rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 53033,SRR9674344,SRX6434730,SRS5089289,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,rnpc3 WT 1 [miRNA seq],GSM3938561,,source name:Wildtype siblings of rnpc3 mutants repeat 1|strain background:TAB 5|genotype/variation:Wildtype siblings of rnpc3 mutants|Stage:7 dpf|tissue:whole fish embryos,rnpc3 WT 1 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Wildtype siblings of rnpc3 mutants repeat 1,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Wildtype siblings of rnpc3 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938561,GSM3938561: rnpc3 WT 1 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938561,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938561,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_Rpc3_1Ctrl.fastq.gz,fastq,1129597674.0,22148974.0,GSM3938561 r1,0:51,A:255811479;C:280511308;G:313965625;T:279284342;N:24920,51,,,,255811479,280511308,313965625,279284342,24920,SRX6434730,SRS5089289,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.00979,,0.00166,,0.99588,,0.63728,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53034,SRR9674343,SRX6434729,SRS5089288,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,smn1 WT 1 [miRNA seq],GSM3938560,,source name:Wildtype siblings of smn1 mutants repeat 1|strain background:TAB 5|genotype/variation:Wildtype siblings of smn1 mutants|Stage:7 dpf|tissue:whole fish embryos,smn1 WT 1 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Wildtype siblings of smn1 mutants repeat 1,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Wildtype siblings of smn1 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938560,GSM3938560: smn1 WT 1 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938560,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938560,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_Smn1_1Ctrl.fastq.gz,fastq,1381751976.0,27093176.0,GSM3938560 r1,0:51,A:323091185;C:348663819;G:380517013;T:329446099;N:33860,51,,,,323091185,348663819,380517013,329446099,33860,SRX6434729,SRS5089288,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.00712,,0.00142,,0.99642,,0.66315,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53035,SRR9674342,SRX6434728,SRS5089287,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin5 WT 1 [miRNA seq],GSM3938559,,source name:Wildtype siblings of germin5 mutants repeat 1|strain background:TAB 5|genotype/variation:Wildtype siblings of germin5 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin5 WT 1 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Wildtype siblings of germin5 mutants repeat 1,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Wildtype siblings of germin5 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938559,GSM3938559: gemin5 WT 1 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938559,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938559,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_Gmn5_1Ctrl.fastq.gz,fastq,1347630171.0,26424121.0,GSM3938559 r1,0:51,A:307019777;C:335315873;G:378259746;T:327002846;N:31929,51,,,,307019777,335315873,378259746,327002846,31929,SRX6434728,SRS5089287,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.00723,,0.00127,,0.99582,,0.63934,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53036,SRR9674341,SRX6434727,SRS5089286,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,smn1 hom 3 [miRNA seq],GSM3938558,,source name:Homozygous smn1 mutants repeat 3|strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos,smn1 hom 3 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous smn1 mutants repeat 3,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938558,GSM3938558: smn1 hom 3 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938558,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938558,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_Smn1_3hom.fastq.gz,fastq,1269172638.0,24885738.0,GSM3938558 r1,0:51,A:290351922;C:320656517;G:354834895;T:303300306;N:28998,51,,,,290351922,320656517,354834895,303300306,28998,SRX6434727,SRS5089286,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.0061,,0.00111,,0.9962,,0.5917,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53037,SRR9674340,SRX6434726,SRS5089285,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,smn1 hom 2 [miRNA seq],GSM3938557,,source name:Homozygous smn1 mutants repeat 2|strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos,smn1 hom 2 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous smn1 mutants repeat 2,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938557,GSM3938557: smn1 hom 2 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938557,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938557,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_Smn1_2hom.fastq.gz,fastq,1625802786.0,31878486.0,GSM3938557 r1,0:51,A:376836190;C:399950981;G:453572869;T:395403783;N:38963,51,,,,376836190,399950981,453572869,395403783,38963,SRX6434726,SRS5089285,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.00609,,0.00111,,0.99638,,0.63347,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53038,SRR9674339,SRX6434725,SRS5089284,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,smn1 hom 1 [miRNA seq],GSM3938556,,source name:Homozygous smn1 mutants repeat 1|strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos,smn1 hom 1 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous smn1 mutants repeat 1,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous smn1 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938556,GSM3938556: smn1 hom 1 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938556,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938556,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_Smn1_1hom.fastq.gz,fastq,1553527320.0,30461320.0,GSM3938556 r1,0:51,A:360279409;C:388795394;G:432335873;T:372080058;N:36586,51,,,,360279409,388795394,432335873,372080058,36586,SRX6434725,SRS5089284,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.00691,,0.00137,,0.99638,,0.61909,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53039,SRR9674338,SRX6434724,SRS5089283,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin5 hom 3 [miRNA seq],GSM3938555,,source name:Homozygous gemin5 mutants repeat 3|strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin5 hom 3 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous gemin5 mutants repeat 3,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938555,GSM3938555: gemin5 hom 3 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938555,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938555,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_Gmn5_3hom.fastq.gz,fastq,1162857936.0,22801136.0,GSM3938555 r1,0:51,A:267576310;C:282684680;G:327841913;T:284728561;N:26472,51,,,,267576310,282684680,327841913,284728561,26472,SRX6434724,SRS5089283,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.00597,,0.00114,,0.99618,,0.62386,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53040,SRR9674337,SRX6434723,SRS5089282,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin5 hom 2 [miRNA seq],GSM3938554,,source name:Homozygous gemin5 mutants repeat 2|strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin5 hom 2 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous gemin5 mutants repeat 2,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938554,GSM3938554: gemin5 hom 2 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938554,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938554,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_Gmn5_2hom.fastq.gz,fastq,1612392846.0,31615546.0,GSM3938554 r1,0:51,A:360634123;C:389619637;G:457463377;T:404638471;N:37238,51,,,,360634123,389619637,457463377,404638471,37238,SRX6434723,SRS5089282,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.00538,,0.00085,,0.99677,,0.62726,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53041,SRR9674336,SRX6434722,SRS5089281,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin5 hom 1 [miRNA seq],GSM3938553,,source name:Homozygous gemin5 mutants repeat 1|strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin5 hom 1 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous gemin5 mutants repeat 1,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous gemin5 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938553,GSM3938553: gemin5 hom 1 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938553,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938553,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_Gmn5_1hom.fastq.gz,fastq,1734523362.0,34010262.0,GSM3938553 r1,0:51,A:400823854;C:428868747;G:484830308;T:419961177;N:39276,51,,,,400823854,428868747,484830308,419961177,39276,SRX6434722,SRS5089281,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.00485,,0.00098,,0.99636,,0.65384,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53042,SRR9674335,SRX6434721,SRS5089280,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin6 