads and their frequencies.,Zebrafish 5 dpf liver,,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,,tissue type:liver|genotype:Tgfabp10:nls mCherry|developmental stage:5 dpf,GSM1362711,GSM1362711: nls Cherry #1; Danio rerio; ncRNA Seq,GSM1362711,,1,Total small RNA from livers of 5 dpf larval zebrafish were collected: 2 batches of Tgfabp10:nls mCherry control larvae 2 batches of ethanol treated Tgfabp10:nls mCherry larvae and 1 batch of Tgfabp10:nAtf6 cherry; cmlc2:GFP. Each batch was purified for preparation of high throughput sequencing libraries.,GEO Accession:GSM1362711,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,,SRP040940,,,Cherry1_raw.txt.gz,fastq,2098395500.0,20983955.0,GSM1362711 r1,0:100,A:533756912;C:521877600;G:512200617;T:528020965;N:2539406,100,,,,533756912,521877600,512200617,528020965,2539406,SRX510527,SRS588955,SRA156310,GEO,"sachidanandam, Oncological Sciences, Icahn School of Medicine at Mount Sinai",1,0.89447,,0.02865,,0.82436,,0.50802,,100,,B,,usable mapping rate,illumina,early_illumina,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2014-04-03,Larval,Larval,Liver,Liver and Biliary System 41150,SRR3744678,SRX1898686,SRS1541536,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto homozygous 5,GSM2226636,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,moto homozygous 5,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,GSM2226636,GSM2226636: moto homozygous 5; Danio rerio; ncRNA Seq,GSM2226636,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226636,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,2118467988.0,41538588.0,GSM2226636 r1,0:51,A:616161510;C:469529175;G:576120961;T:456560109;N:96233,51,,,,616161510,469529175,576120961,456560109,96233,SRX1898686,SRS1541536,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.52011,,0.38818,,0.90193,,0.51677,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41151,SRR3744677,SRX1898685,SRS1541535,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto homozygous 4,GSM2226635,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,moto homozygous 4,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,GSM2226635,GSM2226635: moto homozygous 4; Danio rerio; ncRNA Seq,GSM2226635,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226635,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,1771929771.0,34743721.0,GSM2226635 r1,0:51,A:524609276;C:393148247;G:436902442;T:417188575;N:81231,51,,,,524609276,393148247,436902442,417188575,81231,SRX1898685,SRS1541535,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.62874,,0.45148,,0.89008,,0.52837,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41152,SRR3744676,SRX1898684,SRS1541534,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto homozygous 3,GSM2226634,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,moto homozygous 3,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,GSM2226634,GSM2226634: moto homozygous 3; Danio rerio; ncRNA Seq,GSM2226634,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226634,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,1849849917.0,36271567.0,GSM2226634 r1,0:51,A:554317433;C:408404232;G:459010543;T:428033928;N:83781,51,,,,554317433,408404232,459010543,428033928,83781,SRX1898684,SRS1541534,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.69752,,0.51829,,0.89027,,0.53775,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41153,SRR3744675,SRX1898683,SRS1541533,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto homozygous 2,GSM2226633,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,moto homozygous 2,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,GSM2226633,GSM2226633: moto homozygous 2; Danio rerio; ncRNA Seq,GSM2226633,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226633,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,1863615327.0,36541477.0,GSM2226633 r1,0:51,A:554370010;C:414418365;G:465346091;T:429394630;N:86231,51,,,,554370010,414418365,465346091,429394630,86231,SRX1898683,SRS1541533,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.74326,,0.52319,,0.87361,,0.53081,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41154,SRR3744674,SRX1898682,SRS1541532,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto homozygous 1,GSM2226632,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,moto homozygous 1,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:homozygous mutant moto / ,GSM2226632,GSM2226632: moto homozygous 1; Danio rerio; ncRNA Seq,GSM2226632,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226632,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,1453145193.0,28493043.0,GSM2226632 r1,0:51,A:435644830;C:320413861;G:361678589;T:335340817;N:67096,51,,,,435644830,320413861,361678589,335340817,67096,SRX1898682,SRS1541532,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.66367,,0.47841,,0.88262,,0.50114,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41155,SRR3744673,SRX1898681,SRS1541531,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto heterozygous 6,GSM2226631,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,moto heterozygous 6,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,GSM2226631,GSM2226631: moto heterozygous 6; Danio rerio; ncRNA Seq,GSM2226631,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226631,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,2009800248.0,39407848.0,GSM2226631 r1,0:51,A:586066305;C:443066820;G:503291347;T:477284226;N:91550,51,,,,586066305,443066820,503291347,477284226,91550,SRX1898681,SRS1541531,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.69598,,0.49191,,0.8828,,0.51759,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41156,SRR3744672,SRX1898680,SRS1541530,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto heterozygous 5,GSM2226630,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,moto heterozygous 5,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,GSM2226630,GSM2226630: moto heterozygous 5; Danio rerio; ncRNA Seq,GSM2226630,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226630,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,1833618504.0,35953304.0,GSM2226630 r1,0:51,A:510624241;C:446979639;G:473431335;T:402499572;N:83717,51,,,,510624241,446979639,473431335,402499572,83717,SRX1898680,SRS1541530,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.73675,,0.50008,,0.87957,,0.53243,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41157,SRR3744671,SRX1898679,SRS1541529,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto