rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
44,DRR668250,DRX648352,DRS458865,DRP012880,PRJDB18466,Comparison of spinal cord regeneration capacity in zebrafish and medaka,PRJDB18466,Other,Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.,,pubmed:40278963,Zebrafish 2 weeks post spinal cord injury replicate 3,Zebrafish 2wpi 3,SAMD00799623,,sample name:Zebrafish 2wpi 3|biological replicate:3|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 25|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord,,,,,,,,,DNBSEQ G400 paired end sequencing of SAMD00799623,DRX648352,RNA seq of spinal cord in zebrafish at 2wpi injured 3,1,Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,DNBSEQ,DNBSEQ-G400,,DRP012880,DNBSEQ G400 paired end sequencing of SAMD00799623,,,,14782516800.0,73912584.0,DRR668250,0:100 1:100,A:4058090278;C:3335994894;G:3323563782;T:4062467903;N:2399943,100,100,,,4058090278,3335994894,3323563782,4062467903,2399943,DRX648352,DRS458865,DRA020617,Osaka University,Osaka University,,,,,,,,,,,,B,B,biological fallback assumption,bgi,bgi,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2025-05-12,Adult,Adult,Spinal Cord,Nervous System
45,DRR668249,DRX648351,DRS458864,DRP012880,PRJDB18466,Comparison of spinal cord regeneration capacity in zebrafish and medaka,PRJDB18466,Other,Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.,,pubmed:40278963,Zebrafish 2 weeks post spinal cord injury replicate 2,Zebrafish 2wpi 2,SAMD00799622,,sample name:Zebrafish 2wpi 2|biological replicate:2|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 14|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord,,,,,,,,,DNBSEQ G400 paired end sequencing of SAMD00799622,DRX648351,RNA seq of spinal cord in zebrafish at 2wpi injured 2,1,Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,DNBSEQ,DNBSEQ-G400,,DRP012880,DNBSEQ G400 paired end sequencing of SAMD00799622,,,,13687641800.0,68438209.0,DRR668249,0:100 1:100,A:3759784620;C:3087398782;G:3083881581;T:3754378915;N:2197902,100,100,,,3759784620,3087398782,3083881581,3754378915,2197902,DRX648351,DRS458864,DRA020617,Osaka University,Osaka University,,,,,,,,,,,,B,B,biological fallback assumption,bgi,bgi,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2025-05-12,Adult,Adult,Spinal Cord,Nervous System
46,DRR668248,DRX648350,DRS458863,DRP012880,PRJDB18466,Comparison of spinal cord regeneration capacity in zebrafish and medaka,PRJDB18466,Other,Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.,,pubmed:40278963,Zebrafish 2 weeks post spinal cord injury replicate 1,Zebrafish 2wpi 1,SAMD00799621,,sample name:Zebrafish 2wpi 1|biological replicate:1|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 14|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord,,,,,,,,,DNBSEQ G400 paired end sequencing of SAMD00799621,DRX648350,RNA seq of spinal cord in zebrafish at 2wpi injured 1,1,Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,DNBSEQ,DNBSEQ-G400,,DRP012880,DNBSEQ G400 paired end sequencing of SAMD00799621,,,,16376197200.0,81880986.0,DRR668248,0:100 1:100,A:4485868844;C:3700974430;G:3710833937;T:4475827800;N:2692189,100,100,,,4485868844,3700974430,3710833937,4475827800,2692189,DRX648350,DRS458863,DRA020617,Osaka University,Osaka University,,,,,,,,,,,,B,B,biological fallback assumption,bgi,bgi,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2025-05-12,Adult,Adult,Spinal Cord,Nervous System
47,DRR668247,DRX648349,DRS458862,DRP012880,PRJDB18466,Comparison of spinal cord regeneration capacity in zebrafish and medaka,PRJDB18466,Other,Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.,,pubmed:40278963,Zebrafish Intact biological replicate 3,Zebrafish Control 3,SAMD00799620,,sample name:Zebrafish Control 3|biological replicate:3|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 21|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord,,,,,,,,,DNBSEQ G400 paired end sequencing of SAMD00799620,DRX648349,RNA seq of spinal cord in zebrafish at 0wpi control 3,1,Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,DNBSEQ,DNBSEQ-G400,,DRP012880,DNBSEQ G400 paired end sequencing of SAMD00799620,,,,13377538600.0,66887693.0,DRR668247,0:100 1:100,A:3725064764;C:2973653932;G:2980883214;T:3695767890;N:2168800,100,100,,,3725064764,2973653932,2980883214,3695767890,2168800,DRX648349,DRS458862,DRA020617,Osaka University,Osaka University,,,,,,,,,,,,B,B,biological fallback assumption,bgi,bgi,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2025-05-12,Adult,Adult,Spinal Cord,Nervous System