hom 3 [miRNA seq],GSM3938552,,source name:Homozygous gemin6 mutants repeat 3|strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin6 hom 3 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous gemin6 mutants repeat 3,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938552,GSM3938552: gemin6 hom 3 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938552,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938552,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_G6_3.fastq.gz,fastq,3450343851.0,67653801.0,GSM3938552 r1,0:51,A:777873635;C:888116741;G:969513398;T:814785464;N:54613,51,,,,777873635,888116741,969513398,814785464,54613,SRX6434721,SRS5089280,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.01435,,0.00222,,0.99486,,0.71333,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53043,SRR9674334,SRX6434720,SRS5089279,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin6 hom 2 [miRNA seq],GSM3938551,,source name:Homozygous gemin6 mutants repeat 2|strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin6 hom 2 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous gemin6 mutants repeat 2,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938551,GSM3938551: gemin6 hom 2 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938551,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938551,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_G6_2.fastq.gz,fastq,1586876781.0,31115231.0,GSM3938551 r1,0:51,A:373921059;C:393906222;G:435371208;T:383652895;N:25397,51,,,,373921059,393906222,435371208,383652895,25397,SRX6434720,SRS5089279,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.01456,,0.00199,,0.99488,,0.65884,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53044,SRR9674333,SRX6434719,SRS5089278,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin6 hom 1 [miRNA seq],GSM3938550,,source name:Homozygous gemin6 mutants repeat 1|strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin6 hom 1 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous gemin6 mutants repeat 1,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous gemin6 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938550,GSM3938550: gemin6 hom 1 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938550,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938550,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_G6_1.fastq.gz,fastq,1632291159.0,32005709.0,GSM3938550 r1,0:51,A:387703621;C:405051941;G:452019824;T:387489473;N:26300,51,,,,387703621,405051941,452019824,387489473,26300,SRX6434719,SRS5089278,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.01378,,0.00168,,0.99482,,0.66266,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53045,SRR9674332,SRX6434718,SRS5089277,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin4 hom 3 [miRNA seq],GSM3938549,,source name:Homozygous gemin4 mutants repeat 3|strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin4 hom 3 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous gemin4 mutants repeat 3,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938549,GSM3938549: gemin4 hom 3 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938549,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938549,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_G4_3.fastq.gz,fastq,1079490837.0,21166487.0,GSM3938549 r1,0:51,A:247548301;C:266526237;G:295997407;T:269401582;N:17310,51,,,,247548301,266526237,295997407,269401582,17310,SRX6434718,SRS5089277,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.01616,,0.00211,,0.99486,,0.65494,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53046,SRR9674331,SRX6434717,SRS5089276,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin4 hom 2 [miRNA seq],GSM3938548,,source name:Homozygous gemin4 mutants repeat 2|strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin4 hom 2 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous gemin4 mutants repeat 2,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938548,GSM3938548: gemin4 hom 2 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938548,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938548,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_G4_2.fastq.gz,fastq,6427925862.0,126037762.0,GSM3938548 r1,0:51,A:1491339645;C:1560095279;G:1804953332;T:1571434430;N:103176,51,,,,1491339645,1560095279,1804953332,1571434430,103176,SRX6434717,SRS5089276,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.01032,,0.00157,,0.99504,,0.70577,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 53047,SRR9674330,SRX6434716,SRS5089275,SRP214428,PRJNA554249,the role of SMN complex in tissue regeneration,GSE134187,Transcriptome Analysis,we conducted RNA Seq and MiRNA Seq to screen the molecular targets and pathways involved in tissue regeneration of SMN complex members Overall design: we compared the 3 regeneration gene mutants to the 4 non regeneration gene mutants.,,,,gemin4 hom 1 [miRNA seq],GSM3938547,,source name:Homozygous gemin4 mutants repeat 1|strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos,gemin4 hom 1 [miRNA seq],"Reads are trimmed using Trimmomatic v0.36 Trimmed reads are aligned using STAR 2.5.4a mRNA or ""hisat2 2.2.1.0 no softclip no spliced alignment rna strandness R new summary"" miRNA abundance is measured by RSEM ""rsem calculate expression paired end forward prob 0.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output"" for mRNA Seq ""rsem calculate expression forward prob 1.0 alignments p 16 seed 987347 calc ci calc pme estimate rspd time no bam output fragment length mean 22 fragment length sd 10 seed length 15"" for miRNA Seq Genome build: danRer10/Ensembl release 91 for mRNA Seq miRBase mature miRNA for microRNA Seq Supplementary files format and content: RSEM output gene abundance",Homozygous gemin4 mutants repeat 1,,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain background:TAB 5|genotype/variation:Homozygous gemin4 mutants|Stage:7 dpf|tissue:whole fish embryos,GSM3938547,GSM3938547: gemin4 hom 1 [miRNA seq]; Danio rerio; miRNA Seq,GSM3938547,,1,Embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. Prepare one paired end index library from each total RNA sample pool all libraries load pool on HiSeq 2500 run as indexed 50 base single end reads. embryos were placed in Qiazol and RNA was extracted by using Qiagen miRNeasy Mini Kit. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3938547,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP214428,,,mir_G4_1.fastq.gz,fastq,3063591624.0,60070424.0,GSM3938547 r1,0:51,A:710248035;C:750319193;G:848095316;T:754879685;N:49395,51,,,,710248035,750319193,848095316,754879685,49395,SRX6434716,SRS5089275,SRA920248,GEO,"Burgess, NHGRI, NIH",1,0.01137,,0.00151,,0.99527,,0.69096,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,bulk,bulk,,United States,2019-07-12,Larval,Larval,Whole Organism,All anatomical structures 57067,SRR11214402,SRX7826914,SRS6238049,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD18 [miRNA seq],GSM4368082,,source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,JD18 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf triptolide for 6 h,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368082,GSM4368082: JD18 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368082,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368082,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD18.combined.fastq.gz,fastq,702201000.0,14044020.0,GSM4368082 r1,0:50 1:0,A:165610842;C:167169519;G:192886323;T:176528538;N:5778,50,0,,,165610842,167169519,192886323,176528538,5778,SRX7826914,SRS6238049,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.06331,,0.00756,,0.99153,,0.5451,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57068,SRR11214401,SRX7826913,SRS6238048,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD17 [miRNA seq],GSM4368081,,source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,JD17 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf triptolide for 6 h,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368081,GSM4368081: JD17 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368081,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368081,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD17.combined.fastq.gz,fastq,429694400.0,8593888.0,GSM4368081 r1,0:50 1:0,A:105670449;C:101354858;G:115926173;T:106739304;N:3616,50,0,,,105670449,101354858,115926173,106739304,3616,SRX7826913,SRS6238048,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.04686,,0.00437,,0.99389,,0.53154,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57069,SRR11214400,SRX7826912,SRS6238047,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD16 [miRNA seq],GSM4368080,,source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,JD16 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf triptolide for 6 h,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368080,GSM4368080: JD16 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368080,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368080,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD16.combined.fastq.gz,fastq,381826650.0,7636533.0,GSM4368080 r1,0:50 1:0,A:92578473;C:90665066;G:103254018;T:95325823;N:3270,50,0,,,92578473,90665066,103254018,95325823,3270,SRX7826912,SRS6238047,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07185,,0.00402,,0.99419,,0.49823,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57070,SRR11214399,SRX7826911,SRS6238046,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD15 [miRNA seq],GSM4368079,,source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,JD15 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf triptolide for 6 h,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368079,GSM4368079: JD15 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368079,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368079,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD15.combined.fastq.gz,fastq,285535900.0,5710718.0,GSM4368079 r1,0:50 1:0,A:68624024;C:67839672;G:77291276;T:71778522;N:2406,50,0,,,68624024,67839672,77291276,71778522,2406,SRX7826911,SRS6238046,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07651,,0.00425,,0.99407,,0.54635,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57071,SRR11214398,SRX7826910,SRS6238045,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD14 [miRNA seq],GSM4368078,,source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,JD14 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf triptolide for 6 h,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368078,GSM4368078: JD14 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368078,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368078,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD14.combined.fastq.gz,fastq,363231350.0,7264627.0,GSM4368078 r1,0:50 1:0,A:87298047;C:86511359;G:98123632;T:91295160;N:3152,50,0,,,87298047,86511359,98123632,91295160,3152,SRX7826910,SRS6238045,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07156,,0.00417,,0.99314,,0.49982,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57072,SRR11214397,SRX7826909,SRS6238044,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD13 [miRNA seq],GSM4368077,,source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,JD13 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf triptolide for 6 h,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368077,GSM4368077: JD13 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368077,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368077,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD13.combined.fastq.gz,fastq,280852650.0,5617053.0,GSM4368077 r1,0:50 1:0,A:66976453;C:66985314;G:76111707;T:70776819;N:2357,50,0,,,66976453,66985314,76111707,70776819,2357,SRX7826909,SRS6238044,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.0785,,0.00403,,0.99454,,0.53818,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57073,SRR11214396,SRX7826908,SRS6238043,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD12 [miRNA seq],GSM4368076,,source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,JD12 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf triptolide for 6 h,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368076,GSM4368076: JD12 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368076,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368076,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD12.combined.fastq.gz,fastq,267278950.0,5345579.0,GSM4368076 r1,0:50 1:0,A:63524573;C:63700392;G:72574389;T:67477407;N:2189,50,0,,,63524573,63700392,72574389,67477407,2189,SRX7826908,SRS6238043,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.0867,,0.00429,,0.99403,,0.53048,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57074,SRR11214395,SRX7826907,SRS6238042,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD11 [miRNA seq],GSM4368075,,source name:30 pooled larvae 5dpf triptolide for 6 h|strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,JD11 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf triptolide for 6 h,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:triptolide 1.6μM for 6 h|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368075,GSM4368075: JD11 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368075,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368075,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD11.combined.fastq.gz,fastq,323802250.0,6476045.0,GSM4368075 r1,0:50 1:0,A:78153815;C:77052322;G:87557986;T:81035226;N:2901,50,0,,,78153815,77052322,87557986,81035226,2901,SRX7826907,SRS6238042,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.06809,,0.00424,,0.99368,,0.52229,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57075,SRR11214394,SRX7826906,SRS6238041,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD08 [miRNA seq],GSM4368074,,source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,JD08 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf vehicle,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368074,GSM4368074: JD08 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368074,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368074,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD08.combined.fastq.gz,fastq,375132100.0,7502642.0,GSM4368074 r1,0:50 1:0,A:89764502;C:89300619;G:101501695;T:94562105;N:3179,50,0,,,89764502,89300619,101501695,94562105,3179,SRX7826906,SRS6238041,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07787,,0.0042,,0.99338,,0.52599,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57076,SRR11214393,SRX7826905,SRS6238040,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD07 [miRNA seq],GSM4368073,,source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,JD07 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf vehicle,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368073,GSM4368073: JD07 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368073,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368073,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD07.combined.fastq.gz,fastq,317528050.0,6350561.0,GSM4368073 r1,0:50 1:0,A:75643339;C:75642242;G:86133220;T:80106532;N:2717,50,0,,,75643339,75642242,86133220,80106532,2717,SRX7826905,SRS6238040,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07711,,0.00424,,0.9934,,0.53196,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57077,SRR11214392,SRX7826904,SRS6238039,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD06 [miRNA seq],GSM4368072,,source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,JD06 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf vehicle,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368072,GSM4368072: JD06 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368072,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368072,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD06.combined.fastq.gz,fastq,313235150.0,6264703.0,GSM4368072 r1,0:50 1:0,A:74970317;C:74745173;G:84767516;T:78749342;N:2802,50,0,,,74970317,74745173,84767516,78749342,2802,SRX7826904,SRS6238039,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07206,,0.00403,,0.99312,,0.52846,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57078,SRR11214391,SRX7826903,SRS6238038,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD05 [miRNA seq],GSM4368071,,source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,JD05 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf vehicle,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368071,GSM4368071: JD05 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368071,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368071,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD05.combined.fastq.gz,fastq,282608400.0,5652168.0,GSM4368071 r1,0:50 1:0,A:67639670;C:67139768;G:76678815;T:71147790;N:2357,50,0,,,67639670,67139768,76678815,71147790,2357,SRX7826903,SRS6238038,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07587,,0.00384,,0.99299,,0.5434,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57079,SRR11214390,SRX7826902,SRS6238037,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD04 [miRNA seq],GSM4368070,,source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,JD04 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf vehicle,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368070,GSM4368070: JD04 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368070,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368070,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD04.combined.fastq.gz,fastq,289767100.0,5795342.0,GSM4368070 r1,0:50 1:0,A:69580978;C:68900579;G:78340509;T:72942639;N:2395,50,0,,,69580978,68900579,78340509,72942639,2395,SRX7826902,SRS6238037,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07492,,0.00373,,0.99295,,0.52294,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57080,SRR11214389,SRX7826901,SRS6238036,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD03 [miRNA seq],GSM4368069,,source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,JD03 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf vehicle,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368069,GSM4368069: JD03 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368069,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368069,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD03.combined.fastq.gz,fastq,230982600.0,4619652.0,GSM4368069 r1,0:50 1:0,A:55200177;C:55003182;G:62615802;T:58161510;N:1929,50,0,,,55200177,55003182,62615802,58161510,1929,SRX7826901,SRS6238036,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07179,,0.00361,,0.99336,,0.47352,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57081,SRR11214388,SRX7826900,SRS6238035,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD02 [miRNA seq],GSM4368068,,source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,JD02 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf vehicle,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368068,GSM4368068: JD02 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368068,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368068,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD02.combined.fastq.gz,fastq,367984500.0,7359690.0,GSM4368068 r1,0:50 1:0,A:87859797;C:87548819;G:99752643;T:92820007;N:3234,50,0,,,87859797,87548819,99752643,92820007,3234,SRX7826900,SRS6238035,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07619,,0.00398,,0.99403,,0.53717,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 57082,SRR11214387,SRX7826899,SRS6238034,SRP251256,PRJNA609696,Characterization of Triptolide Induced Hepatotoxicity by Imaging and Transcriptomics in a Novel Zebrafish Model [miRA seq],GSE146200,Transcriptome Analysis,Zebrafish larvae treated with triptolide 5 dpf larvae post exposure to triptolide 1.6µM for 6 hours or vehicle control. Overall design: A total of 16 sequencing experiments were performed control N=8 and treatment N=8. Each individual experiment consisted of 30 pooled larvae therefore 480 larvae were included in total.,parent bioproject:PRJNA609691,pubmed:28962522,,JD01 [miRNA seq],GSM4368067,,source name:30 pooled larvae 5dpf vehicle|strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,JD01 [miRNA seq],"The raw sequences were quality assessed using fastqc Primer sequences were removed using cutadapt v1.9 and parameters b CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG O 15 m 17 n 5 q 20 Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v21 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" per sample were scale normalised to the sample with the lowest number of alignments and counts converted to log2; ""abundance normalised"" data were not further quantile normalised for linear model fitting purposes. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz10; mirBase v21 Supplementary files format and content: fasta formatted non redundant sequences. The frequency of each read is given in the read name eg. x8601610 means that there were 8601610 reads with that sequence.",30 pooled larvae 5dpf vehicle,5 dpf larvae N = 30 were treated per 50 ml dish for 6 h with a TP concentration of 0 µM 8 dishes or 1.6 µM 8 dishes,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,strain:WIK|developmental stage:5dpf|treatment:vehicle|tissue:30 pooled larvae|molecule subtype:small RNA,GSM4368067,GSM4368067: JD01 [miRNA seq]; Danio rerio; ncRNA Seq,GSM4368067,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. RNA libraries were prepared for each sample with the Truseq Stranded Total RNA Sample Prep LT Kit. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4368067,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251256,,,small_JD01.combined.fastq.gz,fastq,374941900.0,7498838.0,GSM4368067 r1,0:50 1:0,A:90013932;C:89307034;G:101275933;T:94341753;N:3248,50,0,,,90013932,89307034,101275933,94341753,3248,SRX7826899,SRS6238034,SRA1049684,GEO,"Centre for Immunity, Infection and Evolution",1,0.07456,,0.00386,,0.99399,,0.52664,,50,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2020-03-02,Larval,Larval,Whole Organism,All anatomical structures 63643,SRR13979112,SRX10356673,SRS8474629,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TiBP rep4,GSM5174052,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TiBP rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174052,GSM5174052: miRNA TiBP rep4; Danio rerio; miRNA Seq,GSM5174052,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174052,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s028-indexRPI28-CAAAAG-52_S28_L001_R1_001.fastq.gz,fastq,910334614.0,9013214.0,GSM5174052 r1,0:101 1:0,A:290447743;C:219962173;G:188092578;T:211816048;N:16072,101,0,,,290447743,219962173,188092578,211816048,16072,SRX10356673,SRS8474629,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00011,,0.0,,0.99967,,0.75,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63644,SRR13979111,SRX10356672,SRS8474628,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TiBP rep3,GSM5174051,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TiBP rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174051,GSM5174051: miRNA TiBP rep3; Danio rerio; miRNA Seq,GSM5174051,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174051,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s027-indexRPI27-ATTCCT-51_S27_L001_R1_001.fastq.gz,fastq,1206610034.0,11946634.0,GSM5174051 r1,0:101 1:0,A:350061820;C:302802434;G:235521116;T:318199102;N:25562,101,0,,,350061820,302802434,235521116,318199102,25562,SRX10356672,SRS8474628,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00013,,0.0,,0.99965,,0.79166,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63645,SRR13979110,SRX10356671,SRS8474626,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TiBP rep2,GSM5174050,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TiBP rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174050,GSM5174050: miRNA TiBP rep2; Danio rerio; miRNA Seq,GSM5174050,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174050,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s026-indexRPI26-ATGAGC-50_S26_L001_R1_001.fastq.gz,fastq,464537279.0,4599379.0,GSM5174050 r1,0:101 1:0,A:139497834;C:112216637;G:99887123;T:112926329;N:9356,101,0,,,139497834,112216637,99887123,112926329,9356,SRX10356671,SRS8474626,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00022,,1e-05,,0.99955,,0.61538,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63646,SRR13979109,SRX10356670,SRS8474627,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TiBP rep1,GSM5174049,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TiBP rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174049,GSM5174049: miRNA TiBP rep1; Danio rerio; miRNA Seq,GSM5174049,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174049,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s025-indexRPI25-ACTGAT-49_S25_L001_R1_001.fastq.gz,fastq,1146926508.0,11355708.0,GSM5174049 r1,0:101 1:0,A:344954395;C:275566512;G:235491109;T:290891698;N:22794,101,0,,,344954395,275566512,235491109,290891698,22794,SRX10356670,SRS8474627,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00019,,1e-05,,0.99965,,0.71875,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63647,SRR13979108,SRX10356669,SRS8474625,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TPP rep4,GSM5174048,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TPP rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174048,GSM5174048: miRNA TPP rep4; Danio rerio; miRNA Seq,GSM5174048,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174048,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s036-indexRPI36-CCAACA-60_S36_L001_R1_001.fastq.gz,fastq,927517340.0,9183340.0,GSM5174048 r1,0:101 1:0,A:288988916;C:242744912;G:181427113;T:214337769;N:18630,101,0,,,288988916,242744912,181427113,214337769,18630,SRX10356669,SRS8474625,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00023,,1e-05,,0.99955,,0.70731,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63648,SRR13979107,SRX10356668,SRS8474624,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TPP rep3,GSM5174047,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TPP rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174047,GSM5174047: miRNA TPP rep3; Danio rerio; miRNA Seq,GSM5174047,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174047,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s035-indexRPI35-CATTTT-59_S35_L001_R1_001.fastq.gz,fastq,1013252907.0,10032207.0,GSM5174047 r1,0:101 1:0,A:295518831;C:243561888;G:197719671;T:276430583;N:21934,101,0,,,295518831,243561888,197719671,276430583,21934,SRX10356668,SRS8474624,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00013,,0.0,,0.99973,,0.48,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63649,SRR13979106,SRX10356667,SRS8474623,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TPP