heterozygous 4,GSM2226629,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,moto heterozygous 4,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,GSM2226629,GSM2226629: moto heterozygous 4; Danio rerio; ncRNA Seq,GSM2226629,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226629,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,2011846776.0,39447976.0,GSM2226629 r1,0:51,A:566935163;C:480777294;G:518987229;T:445055757;N:91333,51,,,,566935163,480777294,518987229,445055757,91333,SRX1898679,SRS1541529,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.7246,,0.49021,,0.88051,,0.5202,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41158,SRR3744670,SRX1898678,SRS1541528,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto heterozygous 3,GSM2226628,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,moto heterozygous 3,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,GSM2226628,GSM2226628: moto heterozygous 3; Danio rerio; ncRNA Seq,GSM2226628,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226628,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,1618368312.0,31732712.0,GSM2226628 r1,0:51,A:476792369;C:353703619;G:406141931;T:381656601;N:73792,51,,,,476792369,353703619,406141931,381656601,73792,SRX1898678,SRS1541528,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.67806,,0.48273,,0.88363,,0.53518,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41159,SRR3744669,SRX1898677,SRS1541527,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto heterozygous 2,GSM2226627,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,moto heterozygous 2,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,GSM2226627,GSM2226627: moto heterozygous 2; Danio rerio; ncRNA Seq,GSM2226627,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226627,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,1825076565.0,35785815.0,GSM2226627 r1,0:51,A:543891854;C:404479103;G:451780092;T:424842227;N:83289,51,,,,543891854,404479103,451780092,424842227,83289,SRX1898677,SRS1541527,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.53478,,0.39486,,0.89899,,0.52282,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41160,SRR3744668,SRX1898676,SRS1541526,SRP077941,PRJNA327880,Analysis of piRNA production in meioc moto mutant zebrafish testis,GSE84060,Transcriptome Analysis,We isolated a novel zebrafish mutant denoted meioc moto in which germ cells arrest at the early stage of spermatogonia. The protein encoded by the mutated gene interacts with Piwil1 and affects its intracellular localization. Thus it is interesting to explore piRNA production in meioc moto mutants. Overall design: Small RNA seq analysis of piRNA production in testes from 6 heterozygous and 5 homozygous moto mutant 10 mpf zebrafish animals.,,pubmed:39605693,,moto heterozygous 1,GSM2226626,,tissue:testis|strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,moto heterozygous 1,Sample demultiplexing and FastQ file generation was performed using Casava version 1.8.2. The raw NGS reads in FastQ format were cleaned from partial 3’ adapter sequences using Flexbar v.2.4 using parameters: m 18 ao 10 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. Read mapping to the Danio rerio reference genome Zv9/danRer7 build from Illumina iGenomes was carried out using Bowtie v.0.12.8 with parameters: n 0 e 80 l 18 y best nomaqround. All mapped reads in the piRNA range 24 32nt were collected for further analysis with NGSUtils v.0.5.2a and options: bamutils filter minlen 24 maxlen 32. Transposon annotation for zebrafish DNA LTR LINE and SINE elements was derived from the UCSC Table Browser https://genome.ucsc.edu/cgi bin/hgTables Zv9/danRer7 RepeatMasker track. The 24 32nt reads mapping in sense or antisense orientation to DNA LTR LINE and SINE transposon elements 2446490 genomic loci with 967 unique names were summarised per meta feature transposon type using Subread featureCounts v.1.5.0 and options: M F SAF s 1 for sense mapping reads and M F SAF s 2 for antisense mapping reads. Genome build: Zv9 danRer7 Supplementary files format and content: Tab delimited table with sense and antisense mapping read counts summarised per transposon type.,testis,,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,,strain:Tuebingen/WIK|age:10 month|genotype:heterozygous mutant moto+/ ,GSM2226626,GSM2226626: moto heterozygous 1; Danio rerio; ncRNA Seq,GSM2226626,,1,Testes from moto+/ and moto / zebrafish were removed and total RNA was isolated using Trizol reagent Thermo Fisher Scientific. RNAs smaller than 40nt were isolated using a 15% TBE Urea polyacrylamide gel BioRad and purified with sodium chloride/isopropanol precipitation. NGS library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina New England BioLabs as recommended by the manufacturer protocol version 2.0 8/13 with 14 PCR cycles for library amplification. The PCR amplified DNA was purified using AMPure XP beads Beckman Coulter. Size selection of the small RNA library was done on LabChip XT instrument Perkin Elmer using a DNA 300 assay kit. The library fractions in the range 120 161 bp were pooled in equal molar ratio. The resulting 2nM pool was denatured and diluted to 10 pM with 5% PhiX spike in DNA and sequenced single read 51 cycles high output mode on 2 lanes of HiSeq 2000 system Illumina.,GEO Accession:GSM2226626,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP077941,,,,,1358381226.0,26634926.0,GSM2226626 r1,0:51,A:402110510;C:300618987;G:340178435;T:315410530;N:62764,51,,,,402110510,300618987,340178435,315410530,62764,SRX1898676,SRS1541526,SRA438045,GEO,"Bioinformatics Core Facility, Institute of Molecular Biology",1,0.68106,,0.46812,,0.87596,,0.53427,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Germany,2016-07-05,Adult,Adult,Gonad,Reproductive System 41250,SRR3987432,SRX1989729,SRS1593551,SRP080353,PRJNA335856,High throughput sequencing analysis identify miRNAs in 7dpf F1 zebrafish under ß diketone antibiotics exposure to F0 zebrafish,GSE85004,Transcriptome Analysis,Small RNA high throughput sequencing technology was used to characterize the miRNAs in F1 zebrafish post 90 day ß diketone antibiotic DKA exposure to F0 zebrafish at 6.25 and 12.5 mg/L. The small RNA libraries from 7 dpf F1 zebrafish were constructed. In total 10 117 347 9 818 830 and 12 049 949 raw reads were