48,DRR668246,DRX648348,DRS458861,DRP012880,PRJDB18466,Comparison of spinal cord regeneration capacity in zebrafish and medaka,PRJDB18466,Other,Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.,,pubmed:40278963,Zebrafish Intact biological replicate 2,Zebrafish Control 2,SAMD00799619,,sample name:Zebrafish Control 2|biological replicate:2|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2023 04 21|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord,,,,,,,,,DNBSEQ G400 paired end sequencing of SAMD00799619,DRX648348,RNA seq of spinal cord in zebrafish at 0wpi control 2,1,Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,DNBSEQ,DNBSEQ-G400,,DRP012880,DNBSEQ G400 paired end sequencing of SAMD00799619,,,,14971411400.0,74857057.0,DRR668246,0:100 1:100,A:4160326445;C:3329083037;G:3329123314;T:4150453700;N:2424904,100,100,,,4160326445,3329083037,3329123314,4150453700,2424904,DRX648348,DRS458861,DRA020617,Osaka University,Osaka University,,,,,,,,,,,,B,B,biological fallback assumption,bgi,bgi,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2025-05-12,Adult,Adult,Spinal Cord,Nervous System
49,DRR668245,DRX648347,DRS458860,DRP012880,PRJDB18466,Comparison of spinal cord regeneration capacity in zebrafish and medaka,PRJDB18466,Other,Unlike mammals zebrafish have the remarkable ability to regenerate many tissues including the spinal cord. Medaka another model fish species has a low regenerative ability in the spinal cord. Therefore comparisons with them advantageous to revealing regeneration specific mechanisms in the spinal cord. The comparison of the spinal cord regeneration abilities of zebrafish and medaka could be a promising research field to elucidate new factors that determine spinal cord regeneration ability.,,pubmed:40278963,Zebrafish Intact biological replicate 1,Zebrafish Control 1,SAMD00799618,,sample name:Zebrafish Control 1|biological replicate:1|biomaterial provider:Center of Medical Innovation and Translational Research Osaka University|collection date:2024 05 04|dev stage:Adult|geo loc name:Japan|sex:not determined|strain:AB Zebrafish|tissue:Spinal cord,,,,,,,,,DNBSEQ G400 paired end sequencing of SAMD00799618,DRX648347,RNA seq of spinal cord in zebrafish at 0wpi control 1,1,Total RNA was extracted using RNeasy Micro Kit Qiagen 74104 with DNase treatment RNase Free DNase Set Qiagen 79254. Libraries were constructed from the amplified total RNA.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,DNBSEQ,DNBSEQ-G400,,DRP012880,DNBSEQ G400 paired end sequencing of SAMD00799618,,,,13912523800.0,69562619.0,DRR668245,0:100 1:100,A:3888902049;C:3079617959;G:3075111814;T:3866655202;N:2236776,100,100,,,3888902049,3079617959,3075111814,3866655202,2236776,DRX648347,DRS458860,DRA020617,Osaka University,Osaka University,,,,,,,,,,,,B,B,biological fallback assumption,bgi,bgi,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2025-05-12,Adult,Adult,Spinal Cord,Nervous System
131,DRR189373,DRX179838,DRS200446,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Dissociated cells from telencephalon of wild type adult zebrafish 3,SAMD00182216,,sample name:Cell Tel 3|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182216,DRX179838,Cell Tel 3,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182216,,,,4142772200.0,20713861.0,DRR189373,0:100 1:100,A:1185533233;C:877739936;G:877025820;T:1202041821;N:431390,100,100,,,1185533233,877739936,877025820,1202041821,431390,DRX179838,DRS200446,DRA008855,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.9018,0.90073,0.24953,0.25062,0.67884,0.67957,0.49957,0.5402,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
132,DRR189372,DRX179837,DRS200445,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Dissociated cells from telencephalon of wild type adult zebrafish 2,SAMD00182215,,sample name:Cell Tel 2|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182215,DRX179837,Cell Tel 2,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182215,,,,5233184600.0,26165923.0,DRR189372,0:100 1:100,A:1522745973;C:1082449570;G:1076728796;T:1550682585;N:577676,100,100,,,1522745973,1082449570,1076728796,1550682585,577676,DRX179837,DRS200445,DRA008855,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.89481,0.89419,0.27137,0.27018,0.67639,0.67671,0.54949,0.55323,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
133,DRR189371,DRX179836,DRS200444,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Dissociated cells from telencephalon of wild type adult zebrafish 1,SAMD00182214,,sample name:Cell Tel 1|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182214,DRX179836,Cell Tel 1,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182214,,,,4407578800.0,22037894.0,DRR189371,0:100 1:100,A:1270948410;C:923917605;G:922122984;T:1290126238;N:463563,100,100,,,1270948410,923917605,922122984,1290126238,463563,DRX179836,DRS200444,DRA008855,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.90057,0.90117,0.24092,0.24074,0.67598,0.67775,0.53184,0.53433,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
134,DRR189370,DRX179835,DRS200415,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 5,SAMD00182213,,sample name:h62A GFP Tel 5|genotype:hspGFF62A;UAS:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182213,DRX179835,h62A GFP Tel 5,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182213,,,,2904332400.0,14521662.0,DRR189370,0:100 1:100,A:821602205;C:620206517;G:623738781;T:838474359;N:310538,100,100,,,821602205,620206517,623738781,838474359,310538,DRX179835,DRS200415,DRA008854,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.91925,0.91942,0.14636,0.14584,0.71127,0.71429,0.62818,0.40804,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