rep2,GSM5174046,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TPP rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174046,GSM5174046: miRNA TPP rep2; Danio rerio; miRNA Seq,GSM5174046,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174046,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s034-indexRPI34-CATGGC-58_S34_L001_R1_001.fastq.gz,fastq,907210381.0,8982281.0,GSM5174046 r1,0:101 1:0,A:265012714;C:227793861;G:194928689;T:219454152;N:20965,101,0,,,265012714,227793861,194928689,219454152,20965,SRX10356667,SRS8474623,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00013,,0.0,,0.99965,,0.875,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63650,SRR13979105,SRX10356666,SRS8474622,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TPP rep1,GSM5174045,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TPP rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174045,GSM5174045: miRNA TPP rep1; Danio rerio; miRNA Seq,GSM5174045,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174045,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s033-indexRPI33-CAGGCG-57_S33_L001_R1_001.fastq.gz,fastq,980681013.0,9709713.0,GSM5174045 r1,0:101 1:0,A:286952877;C:245397809;G:220787030;T:227522023;N:21274,101,0,,,286952877,245397809,220787030,227522023,21274,SRX10356666,SRS8474622,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00021,,1e-05,,0.99961,,0.72222,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63651,SRR13979104,SRX10356665,SRS8474621,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBPH rep4,GSM5174044,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TBPH rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174044,GSM5174044: miRNA TBPH rep4; Danio rerio; miRNA Seq,GSM5174044,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174044,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s012-indexRPI12-CTTGTA-24_S12_L001_R1_001.fastq.gz,fastq,879997850.0,8712850.0,GSM5174044 r1,0:101 1:0,A:257202916;C:211754629;G:179803383;T:231218549;N:18373,101,0,,,257202916,211754629,179803383,231218549,18373,SRX10356665,SRS8474621,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00022,,0.0,,0.99961,,0.55,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63652,SRR13979103,SRX10356664,SRS8474620,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBPH rep3,GSM5174043,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TBPH rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174043,GSM5174043: miRNA TBPH rep3; Danio rerio; miRNA Seq,GSM5174043,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174043,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s011-indexRPI11-GGCTAC-23_S11_L001_R1_001.fastq.gz,fastq,883707883.0,8749583.0,GSM5174043 r1,0:101 1:0,A:256575313;C:222504855;G:189827000;T:214781797;N:18918,101,0,,,256575313,222504855,189827000,214781797,18918,SRX10356664,SRS8474620,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00021,,0.0,,0.99961,,0.725,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63653,SRR13979102,SRX10356663,SRS8474619,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBPH rep2,GSM5174042,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TBPH rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174042,GSM5174042: miRNA TBPH rep2; Danio rerio; miRNA Seq,GSM5174042,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174042,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s010-indexRPI10-TAGCTT-22_S10_L001_R1_001.fastq.gz,fastq,727499667.0,7202967.0,GSM5174042 r1,0:101 1:0,A:212029291;C:175832603;G:148851978;T:190770471;N:15324,101,0,,,212029291,175832603,148851978,190770471,15324,SRX10356663,SRS8474619,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00025,,1e-05,,0.99951,,0.68181,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63654,SRR13979101,SRX10356662,SRS8474618,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBPH rep1,GSM5174041,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TBPH rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174041,GSM5174041: miRNA TBPH rep1; Danio rerio; miRNA Seq,GSM5174041,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174041,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s009-indexRPI9-GATCAG-21_S9_L001_R1_001.fastq.gz,fastq,351322743.0,3478443.0,GSM5174041 r1,0:101 1:0,A:105338110;C:85172820;G:75749691;T:85054964;N:7158,101,0,,,105338110,85172820,75749691,85054964,7158,SRX10356662,SRS8474618,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00036,,1e-05,,0.99953,,0.52238,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63655,SRR13979100,SRX10356661,SRS8474616,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TCEP rep4,GSM5174040,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TCEP rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174040,GSM5174040: miRNA TCEP rep4; Danio rerio; miRNA Seq,GSM5174040,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174040,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s044-indexRPI44-TATAAT-72_S44_L001_R1_001.fastq.gz,fastq,904258656.0,8953056.0,GSM5174040 r1,0:101 1:0,A:282578101;C:207780974;G:175938229;T:237943510;N:17842,101,0,,,282578101,207780974,175938229,237943510,17842,SRX10356661,SRS8474616,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.0002,,0.0,,0.99951,,0.72972,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63656,SRR13979099,SRX10356660,SRS8474615,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TCEP rep3,GSM5174039,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TCEP rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174039,GSM5174039: miRNA TCEP rep3; Danio rerio; miRNA Seq,GSM5174039,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174039,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s043-indexRPI43-TACAGC-71_S43_L001_R1_001.fastq.gz,fastq,908098777.0,8991077.0,GSM5174039 r1,0:101 1:0,A:274350569;C:227463819;G:185316266;T:220948697;N:19426,101,0,,,274350569,227463819,185316266,220948697,19426,SRX10356660,SRS8474615,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00015,,0.0,,0.99965,,0.57142,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63657,SRR13979098,SRX10356659,SRS8474617,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TCEP rep2,GSM5174038,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TCEP rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174038,GSM5174038: miRNA TCEP rep2; Danio rerio; miRNA Seq,GSM5174038,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174038,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s042-indexRPI42-TAATCG-70_S42_L001_R1_001.fastq.gz,fastq,738320403.0,7310103.0,GSM5174038 r1,0:101 1:0,A:221107544;C:178181142;G:152128298;T:186889068;N:14351,101,0,,,221107544,178181142,152128298,186889068,14351,SRX10356659,SRS8474617,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00017,,0.0,,0.99965,,0.59375,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63658,SRR13979097,SRX10356658,SRS8474612,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TCEP rep1,GSM5174037,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TCEP rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174037,GSM5174037: miRNA TCEP rep1; Danio rerio; miRNA Seq,GSM5174037,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174037,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s041-indexRPI41-GACGAC-69_S41_L001_R1_001.fastq.gz,fastq,470221761.0,4655661.0,GSM5174037 r1,0:101 1:0,A:142688200;C:117856681;G:100380615;T:109286679;N:9586,101,0,,,142688200,117856681,100380615,109286679,9586,SRX10356658,SRS8474612,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00028,,1e-05,,0.99951,,0.66666,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63659,SRR13979096,SRX10356657,SRS8474613,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TDBPP rep4,GSM5174036,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TDBPP rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174036,GSM5174036: miRNA TDBPP rep4; Danio rerio; miRNA Seq,GSM5174036,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174036,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s024-indexRPI24-GGTAGC-48_S24_L001_R1_001.fastq.gz,fastq,889897668.0,8810868.0,GSM5174036 r1,0:101 1:0,A:253810688;C:216798740;G:203615337;T:215653771;N:19132,101,0,,,253810688,216798740,203615337,215653771,19132,SRX10356657,SRS8474613,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00019,,0.0,,0.99963,,0.41176,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63660,SRR13979095,SRX10356656,SRS8474614,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TDBPP rep3,GSM5174035,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TDBPP rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174035,GSM5174035: miRNA TDBPP rep3; Danio rerio; miRNA