acquired respectively under the different DKA exposure treatments 0 6.25 mg/L and 12.5mg/L from the three miRNAs libraries by Illumina sequencing. Low quality reads were removed which included five prime' contaminants those missing the three prime' primer or insert tag sequences with a poly A tail and those shorter than 17 nt and longer than 25 nt. As a result 8 141 146 representing 312 735 unique sequences; control 8 687 210 representing 251 508 unique sequences; 6.25 mg/L and 10 569 566 representing 441 938 unique sequences; 12.5 mg/L valid reads in the 17 to 25 nt size range were isolated for further analysis. The sRNAs from the three libraries were similar and the unique sRNA reads were mainly distributed in the 20 24 nt range among which 22 and 23 nt accounted for 41.8% and 20.0% of total unique sRNA reads respectively. The 22 nt sRNAs were the most abundant with the length distribution of counts of sequ seqs and unique miRNAs displaying a normal distribution. Overall design: Sample 1: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 0 mg/L; Sample 2: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 6.25 mg/L; Sample 3: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 12.5 mg/L.,,,,S12 F1,GSM2255739,,source name:F1 zebrafish 7 dpf F0 12.5 mg/L DKA exposure|strain/background:AB|genotype/variation:WT|f0 treatment:12.5 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf,S12 F1,Briefly the raw reads were subjected to the Illumina pipeline filter Solexa 0.3 and then the dataset was further processed with an in house program ACGT101 miR LC Sciences Houston Texas USA to remove adapter dimers junk low complexity common RNA families rRNA tRNA snRNA snoRNA and repeats. Subsequently unique sequences with length in 1826 nucleotide were mapped to specific species precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p and 5p derived miRNAs. Length variation at both 3’ and 5’ ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping to specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA containing arm were considered to be novel 5p or 3p derived miRNA candidates. The remaining sequences were mapped to other selected species precursors with the exclusion of specific species in miRBase 20.0 by BLAST search and the mapped pre miRNAs were further BLASTed against the specific species genomes to determine their genomic locations. The above two we defined as known miRNAs. The unmapped sequences were BLASTed against the specific genomes and the hairpin RNA structures containing sequences were predicated from the flank 80 nt sequences using RNAfold software http://rna.tbi.univie.ac.at/cgi bin/RNAfold.cgi. The criteria for secondary structure prediction were: 1 number of nucleotides in one bulge in stem <=12; 2 number of base pairs in the stem region of the predicted hairpin >=16; 3 cutoff of free energy kCal/mol <=15; 4 length of hairpin up and down stems + terminal loop >=50; 5 length of hairpin loop <=20; 6 number of nucleotides in one bulge in mature region <=8; 7 number of biased errors in one bulge in mature region<=4; 8 number of biased bulges in mature region <=2; 9 number of errors in mature region <=7; 10 number of base pairs in the mature region of the predicted hairpin >=12; and 11 percent of mature in stem >=80. For normalized abundance measurements a modified global normalization is used to correct copy numbers among different samples. Basic assumptions and procedures involved in this method are: 1. There is a subset of sequences of a significant number that do not change significantly across all samples. 2. In sequencing measurements experimental condition variations may lead to copy number reading variations. However in each sample run the reading variations occur in the same proportion to all sequences. This assumption permits the use of a single correction factor for all sequences in a sample. Genome build: Zv9 ftp://ftp.ensembl.org/pub/release 66/fasta/danio rerio/dna/ Supplementary files format and content: Table8.2 S12 F1vsS6 F1vsCON F1.xlsx indicates the differential expression between two DKA exposure treatments 6.25 and 12.5 mg/L treatments and control. Supplementary files format and content: Table8.6 S12 F1vsS6 F1.xlsx indicates the differential expression between 6.25 mg/L and 12.5 mg/L DKA exposure treatments. Supplementary files format and content: Table8.7 S6 F1vsCON F1.xlsx indicates the differential expression between 6.25 mg/L DKA exposure treatment and control. Supplementary files format and content: Table8.8 S12 F1vsCON F1.xlsx indicates the differential expression between 12.5 mg/L DKA exposure treatment and control.,F1 zebrafish 7 dpf F0 12.5 mg/L DKA exposure,Adult wild type zebrafish AB strain were purchased from a local supplier. Embryos at 6 hpf were exposed to control and two DKA treatments 6.25 and 12.5 mg/L composed of a mix of the six DKA species listed below with equal weight concentrations and equal volumes of each DKA species. post 90 days of DKA exposure F1 zebrafish at 7 dpf for each group control and two DKA exposure treatments were collected. Certified DKA reference standards were sourced from Amresco Solon OH USA and used as received: ofluoxacin CAS No. 82419 36 1 purity of 99% ciprofloxacin 85721 33 1 99% enrofloxacin 93106 60 6 99% doxycycline 24390 14 5 99% chlortetracycline 64 72 2 95% and oxytetracycline 79 57 2 99%.,Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol.,,strain/background:AB|genotype/variation:WT|f0 treatment:12.5 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf,GSM2255739,GSM2255739: S12 F1; Danio rerio; ncRNA Seq,GSM2255739,,1,Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol.,GEO Accession:GSM2255739,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP080353,,,S12_F1.fq,fastq,602497450.0,12049949.0,GSM2255739 r1,0:50,A:147750395;C:138369661;G:162147841;T:153975593;N:253960,50,,,,147750395,138369661,162147841,153975593,253960,SRX1989729,SRS1593551,SRA446490,GEO,"Wenzhou Medical University Chashan Campus Chashan University Town, Wenzhou, Zhejiang Province",1,0.0,,0.0,,1.0,,,,50,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,China,2016-07-29,Larval,Larval,Trunk,Surface Structure 41251,SRR3987431,SRX1989728,SRS1593550,SRP080353,PRJNA335856,High throughput sequencing analysis identify miRNAs in 7dpf F1 zebrafish under ß diketone antibiotics exposure to F0 zebrafish,GSE85004,Transcriptome Analysis,Small RNA high throughput sequencing technology was used to characterize the miRNAs in F1 zebrafish post 90 day ß diketone antibiotic DKA exposure to F0 zebrafish at 6.25 and 12.5 mg/L. The small RNA libraries from 7 dpf F1 zebrafish were constructed. In total 10 117 347 9 818 830 and 12 049 949 raw reads were acquired respectively under the different DKA exposure treatments 0 6.25 mg/L and 12.5mg/L from the three miRNAs libraries by Illumina sequencing. Low quality reads were removed which included five prime' contaminants those missing the three prime' primer or insert tag sequences with a poly A tail and those shorter than 17 nt and longer than 25 nt. As a result 8 141 146 representing 312 735 unique sequences; control 8 687 210 representing 251 508 unique sequences; 6.25 mg/L and 10 569 566 representing 441 938 unique sequences; 12.5 mg/L valid reads in the 17 to 25 nt size range were isolated for further analysis. The sRNAs from the three libraries were similar and the unique sRNA reads were mainly distributed in the 20 24 nt range among which 22 and 23 nt accounted for 41.8% and 20.0% of total unique sRNA reads respectively. The 22 nt sRNAs were the most abundant with the length distribution of counts of sequ seqs and unique miRNAs displaying a normal distribution. Overall design: Sample 1: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 0 mg/L; Sample 2: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 6.25 mg/L; Sample 3: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 12.5 mg/L.,,,,S6 F1,GSM2255738,,source name:F1 zebrafish 7 dpf F0 6.25 mg/L DKA exposure|strain/background:AB|genotype/variation:WT|f0 treatment:6.25 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf,S6 F1,Briefly the raw reads were subjected to the Illumina pipeline filter Solexa 0.3 and then the dataset was further processed with an in house program ACGT101 miR LC Sciences Houston Texas USA to remove adapter dimers junk low complexity common RNA families rRNA tRNA snRNA snoRNA and repeats. Subsequently unique sequences with length in 1826 nucleotide were mapped to specific species precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p and 5p derived miRNAs. Length variation at both 3’ and 5’ ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping to specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA containing arm were considered to be novel 5p or 3p derived miRNA candidates. The remaining sequences were mapped to other selected species precursors with the exclusion of specific species in miRBase 20.0 by BLAST search and the mapped pre miRNAs were further BLASTed against the specific species genomes to determine their genomic locations. The above two we defined as known miRNAs. The unmapped sequences were BLASTed against the specific genomes and the hairpin RNA structures containing sequences were predicated from the flank 80 nt sequences using RNAfold software http://rna.tbi.univie.ac.at/cgi bin/RNAfold.cgi. The criteria for secondary structure prediction were: 1 number of nucleotides in one bulge in stem <=12; 2 number of base pairs in the stem region of the predicted hairpin >=16; 3 cutoff of free energy kCal/mol <=15; 4 length of hairpin up and down stems + terminal loop >=50; 5 length of hairpin loop <=20; 6 number of nucleotides in one bulge in mature region <=8; 7 number of biased errors in one bulge in mature region<=4; 8 number of biased bulges in mature region <=2; 9 number of errors in mature region <=7; 10 number of base pairs in the mature region of the predicted hairpin >=12; and 11 percent of mature in stem >=80. For normalized abundance measurements a modified global normalization is used to correct copy numbers among different samples. Basic assumptions and procedures involved in this method are: 1. There is a subset of sequences of a significant number that do not change significantly across all samples. 2. In sequencing measurements experimental condition variations may lead to copy number reading variations. However in each sample run the reading variations occur in the same proportion to all sequences. This assumption permits the use of a single correction factor for all sequences in a sample. Genome build: Zv9 ftp://ftp.ensembl.org/pub/release 66/fasta/danio rerio/dna/ Supplementary files format and content: Table8.2 S12 F1vsS6 F1vsCON F1.xlsx indicates the differential expression between two DKA exposure treatments 6.25 and 12.5 mg/L treatments and control. Supplementary files format and content: Table8.6 S12 F1vsS6 F1.xlsx indicates the differential expression between 6.25 mg/L and 12.5 mg/L DKA exposure treatments. Supplementary files format and content: Table8.7 S6 F1vsCON F1.xlsx indicates the differential expression between 6.25 mg/L DKA exposure treatment and control. Supplementary files format and content: Table8.8 S12 F1vsCON F1.xlsx indicates the differential expression between 12.5 mg/L DKA exposure treatment and control.,F1 zebrafish 7 dpf F0 6.25 mg/L DKA exposure,Adult wild type zebrafish AB strain were purchased from a local supplier. Embryos at 6 hpf were exposed to control and two DKA treatments 6.25 and 12.5 mg/L composed of a mix of the six DKA species listed below with equal weight concentrations and equal volumes of each DKA species. post 90 days of DKA exposure F1 zebrafish at 7 dpf for each group control and two DKA exposure treatments were collected. Certified DKA reference standards were sourced from Amresco Solon OH USA and used as received: ofluoxacin CAS No. 82419 36 1 purity of 99% ciprofloxacin 85721 33 1 99% enrofloxacin 93106 60 6 99% doxycycline 24390 14 5 99% chlortetracycline 64 72 2 95% and oxytetracycline 79 57 2 99%.,Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol.,,strain/background:AB|genotype/variation:WT|f0 treatment:6.25 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf,GSM2255738,GSM2255738: S6 F1; Danio rerio; ncRNA Seq,GSM2255738,,1,Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol.,GEO Accession:GSM2255738,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP080353,,,S6_F1.fq,fastq,490941500.0,9818830.0,GSM2255738 r1,0:50,A:119942635;C:111532763;G:133144810;T:126303825;N:17467,50,,,,119942635,111532763,133144810,126303825,17467,SRX1989728,SRS1593550,SRA446490,GEO,"Wenzhou Medical University Chashan Campus Chashan University Town, Wenzhou, Zhejiang Province",1,1e-05,,0.0,,1.0,,,,50,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,China,2016-07-29,Larval,Larval,Trunk,Surface