Seq,GSM5174035,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174035,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s023-indexRPI23-GAGTGG-47_S23_L001_R1_001.fastq.gz,fastq,528666623.0,5234323.0,GSM5174035 r1,0:101 1:0,A:145917522;C:125201606;G:128827845;T:128709318;N:10332,101,0,,,145917522,125201606,128827845,128709318,10332,SRX10356656,SRS8474614,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00024,,0.0,,0.99961,,0.56818,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63661,SRR13979094,SRX10356655,SRS8474609,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TDBPP rep2,GSM5174034,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TDBPP rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174034,GSM5174034: miRNA TDBPP rep2; Danio rerio; miRNA Seq,GSM5174034,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174034,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s022-indexRPI22-CGTACG-46_S22_L001_R1_001.fastq.gz,fastq,906963537.0,8979837.0,GSM5174034 r1,0:101 1:0,A:246251307;C:236436405;G:206539134;T:217717657;N:19034,101,0,,,246251307,236436405,206539134,217717657,19034,SRX10356655,SRS8474609,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00015,,0.0,,0.99967,,0.65384,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63662,SRR13979093,SRX10356654,SRS8474611,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TDBPP rep1,GSM5174033,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TDBPP rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174033,GSM5174033: miRNA TDBPP rep1; Danio rerio; miRNA Seq,GSM5174033,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174033,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s021-indexRPI21-GTTTCG-45_S21_L001_R1_001.fastq.gz,fastq,556898547.0,5513847.0,GSM5174033 r1,0:101 1:0,A:149304325;C:137357612;G:124103413;T:146121425;N:11772,101,0,,,149304325,137357612,124103413,146121425,11772,SRX10356654,SRS8474611,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00021,,0.0,,0.99957,,0.7027,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63663,SRR13979092,SRX10356653,SRS8474610,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TCPP rep4,GSM5174032,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TCPP rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174032,GSM5174032: miRNA TCPP rep4; Danio rerio; miRNA Seq,GSM5174032,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174032,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s016-indexRPI16-CCGTCC-28_S16_L001_R1_001.fastq.gz,fastq,885697179.0,8769279.0,GSM5174032 r1,0:101 1:0,A:247836719;C:241737695;G:181087463;T:215012979;N:22323,101,0,,,247836719,241737695,181087463,215012979,22323,SRX10356653,SRS8474610,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00019,,0.0,,0.99967,,0.68571,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63664,SRR13979091,SRX10356652,SRS8474608,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TCPP rep3,GSM5174031,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TCPP rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174031,GSM5174031: miRNA TCPP rep3; Danio rerio; miRNA Seq,GSM5174031,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174031,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s015-indexRPI15-ATGTCA-27_S15_L001_R1_001.fastq.gz,fastq,566510010.0,5609010.0,GSM5174031 r1,0:101 1:0,A:170383116;C:137048514;G:115945259;T:143122249;N:10872,101,0,,,170383116,137048514,115945259,143122249,10872,SRX10356652,SRS8474608,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00025,,0.0,,0.99967,,0.54347,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63665,SRR13979090,SRX10356651,SRS8474607,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TCPP rep2,GSM5174030,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TCPP rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174030,GSM5174030: miRNA TCPP rep2; Danio rerio; miRNA Seq,GSM5174030,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174030,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s014-indexRPI14-AGTTCC-26_S14_L001_R1_001.fastq.gz,fastq,892405902.0,8835702.0,GSM5174030 r1,0:101 1:0,A:259754435;C:224608997;G:182748088;T:225275385;N:18997,101,0,,,259754435,224608997,182748088,225275385,18997,SRX10356651,SRS8474607,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00022,,0.0,,0.99951,,0.64285,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63666,SRR13979089,SRX10356650,SRS8474606,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TCPP rep1,GSM5174029,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TCPP rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174029,GSM5174029: miRNA TCPP rep1; Danio rerio; miRNA Seq,GSM5174029,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174029,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s013-indexRPI13-AGTCAA-25_S13_L001_R1_001.fastq.gz,fastq,1059166295.0,10486795.0,GSM5174029 r1,0:101 1:0,A:329962449;C:255719926;G:216763563;T:256700660;N:19697,101,0,,,329962449,255719926,216763563,256700660,19697,SRX10356650,SRS8474606,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00013,,1e-05,,0.99969,,0.63636,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63667,SRR13979088,SRX10356649,SRS8474605,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBBPA rep4,GSM5174028,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TBBPA rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174028,GSM5174028: miRNA TBBPA rep4; Danio rerio; miRNA Seq,GSM5174028,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174028,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s008-indexRPI8-ACTTGA-20_S8_L001_R1_001.fastq.gz,fastq,868526270.0,8599270.0,GSM5174028 r1,0:101 1:0,A:259616680;C:210636450;G:178110756;T:220145615;N:16769,101,0,,,259616680,210636450,178110756,220145615,16769,SRX10356649,SRS8474605,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00023,,0.0,,0.99961,,0.67441,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63668,SRR13979087,SRX10356648,SRS8474604,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBBPA rep3,GSM5174027,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TBBPA rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174027,GSM5174027: miRNA TBBPA rep3; Danio rerio; miRNA Seq,GSM5174027,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174027,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s007-indexRPI7-CAGATC-19_S7_L001_R1_001.fastq.gz,fastq,493578011.0,4886911.0,GSM5174027 r1,0:101 1:0,A:147046152;C:124953541;G:102431606;T:119137120;N:9592,101,0,,,147046152,124953541,102431606,119137120,9592,SRX10356648,SRS8474604,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00024,,1e-05,,0.99947,,0.76744,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63669,SRR13979086,SRX10356647,SRS8474603,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBBPA rep2,GSM5174026,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TBBPA rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174026,GSM5174026: miRNA TBBPA rep2; Danio rerio; miRNA Seq,GSM5174026,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174026,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s006-indexRPI6-GCCAAT-18_S6_L001_R1_001.fastq.gz,fastq,910368853.0,9013553.0,GSM5174026 r1,0:101 1:0,A:270122236;C:230334670;G:190520709;T:219373774;N:17464,101,0,,,270122236,230334670,190520709,219373774,17464,SRX10356647,SRS8474603,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00023,,0.0,,0.99949,,0.72727,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63670,SRR13979085,SRX10356646,SRS8474602,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBBPA rep1,GSM5174025,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA TBBPA rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174025,GSM5174025: miRNA TBBPA rep1; Danio rerio; miRNA Seq,GSM5174025,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174025,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s005-indexRPI5-ACAGTG-17_S5_L001_R1_001.fastq.gz,fastq,894131992.0,8852792.0,GSM5174025 r1,0:101 1:0,A:261443048;C:220215927;G:200185007;T:212270956;N:17054,101,0,,,261443048,220215927,200185007,212270956,17054,SRX10356646,SRS8474602,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00021,,1e-05,,0.99953,,0.7027,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63671,SRR13979084,SRX10356645,SRS8474601,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBBPA DBPE rep4,GSM5174024,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf DBPE,miRNA TBBPA DBPE rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf DBPE,GSM5174024,GSM5174024: miRNA TBBPA DBPE rep4; Danio rerio; miRNA Seq,GSM5174024,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174024,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s040-indexRPI40-CTCAGA-68_S40_L001_R1_001.fastq.gz,fastq,567614950.0,5619950.0,GSM5174024 r1,0:101 1:0,A:171789620;C:142600627;G:115292068;T:137921194;N:11441,101,0,,,171789620,142600627,115292068,137921194,11441,SRX10356645,SRS8474601,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00014,,0.0,,0.99965,,0.55555,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63672,SRR13979083,SRX10356644,SRS8474600,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBBPA DBPE rep3,GSM5174023,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf DBPE,miRNA TBBPA DBPE rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf DBPE,GSM5174023,GSM5174023: miRNA TBBPA DBPE rep3; Danio rerio; miRNA Seq,GSM5174023,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174023,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s039-indexRPI39-CTATAC-67_S39_L001_R1_001.fastq.gz,fastq,883651020.0,8749020.0,GSM5174023 r1,0:101 1:0,A:267266527;C:221471697;G:172032269;T:222861646;N:18881,101,0,,,267266527,221471697,172032269,222861646,18881,SRX10356644,SRS8474600,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00024,,1e-05,,0.99959,,0.65116,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63673,SRR13979082,SRX10356643,SRS8474599,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBBPA DBPE rep2,GSM5174022,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf DBPE,miRNA TBBPA DBPE rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf DBPE,GSM5174022,GSM5174022: miRNA TBBPA DBPE rep2; Danio rerio; miRNA Seq,GSM5174022,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174022,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s038-indexRPI38-CTAGCT-66_S38_L001_R1_001.fastq.gz,fastq,311086666.0,3080066.0,GSM5174022 r1,0:101 1:0,A:90852851;C:77957592;G:63570096;T:78699630;N:6497,101,0,,,90852851,77957592,63570096,78699630,6497,SRX10356643,SRS8474599,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00036,,1e-05,,0.99947,,0.6875,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63674,SRR13979081,SRX10356642,SRS8474598,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA TBBPA DBPE rep1,GSM5174021,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf DBPE,miRNA TBBPA DBPE rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf DBPE,GSM5174021,GSM5174021: miRNA TBBPA DBPE rep1; Danio rerio; miRNA Seq,GSM5174021,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174021,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s037-indexRPI37-CGGAAT-65_S37_L001_R1_001.fastq.gz,fastq,1002314506.0,9923906.0,GSM5174021 r1,0:101 1:0,A:303735625;C:240217618;G:214324562;T:244016797;N:19904,101,0,,,303735625,240217618,214324562,244016797,19904,SRX10356642,SRS8474598,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00024,,1e-05,,0.99953,,0.66666,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63675,SRR13979080,SRX10356641,SRS8474597,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA IPP rep4,GSM5174020,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA IPP rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174020,GSM5174020: miRNA IPP rep4; Danio rerio; miRNA Seq,GSM5174020,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174020,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s032-indexRPI32-CACTCA-56_S32_L001_R1_001.fastq.gz,fastq,1129258881.0,11180781.0,GSM5174020 r1,0:101 1:0,A:335239774;C:296599595;G:223965990;T:273431685;N:21837,101,0,,,335239774,296599595,223965990,273431685,21837,SRX10356641,SRS8474597,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00013,,0.0,,0.99959,,0.75,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63676,SRR13979079,SRX10356640,SRS8474596,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA IPP rep3,GSM5174019,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA IPP rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174019,GSM5174019: miRNA IPP rep3; Danio rerio; miRNA Seq,GSM5174019,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174019,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s031-indexRPI31-CACGAT-55_S31_L001_R1_001.fastq.gz,fastq,1364695941.0,13511841.0,GSM5174019 r1,0:101 1:0,A:408343873;C:341704999;G:281119661;T:333499060;N:28348,101,0,,,408343873,341704999,281119661,333499060,28348,SRX10356640,SRS8474596,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00016,,0.0,,0.99961,,0.68965,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63677,SRR13979078,SRX10356639,SRS8474595,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA IPP rep2,GSM5174018,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA IPP rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174018,GSM5174018: miRNA IPP rep2; Danio rerio; miRNA Seq,GSM5174018,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174018,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s030-indexRPI30-CACCGG-54_S30_L001_R1_001.fastq.gz,fastq,1118435923.0,11073623.0,GSM5174018 r1,0:101 1:0,A:322914077;C:292720303;G:241919484;T:260855307;N:26752,101,0,,,322914077,292720303,241919484,260855307,26752,SRX10356639,SRS8474595,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.0002,,1e-05,,0.99959,,0.74285,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63678,SRR13979077,SRX10356638,SRS8474594,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA IPP rep1,GSM5174017,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA IPP rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174017,GSM5174017: miRNA IPP rep1; Danio rerio; miRNA Seq,GSM5174017,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174017,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s029-indexRPI29-CAACTA-53_S29_L001_R1_001.fastq.gz,fastq,965915217.0,9563517.0,GSM5174017 r1,0:101 1:0,A:298517953;C:241792467;G:190277966;T:235308237;N:18594,101,0,,,298517953,241792467,190277966,235308237,18594,SRX10356638,SRS8474594,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00011,,0.0,,0.99973,,0.55,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63679,SRR13979076,SRX10356637,SRS8474593,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA BDE 47 rep4,GSM5174016,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA BDE 47 rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174016,GSM5174016: miRNA BDE 47 rep4; Danio rerio; miRNA Seq,GSM5174016,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174016,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s020-indexRPI20-GTGGCC-44_S20_L001_R1_001.fastq.gz,fastq,990919989.0,9811089.0,GSM5174016 r1,0:101 1:0,A:281268229;C:247800394;G:221010761;T:240816791;N:23814,101,0,,,281268229,247800394,221010761,240816791,23814,SRX10356637,SRS8474593,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00016,,0.0,,0.99965,,0.7,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63680,SRR13979075,SRX10356636,SRS8474592,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA BDE 47 rep3,GSM5174015,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA BDE 47 rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174015,GSM5174015: miRNA BDE 47 rep3; Danio rerio; miRNA Seq,GSM5174015,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174015,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s019-indexRPI19-GTGAAA-43_S19_L001_R1_001.fastq.gz,fastq,936520278.0,9272478.0,GSM5174015 r1,0:101 1:0,A:292610982;C:215924738;G:200657250;T:227310895;N:16413,101,0,,,292610982,215924738,200657250,227310895,16413,SRX10356636,SRS8474592,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00017,,0.0,,0.99961,,0.6,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63681,SRR13979074,SRX10356635,SRS8474591,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA BDE 47 rep2,GSM5174014,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA BDE 47 rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174014,GSM5174014: miRNA BDE 47 rep2; Danio rerio; miRNA Seq,GSM5174014,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174014,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s018-indexRPI18-GTCCGC-42_S18_L001_R1_001.fastq.gz,fastq,923871038.0,9147238.0,GSM5174014 r1,0:101 1:0,A:261826604;C:240583077;G:197471686;T:223966265;N:23406,101,0,,,261826604,240583077,197471686,223966265,23406,SRX10356635,SRS8474591,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00019,,0.0,,0.99963,,0.70588,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63682,SRR13979073,SRX10356634,SRS8474588,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA BDE 47 rep1,GSM5174013,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA BDE 47 rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174013,GSM5174013: miRNA BDE 47 rep1; Danio rerio; miRNA Seq,GSM5174013,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174013,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s017-indexRPI17-GTAGAG-41_S17_L001_R1_001.fastq.gz,fastq,963214780.0,9536780.0,GSM5174013 r1,0:101 1:0,A:290268878;C:222146596;G:216903245;T:233878186;N:17875,101,0,,,290268878,222146596,216903245,233878186,17875,SRX10356634,SRS8474588,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00013,,0.0,,0.99971,,0.58333,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63683,SRR13979072,SRX10356633,SRS8474589,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA Control rep4,GSM5174012,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA Control rep4,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174012,GSM5174012: miRNA Control rep4; Danio rerio; miRNA Seq,GSM5174012,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174012,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s004-indexRPI4-TGACCA-4_S4_L001_R1_001.fastq.gz,fastq,776677274.0,7689874.0,GSM5174012 r1,0:101 1:0,A:233505881;C:196049592;G:158864473;T:188241779;N:15549,101,0,,,233505881,196049592,158864473,188241779,15549,SRX10356633,SRS8474589,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00024,,0.0,,0.99949,,0.76086,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63684,SRR13979071,SRX10356632,SRS8474590,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA Control rep3,GSM5174011,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA Control rep3,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174011,GSM5174011: miRNA Control rep3; Danio rerio; miRNA Seq,GSM5174011,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174011,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s003-indexRPI3-TTAGGC-3_S3_L001_R1_001.fastq.gz,fastq,489457615.0,4846115.0,GSM5174011 r1,0:101 1:0,A:141598763;C:118796680;G:105152559;T:123899061;N:10552,101,0,,,141598763,118796680,105152559,123899061,10552,SRX10356632,SRS8474590,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00037,,0.0,,0.99947,,0.66666,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63685,SRR13979070,SRX10356631,SRS8474586,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA Control rep2,GSM5174010,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA Control rep2,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174010,GSM5174010: miRNA Control rep2; Danio rerio; miRNA Seq,GSM5174010,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174010,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s002-indexRPI2-CGATGT-2_S2_L001_R1_001.fastq.gz,fastq,777242066.0,7695466.0,GSM5174010 r1,0:101 1:0,A:226389551;C:187485077;G:166405949;T:196945091;N:16398,101,0,,,226389551,187485077,166405949,196945091,16398,SRX10356631,SRS8474586,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00026,,0.0,,0.99957,,0.62,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures 63686,SRR13979069,SRX10356630,SRS8474585,SRP310924,PRJNA714931,Phenotypically anchored mRNA and miRNA expression profiling in zebrafish reveals flame retardant chemical toxicity networks,GSE169013,Transcriptome Analysis,Purpose: The goals of this study are to examine mRNA and miR networks on exposures to flame retardant chemicals FRCs an ubiquitous group of chemicals in the environment Methods: Four biological replicates were created by pooling eight embryos per replicate from individual wells which were placed into an Eppendorf Safelock Tube and excess solution removed. 0.5 mM zirconium oxide beads were added along with 500 µL of RNAzol Molecular Research Center Inc. and the tubes were immediately placed into a bullet blender Next Advance using settings recommended by the manufacturer. The RNA was purified using the Direct zol MiniPrep kit Zymo Research including an optional DNase 1 digestion treatment for 15 minutes. RNA integrity RIN was assessed using an Agilent Bioanalyzer Santa Clara CA and RNA samples with RIN values >8 were processed for library preparation and sequencing at the Oregon State University Center for Genome Research and Biocomputing. Total RNA was used as input for both mRNA and miRNA sequencing. For mRNA sequencing mRNA was poly A selected libraries were prepared with the PrepX™ mRNA and Illumina sequencing workflow Wafergen Biosystems. For miRNA seq the Illumina TruSeq Small RNA library kit was used to generate small RNA libraries from total RNA. For sequencing an Illumina HiSeq 3000 sequencer Illumina San Diego was used for mRNA and small RNA single end sequencing at 100 and 50 base pairs respectively. Bioinformatics analysis of sequencing data was performed on an R platform. Briefly reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 . RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 Kim et al. 2013 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome. For miR identification and quantification a combination of miRDeep2 v2.0.0.8 miRBase release 22 and Bowtie v1.2.1.1 were used. Differential expression between experimental and control samples was determined with functions from the Bioconductor package edgeR; mRNAs with a log2 fold change =1.5 and Benjamini Hochberg BH adjusted p = 0.05 were considered differentially expressed while an adjusted p = 0.05 was applied to miRs without xxx fold change cutoffs. Heatmap clustering of differentially expressed genes were generated in R based on their log2 fold changes using the ggplot2 package. Results: We found widespread disruption of mRNA and miR expression. Neurodevelopment was a key disrupted biological process across multiple FRCs and was corroborated by behavioral deficits. Several mRNAs eg: osbpl2a and miRs eg mir 125b 5p showed differential expression common to multiple FRCs 10 and 7 respectively. These common miRs were also predicted to regulate a network of differentially expressed genes with diverse functions including apoptosis neurodevelopment lipid regulation and inflammation. Commonly disrupted transcription factors TFs such as RXR RAR and VDR were predicted to regulate a wide network of differentially expressed mRNAs across a majority of the FRCs. Many of the differential mRNA TF and mRNA miR pairs were predicted to play important roles in development as well as cancer signaling. Specific comparisons between TBBPA and its derivative TBBPA DBPE showed contrasting gene expression patterns that corroborated with their phenotypic profiles. The newer generation FRCs such as IPP and TCEP produced distinct gene expression changes compared to the legacy FRC BDE 47. Conclusions: Our study is the first to establish a mRNA miR TF regulatory network across a large group of structurally diverse FRCs and diverse phenotypic responses. The purpose was to discover common and unique biological targets that will help us understand mechanisms of action for these important chemicals. Overall design: mRNA and miR profiles of zebrafish embryos exposed to 10 FRCs from xxx ttwo xxx hpf,,pubmed:33898466,,miRNA Control rep1,GSM5174009,,tissue:zebrafish whole embryos|strain:5D|developmental stage:48 hpf,miRNA Control rep1,For mRNA seq reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For mRNA seq the Bioconductor package edgeR v3.26.0 was used to normalize gene counts and determine differential expression For miRNA reads were evaluated by FastQC v0.11.3 to detect major sequencing problems and then trimmed for quality control with Skewer v0.2.2 to remove ends of reads with low mean Phred quality score. RNA seq alignment and quantification proceeded with Bowtie2 v2.2.3 being used to build HISAT2 genome index files from the Genome Reference Consortium Zebrafish Build 10 GRCz10 genome For miRNA the Bioconductor package edgeR v3.26.0 was used to normalize miRNA gene counts and determine expression Genome build: GRz10 for mRNA Supplementary files format and content: DGE rlog TMM normalized counts FRC mRNA.tab is a tab delimited text files include TMM normalized values for each Sample Supplementary files format and content: Combined HTSeq count table FRC mRNA.tab is a tab delimited text files contain raw gene counts for every gene and every sample Supplementary files format and content: DGE rlog transformed counts FRC miRNA.tab is a tab delimited text file with transformed miRNA counts for each sample Supplementary files format and content: Count matrix FRC miRNA.tab is a tab delimited text file with miRNA counts for each sample,zebrafish whole embryos,Embryos were treated with EC80 or limit concentrations of FRCs from 6 hpf to 48 hpf.,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,,strain:5D|developmental stage:48 hpf,GSM5174009,GSM5174009: miRNA Control rep1; Danio rerio; miRNA Seq,GSM5174009,,1,FRC exposed embryos were homogenzied in RNAzol 4 replicates per treatment and total RNA was extracted using the Direct zol MiniPrep kit. Total RNA was then processed for library preparation mRNA and small RNA libraries were prepared using the PrepX™ mRNA and Illumina TruSeq Small RNA library kit respectively. Illumina HiSeq 3000 single end 100 bp for mRNA and 50 bp for small RNA,GEO Accession:GSM5174009,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP310924,,,miRNA_lane1-s001-indexRPI1-ATCACG-1_S1_L001_R1_001.fastq.gz,fastq,370858163.0,3671863.0,GSM5174009 r1,0:101 1:0,A:112058381;C:93306905;G:75506546;T:89979021;N:7310,101,0,,,112058381,93306905,75506546,89979021,7310,SRX10356630,SRS8474585,SRA1207022,GEO,"Robert L. Tanguay, Environmental & Molecular Toxicology, Oregon State University",1,0.00033,,1e-05,,0.99949,,0.64516,,101,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,bulk,bulk,,United States,2021-03-16,Hatching,Embryo,Whole Organism,All anatomical structures