Structure 41252,SRR3987430,SRX1989727,SRS1593549,SRP080353,PRJNA335856,High throughput sequencing analysis identify miRNAs in 7dpf F1 zebrafish under ß diketone antibiotics exposure to F0 zebrafish,GSE85004,Transcriptome Analysis,Small RNA high throughput sequencing technology was used to characterize the miRNAs in F1 zebrafish post 90 day ß diketone antibiotic DKA exposure to F0 zebrafish at 6.25 and 12.5 mg/L. The small RNA libraries from 7 dpf F1 zebrafish were constructed. In total 10 117 347 9 818 830 and 12 049 949 raw reads were acquired respectively under the different DKA exposure treatments 0 6.25 mg/L and 12.5mg/L from the three miRNAs libraries by Illumina sequencing. Low quality reads were removed which included five prime' contaminants those missing the three prime' primer or insert tag sequences with a poly A tail and those shorter than 17 nt and longer than 25 nt. As a result 8 141 146 representing 312 735 unique sequences; control 8 687 210 representing 251 508 unique sequences; 6.25 mg/L and 10 569 566 representing 441 938 unique sequences; 12.5 mg/L valid reads in the 17 to 25 nt size range were isolated for further analysis. The sRNAs from the three libraries were similar and the unique sRNA reads were mainly distributed in the 20 24 nt range among which 22 and 23 nt accounted for 41.8% and 20.0% of total unique sRNA reads respectively. The 22 nt sRNAs were the most abundant with the length distribution of counts of sequ seqs and unique miRNAs displaying a normal distribution. Overall design: Sample 1: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 0 mg/L; Sample 2: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 6.25 mg/L; Sample 3: Examination of small RNA in 7 dpf F1 zebrafish post 90 day DKA exposure to F0 zebrafish at 12.5 mg/L.,,,,CON F1,GSM2255737,,source name:F1 zebrafish 7 dpf F0 0 mg/L DKA exposure|strain/background:AB|genotype/variation:WT|f0 treatment:0 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf,CON F1,Briefly the raw reads were subjected to the Illumina pipeline filter Solexa 0.3 and then the dataset was further processed with an in house program ACGT101 miR LC Sciences Houston Texas USA to remove adapter dimers junk low complexity common RNA families rRNA tRNA snRNA snoRNA and repeats. Subsequently unique sequences with length in 1826 nucleotide were mapped to specific species precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p and 5p derived miRNAs. Length variation at both 3’ and 5’ ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping to specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA containing arm were considered to be novel 5p or 3p derived miRNA candidates. The remaining sequences were mapped to other selected species precursors with the exclusion of specific species in miRBase 20.0 by BLAST search and the mapped pre miRNAs were further BLASTed against the specific species genomes to determine their genomic locations. The above two we defined as known miRNAs. The unmapped sequences were BLASTed against the specific genomes and the hairpin RNA structures containing sequences were predicated from the flank 80 nt sequences using RNAfold software http://rna.tbi.univie.ac.at/cgi bin/RNAfold.cgi. The criteria for secondary structure prediction were: 1 number of nucleotides in one bulge in stem <=12; 2 number of base pairs in the stem region of the predicted hairpin >=16; 3 cutoff of free energy kCal/mol <=15; 4 length of hairpin up and down stems + terminal loop >=50; 5 length of hairpin loop <=20; 6 number of nucleotides in one bulge in mature region <=8; 7 number of biased errors in one bulge in mature region<=4; 8 number of biased bulges in mature region <=2; 9 number of errors in mature region <=7; 10 number of base pairs in the mature region of the predicted hairpin >=12; and 11 percent of mature in stem >=80. For normalized abundance measurements a modified global normalization is used to correct copy numbers among different samples. Basic assumptions and procedures involved in this method are: 1. There is a subset of sequences of a significant number that do not change significantly across all samples. 2. In sequencing measurements experimental condition variations may lead to copy number reading variations. However in each sample run the reading variations occur in the same proportion to all sequences. This assumption permits the use of a single correction factor for all sequences in a sample. Genome build: Zv9 ftp://ftp.ensembl.org/pub/release 66/fasta/danio rerio/dna/ Supplementary files format and content: Table8.2 S12 F1vsS6 F1vsCON F1.xlsx indicates the differential expression between two DKA exposure treatments 6.25 and 12.5 mg/L treatments and control. Supplementary files format and content: Table8.6 S12 F1vsS6 F1.xlsx indicates the differential expression between 6.25 mg/L and 12.5 mg/L DKA exposure treatments. Supplementary files format and content: Table8.7 S6 F1vsCON F1.xlsx indicates the differential expression between 6.25 mg/L DKA exposure treatment and control. Supplementary files format and content: Table8.8 S12 F1vsCON F1.xlsx indicates the differential expression between 12.5 mg/L DKA exposure treatment and control.,F1 zebrafish 7 dpf F0 0 mg/L DKA exposure,Adult wild type zebrafish AB strain were purchased from a local supplier. Embryos at 6 hpf were exposed to control and two DKA treatments 6.25 and 12.5 mg/L composed of a mix of the six DKA species listed below with equal weight concentrations and equal volumes of each DKA species. post 90 days of DKA exposure F1 zebrafish at 7 dpf for each group control and two DKA exposure treatments were collected. Certified DKA reference standards were sourced from Amresco Solon OH USA and used as received: ofluoxacin CAS No. 82419 36 1 purity of 99% ciprofloxacin 85721 33 1 99% enrofloxacin 93106 60 6 99% doxycycline 24390 14 5 99% chlortetracycline 64 72 2 95% and oxytetracycline 79 57 2 99%.,Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol.,,strain/background:AB|genotype/variation:WT|f0 treatment:0 mg/L DKA exposure for 90 days|tissue:F1 whole body|f1 developmental stage:7 dpf,GSM2255737,GSM2255737: CON F1; Danio rerio; ncRNA Seq,GSM2255737,,1,Total RNA was extracted using Trizol reagent Invitrogen CA USA following the manufacturer’s procedure. The total RNA quantity and purity were analyzed by Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit Agilent CA USA with RIN number >7.0. Approximately 1 μg of total RNA was used to prepare small RNA library according to protocol of TruSeq Small RNA Sample Prep Kits Illumina San Diego USA. Then we performed the single end sequencing 36 bp on an Illumina HiSeq 2500 at the LC BIO Hangzhou China following the vendor’s recommended protocol.,GEO Accession:GSM2255737,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP080353,,,CON_F1.fq,fastq,505867350.0,10117347.0,GSM2255737 r1,0:50,A:123471791;C:114424623;G:138931875;T:129020913;N:18148,50,,,,123471791,114424623,138931875,129020913,18148,SRX1989727,SRS1593549,SRA446490,GEO,"Wenzhou Medical University Chashan Campus Chashan University Town, Wenzhou, Zhejiang Province",1,2e-05,,0.0,,0.99993,,0.66666,,50,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,China,2016-07-29,Larval,Larval,Trunk,Surface Structure 41693,SRR5122167,SRX2437316,SRS1872014,SRP095411,PRJNA358209,Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish,GSE92639,Transcriptome Analysis,Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay.,,pubmed:29228146,,PG small RNA seq 2,GSM2433869,,tissue:Ovarian follicle|strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish,PG small RNA seq 2,For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA.,Ovarian follicle,Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology.,RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively,AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis.,strain:AB|cell type:Pre vitellogenic follicle|age:from ovary of 3 month zebrafish,GSM2433869,GSM2433869: PG small RNA seq 2; Danio rerio; ncRNA Seq,GSM2433869,,1,RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively,GEO Accession:GSM2433869,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP095411,,,Ctrl_PV_1.fq.gz,fastq,532189753.0,19043107.0,GSM2433869 r1,0:27.95 1:0,A:138460901;C:107807428;G:115489810;T:170431567;N:47,27,0,,,138460901,107807428,115489810,170431567,47,SRX2437316,SRS1872014,SRA505873,GEO,"Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health",1,0.86612,,0.65562,,0.84486,,0.53167,,26,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,United States,2016-12-20,Adult,Adult,Gonad,Reproductive System 41694,SRR5122166,SRX2437315,SRS1872013,SRP095411,PRJNA358209,Identification of a specific 13 miRNA expression signature during follicle activation in Zebrafish,GSE92639,Transcriptome Analysis,Purpose: We aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish. Methods: By using small and regular RNA sequencing we performed transcriptomic analyses of PG primary growth stage I; inactive and PV pre vitellogenic stage II; activated follicles to decipher important miRNA and gene events underlying follicle activation of zebrafish. We identified differentially expressed miRNAs for subsequent qPCR validation and miRNA::target gene prediction. Interaction of candidate miRNA:: target gene pairs were further validated by luciferase reporter assay. Global gene networks involved during PG to PV transition were also assessed by Gene Ontology as well as KEGG pathway analyses. Results and Conclusion: Our expression results indicated that PG follicles can be well differentiated from PV follicles by simply using a specific 13 miRNA expression signature let 7a 7b 7c 5p 7d 5p 7h 7i; miR 21 23a 27c 3p 107a 3p 125b 5p 145 3p 202 5p. Besides we validated interactions of let 7i::atg4a miR 202 5p::c23h20orf24 and miR 144::ybx1 by luciferase reporter assay. Purpose: we aimed to investigate important miRNA events and to define specific miRNA expression signature underlying the follicle activation of zebrafish Overall design: To identify differentially expressed miRNAs and its potential downstream targets during follicle activation of zebrafish we carried out transcriptomic profiling by both small and regular RNA sequencing. By intersecting gene lists of the online predicted targets and RNA seq derived differentially expressed transcripts with a reciprocal expression pattern of miRNAs we shortlisted 6 pairs of miRNA::target gene for validation using luciferase reporter assay.,,pubmed:29228146,,PG small RNA seq 1,GSM2433868,,tissue:Ovarian follicle|strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish,PG small RNA seq 1,For the RNA seq data all the pair end reads were mapped to the zebrafish genome using TopHat version 2.0.11. Genome annotation files with GTF format for known genes were downloaded from Ensembl. FPKM and RPKM values were calculated for each miRNA and gene respectively using Cufflinks software version 2.2.1 with default parameters. Genome build: Zv9 Ensembl release 79 Supplementary files format and content: tab delimited text files include FFKM for each mRNA transcript; tab delimited text files include RFKM for each miRNA.,Ovarian follicle,Ovaries from 3 mpf adult zebrafish were dissected in 60% medium of Leibovitz L 15 and follicles PG PV were sorted out according to the size and morphology.,RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively,AB fish was housed under a stable flow through condition at 28°C on a 14L:10D photoperiod with the light on at 0800 and off at 2200. Fish were fed regularly twice a day with live brine shrimp with supplement of commercial tropical fish food at a fixed time basis.,strain:AB|cell type:Primary growth follicle|age:from ovary of 3 month zebrafish,GSM2433868,GSM2433868: PG small RNA seq 1; Danio rerio; ncRNA Seq,GSM2433868,,1,RNA was extracted with miRNeasy and RNAeasy extraction kits Qiagen RNA Seq libraries were constructed according to Illumima TrueSeq and small RNA seq protocol and sequenced with the Illumina Hiseq 2000 Single end sequencing and pair end sequencing were used for small RNA seq library and RNA seq library respectively,GEO Accession:GSM2433868,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP095411,,,Ctrl_PG_1.fq.gz,fastq,368945203.0,13147324.0,GSM2433868 r1,0:28.06 1:0,A:96466912;C:75527992;G:78177838;T:118772423;N:38,28,0,,,96466912,75527992,78177838,118772423,38,SRX2437315,SRS1872013,SRA505873,GEO,"Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health",1,0.8524,,0.67638,,0.86074,,0.48958,,27,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,United States,2016-12-20,Adult,Adult,Gonad,Reproductive System 44967,SRR6345660,SRX3442976,SRS2733636,SRP126106,PRJNA421016,Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA],GSE107682,Transcriptome Analysis,Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.,parent bioproject:PRJNA315403,pubmed:30086300,,smRNA seq library of ovary from tdrd6a mut fish,GSM2875719,,source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant,smRNA seq library of ovary from tdrd6a mut fish,1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks.,Ovary from tdrd6a mut fish,,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,,tissue:whole ovary|genotype:tdrd6a mutant,GSM2875719,GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq,GSM2875719,,1,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,GEO Accession:GSM2875719,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP126106,,,Tdrd6a-mut-ovary-input-Adult.fastq.gz,fastq,817885062.0,16036962.0,GSM2875719 r1,0:51,A:212456064;C:163491733;G:233627239;T:208262707;N:47319,51,,,,212456064,163491733,233627239,208262707,47319,SRX3442976,SRS2733636,SRA636010,GEO,"Rene Ketting, RNA silencing, IMB",1,0.46308,,0.13668,,0.83587,,0.79104,,51,,B,,usable mapping rate,illumina,hiseq_era,5prime,size_fractionation,unknown,sc_generic,single_cell_generic,generic-scrnaseq-only,,Germany,2017-12-04,Undetermined,Undetermined,Gonad,Reproductive System 44968,SRR6345659,SRX3442975,SRS2733637,SRP126106,PRJNA421016,Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA],GSE107682,Transcriptome Analysis,Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.,parent bioproject:PRJNA315403,pubmed:30086300,,smRNA seq library of ovary from tdrd6a het fish,GSM2875718,,source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous,smRNA seq library of ovary from tdrd6a het fish,1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks.,Ovary from tdrd6a het fish,,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,,tissue:whole ovary|genotype:tdrd6a heterozygous,GSM2875718,GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq,GSM2875718,,1,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,GEO Accession:GSM2875718,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP126106,,,Tdrd6a-het-ovary-input-Adult.fastq.gz,fastq,1452353571.0,28477521.0,GSM2875718 r1,0:51,A:397993735;C:284194126;G:396142390;T:373939235;N:84085,51,,,,397993735,284194126,396142390,373939235,84085,SRX3442975,SRS2733637,SRA636010,GEO,"Rene Ketting, RNA silencing, IMB",1,0.3869,,0.1369,,0.86397,,0.77165,,51,,B,,usable mapping rate,illumina,hiseq_era,5prime,size_fractionation,unknown,sc_generic,single_cell_generic,generic-scrnaseq-only,,Germany,2017-12-04,Undetermined,Undetermined,Gonad,Reproductive System 44969,SRR6345658,SRX3442974,SRS2733632,SRP126106,PRJNA421016,Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA],GSE107682,Transcriptome Analysis,Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.,parent bioproject:PRJNA315403,pubmed:30086300,,smRNA seq library of late oocytes from tdrd6a hett fish,GSM2875717,,source name:late oocytes from tdrd6a hett fish|tissue:late oocytes|genotype:tdrd6a heterozygous,smRNA seq library of late oocytes from tdrd6a hett fish,1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks.,late oocytes from tdrd6a hett fish,,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,,tissue:late oocytes|genotype:tdrd6a heterozygous,GSM2875717,GSM2875717: smRNA seq library of late oocytes from tdrd6a hett fish; Danio rerio; ncRNA Seq,GSM2875717,,1,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,GEO Accession:GSM2875717,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP126106,,,tdrd6a-het_oocytes-late-input.fastq.gz,fastq,1884769630.0,28130890.0,GSM2875717 r1,0:67,A:519051884;C:437635381;G:510738306;T:417295309;N:48750,67,,,,519051884,437635381,510738306,417295309,48750,SRX3442974,SRS2733632,SRA636010,GEO,"Rene Ketting, RNA silencing, IMB",1,0.17778,,0.06655,,0.95931,,0.91529,,67,,B,,usable mapping rate,illumina,hiseq_era,5prime,size_fractionation,unknown,sc_generic,single_cell_generic,generic-scrnaseq-only,,Germany,2017-12-04,Zygote,Embryo,Oocyte,Reproductive System 44970,SRR6345657,SRX3442973,SRS2733634,SRP126106,PRJNA421016,Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA],GSE107682,Transcriptome Analysis,Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.,parent bioproject:PRJNA315403,pubmed:30086300,,smRNA seq library of early oocytes from tdrd6a mut fish,GSM2875716,,source name:early oocytes from tdrd6a mut fish|tissue:early oocytes|genotype:tdrd6a mutant,smRNA seq library of early oocytes from tdrd6a mut fish,1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks.,early oocytes from tdrd6a mut fish,,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,,tissue:early oocytes|genotype:tdrd6a mutant,GSM2875716,GSM2875716: smRNA seq library of early oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq,GSM2875716,,1,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,GEO Accession:GSM2875716,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP126106,,,tdrd6a-mut_oocytes-early-input.fastq.gz,fastq,2102216723.0,31376369.0,GSM2875716 r1,0:67,A:592618102;C:472348913;G:550028898;T:487165955;N:54855,67,,,,592618102,472348913,550028898,487165955,54855,SRX3442973,SRS2733634,SRA636010,GEO,"Rene Ketting, RNA silencing, IMB",1,0.08293,,0.04595,,0.96193,,0.77321,,67,,B,,usable mapping rate,illumina,hiseq_era,5prime,size_fractionation,unknown,sc_generic,single_cell_generic,generic-scrnaseq-only,,Germany,2017-12-04,Zygote,Embryo,Oocyte,Reproductive System 44971,SRR6345656,SRX3442972,SRS2733635,SRP126106,PRJNA421016,Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA],GSE107682,Transcriptome Analysis,Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.,parent bioproject:PRJNA315403,pubmed:30086300,,smRNA seq library of late oocytes from tdrd6a mut fish,GSM2875715,,source name:late oocytes from tdrd6a mut fish|tissue:late oocytes|genotype:tdrd6a mutant,smRNA seq library of late oocytes from tdrd6a mut fish,1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks.,late oocytes from tdrd6a mut fish,,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,,tissue:late oocytes|genotype:tdrd6a mutant,GSM2875715,GSM2875715: smRNA seq library of late oocytes from tdrd6a mut fish; Danio rerio; ncRNA Seq,GSM2875715,,1,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,GEO Accession:GSM2875715,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP126106,,,tdrd6a-mut_oocytes-late-input.fastq.gz,fastq,2110760295.0,31503885.0,GSM2875715 r1,0:67,A:582021495;C:486821539;G:582933348;T:458929133;N:54780,67,,,,582021495,486821539,582933348,458929133,54780,SRX3442972,SRS2733635,SRA636010,GEO,"Rene Ketting, RNA silencing, IMB",1,0.17064,,0.06728,,0.96173,,0.9114,,67,,B,,usable mapping rate,illumina,hiseq_era,5prime,size_fractionation,unknown,sc_generic,single_cell_generic,generic-scrnaseq-only,,Germany,2017-12-04,Zygote,Embryo,Oocyte,Reproductive System 44972,SRR6345655,SRX3442971,SRS2733633,SRP126106,PRJNA421016,Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA],GSE107682,Transcriptome Analysis,Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.,parent bioproject:PRJNA315403,pubmed:30086300,,smRNA seq library of early oocytes from tdrd6a het fish,GSM2875714,,source name:early oocytes from tdrd6a het fish|tissue:Early oocytes|genotype:tdrd6a heterozygous,smRNA seq library of early oocytes from tdrd6a het fish,1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks.,early oocytes from tdrd6a het fish,,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,,tissue:Early oocytes|genotype:tdrd6a heterozygous,GSM2875714,GSM2875714: smRNA seq library of early oocytes from tdrd6a het fish; Danio rerio; ncRNA Seq,GSM2875714,,1,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,GEO Accession:GSM2875714,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP126106,,,tdrd6a-het_oocytes-early-input.fastq.gz,fastq,2243425655.0,33483965.0,GSM2875714 r1,0:67,A:633468129;C:503239215;G:592089295;T:514571679;N:57337,67,,,,633468129,503239215,592089295,514571679,57337,SRX3442971,SRS2733633,SRA636010,GEO,"Rene Ketting, RNA silencing, IMB",1,0.06641,,0.04254,,0.96806,,0.58509,,67,,B,,usable mapping rate,illumina,hiseq_era,5prime,size_fractionation,unknown,sc_generic,single_cell_generic,generic-scrnaseq-only,,Germany,2017-12-04,Zygote,Embryo,Oocyte,Reproductive System 48990,SRR7612999,SRX4477699,SRS3602899,SRP155545,PRJNA483217,Sequencing of Danio rerio brain for 5 age groups,GSE117807,Transcriptome Analysis,Comparison of temporal small RNA gene expression profiles from Danio rerio brain. The smallRNA seq data comprise 5 age groups at 6 12 24 36 month and 42 month. Jena Centre for Systems Biology of Ageing JenAge www.jenage.de Overall design: 25 samples in 5 groups: 6 month 5 samples 12 month 5 samples 24 month 5 samples 36 month 5 samples 42 month 5 samples.,,,,NH FLI 156 ZF brain smallRNAseq,GSM3309607,,source name:brain|strain:AB JxT\xFC Tgpu.1:GFP|tissue:brain|age:3 years|Sex:male,NH FLI 156 ZF brain smallRNAseq,Sequence information was extracted in FastQ format using CASAVA software 1.8.4 data processing step. Reads were trimmed und filtered using trimmomatic 0.36 [parameter: ILLUMINACLIP:smallRNAAdapter:2:6:6 LEADING:15 SLIDINGWINDOW:4:15 MINLEN:20]. Reads were mapped using BWA 0.7.12 r1039 [parameter: n 0 o 0 e 0 l 8 k 0]. Reads per gene were counted using samtools 1.3.1 9 ge5dfb0a. Genome build: mirBase Release 21 D. rerio sequences only Supplementary files format and content: The Excel file includes raw counts sample counts.xls of all mirBase D. rerio sequences for each sample.,brain,,Extraction was done as described in Baumgart et al. 2012. PMID:22487494 Library preparation was done using Illumina's TruSeq smallRNA Library Preparation Kit following the manufacturer's instruction.,,strain:AB JxT\xFC Tgpu.1:GFP|tissue:brain|age:3 years|Sex:male,GSM3309607,GSM3309607: NH FLI 156 ZF brain smallRNAseq; Danio rerio; ncRNA Seq,GSM3309607,,1,Extraction was done as described in Baumgart et al. 2012. PMID:22487494 Library preparation was done using Illumina's TruSeq smallRNA Library Preparation Kit following the manufacturer's instruction.,GEO Accession:GSM3309607,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP155545,,,,,681376400.0,13627528.0,GSM3309607 r1,0:50,A:149742268;C:163827889;G:200725169;T:167045618;N:35456,50,,,,149742268,163827889,200725169,167045618,35456,SRX4477699,SRS3602899,SRA745937,GEO,Leibniz Institute for Age Research - Fritz Lipmann Institute,1,0.00576,,0.00087,,0.9959,,0.70299,,50,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Germany,2018-07-27,Adult,Adult,Brain,Nervous System 48991,SRR7612998,SRX4477698,SRS3602898,SRP155545,PRJNA483217,Sequencing of Danio rerio brain for 5 age groups,GSE117807,Transcriptome Analysis,Comparison of temporal small RNA gene expression profiles from Danio rerio brain. The smallRNA seq data comprise 5 age groups at 6 12 24 36 month and 42 month. Jena Centre for Systems Biology of Ageing JenAge www.jenage.de Overall design: 25 samples in 5 groups: 6 month 5 samples 12 month 5 samples 24 month 5 samples 36 month 5 samples 42 month 5 samples.,,,,NH FLI 154 ZF brain smallRNAseq,GSM3309606,,source name:brain|strain:AB JxT\xFC Tgpu.1:GFP|tissue:brain|age:3 years|Sex:male,NH FLI 154 ZF brain smallRNAseq,Sequence information was extracted in FastQ format using CASAVA software 1.8.4 data processing step. Reads were trimmed und filtered using trimmomatic 0.36 [parameter: ILLUMINACLIP:smallRNAAdapter:2:6:6 LEADING:15 SLIDINGWINDOW:4:15 MINLEN:20]. Reads were mapped using BWA 0.7.12 r1039 [parameter: n 0 o 0 e 0 l 8 k 0]. Reads per gene were counted using samtools 1.3.1 9 ge5dfb0a. Genome build: mirBase Release 21 D. rerio sequences only Supplementary files format and content: The Excel file includes raw counts sample counts.xls of all mirBase D. rerio sequences for each sample.,brain,,Extraction was done as described in Baumgart et al. 2012. PMID:22487494 Library preparation was done using Illumina's TruSeq smallRNA Library Preparation Kit following the manufacturer's instruction.,,strain:AB JxT\xFC Tgpu.1:GFP|tissue:brain|age:3 years|Sex:male,GSM3309606,GSM3309606: NH FLI 154 ZF brain smallRNAseq; Danio rerio; ncRNA Seq,GSM3309606,,1,Extraction was done as described in Baumgart et al. 2012. PMID:22487494 Library preparation was done using Illumina's TruSeq smallRNA Library Preparation Kit following the manufacturer's instruction.,GEO Accession:GSM3309606,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP155545,,,,,1196666100.0,23933322.0,GSM3309606 r1,0:50,A:243243770;C:320296221;G:371488432;T:261584801;N:52876,50,,,,243243770,320296221,371488432,261584801,52876,SRX4477698,SRS3602898,SRA745937,GEO,Leibniz Institute for Age Research - Fritz Lipmann Institute,1,0.01627,,0.00325,,0.99293,,0.7183,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Germany,2018-07-27,Adult,Adult,Brain,Nervous System