135,DRR189369,DRX179834,DRS200414,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 4,SAMD00182212,,sample name:h62A GFP Tel 4|genotype:hspGFF62A;UAS:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182212,DRX179834,h62A GFP Tel 4,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182212,,,,4670374000.0,23351870.0,DRR189369,0:100 1:100,A:1294304230;C:1030286884;G:1032728119;T:1312561064;N:493703,100,100,,,1294304230,1030286884,1032728119,1312561064,493703,DRX179834,DRS200414,DRA008854,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.92587,0.92725,0.12279,0.12312,0.71056,0.71293,0.57854,0.57882,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
136,DRR189368,DRX179833,DRS200413,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 3,SAMD00182211,,sample name:h62A GFP Tel 3|genotype:hspGFF62A;UAS:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182211,DRX179833,h62A GFP Tel 3,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182211,,,,11487645000.0,57438225.0,DRR189368,0:100 1:100,A:3127119396;C:2611288030;G:2547219656;T:3194997425;N:7020493,100,100,,,3127119396,2611288030,2547219656,3194997425,7020493,DRX179833,DRS200413,DRA008854,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.91389,0.91371,0.11188,0.11336,0.74576,0.74639,0.56209,0.56027,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
137,DRR189367,DRX179832,DRS200412,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 2,SAMD00182210,,sample name:h62A GFP Tel 2|genotype:hspGFF62A;UAS:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182210,DRX179832,h62A GFP Tel 2,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182210,,,,13536257200.0,67681286.0,DRR189367,0:100 1:100,A:3723068804;C:3049411151;G:2951685691;T:3803778575;N:8312979,100,100,,,3723068804,3049411151,2951685691,3803778575,8312979,DRX179832,DRS200412,DRA008854,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.9136,0.91493,0.14102,0.14249,0.70534,0.70569,0.58385,0.58171,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
138,DRR189366,DRX179831,DRS200411,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form telencephalon of h62A;UAS:GFP adult zebrafish 1,SAMD00182209,,sample name:h62A GFP Tel 1|genotype:hspGFF62A;UAS:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182209,DRX179831,h62A GFP Tel 1,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182209,,,,13057029600.0,65285148.0,DRR189366,0:100 1:100,A:3609997372;C:2912841795;G:2821782510;T:3704302917;N:8105006,100,100,,,3609997372,2912841795,2821782510,3704302917,8105006,DRX179831,DRS200411,DRA008854,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.90766,0.90786,0.13813,0.14007,0.73677,0.73777,0.55675,0.55743,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
139,DRR189365,DRX179830,DRS200432,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form telencephalon of SAGFF120A;UAS:GFP adult zebrafish 4,SAMD00182208,,sample name:120A GFP Tel 4|genotype:SAGFF120A;UAS:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00182208,DRX179830,120A GFP Tel 4,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2000 paired end sequencing of SAMD00182208,,,,4105132200.0,20525661.0,DRR189365,0:100 1:100,A:1171500567;C:874901685;G:872257219;T:1186025546;N:447183,100,100,,,1171500567,874901685,872257219,1186025546,447183,DRX179830,DRS200432,DRA008853,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.91106,0.90924,0.18729,0.18688,0.69406,0.69589,0.51697,0.51253,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
140,DRR189364,DRX179829,DRS200431,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form telencephalon of SAGFF120A;UAS:GFP adult zebrafish 3,SAMD00182207,,sample name:120A GFP Tel 3|genotype:SAGFF120A;UAS:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182207,DRX179829,120A GFP Tel 3,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182207,,,,5062007400.0,25310037.0,DRR189364,0:100 1:100,A:1425414609;C:1105334563;G:1072448536;T:1458726402;N:83290,100,100,,,1425414609,1105334563,1072448536,1458726402,83290,DRX179829,DRS200431,DRA008853,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.89598,0.89539,0.2645,0.2668,0.69591,0.6971,0.49901,0.49932,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
141,DRR189363,DRX179828,DRS200430,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form telencephalon of SAGFF120A;UAS:GFP adult zebrafish 2,SAMD00182206,,sample name:120A GFP Tel 2|genotype:SAGFF120A;UAS:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182206,DRX179828,120A GFP Tel 2,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182206,,,,4148886200.0,20744431.0,DRR189363,0:100 1:100,A:1121946535;C:959659540;G:901840216;T:1165367793;N:72116,100,100,,,1121946535,959659540,901840216,1165367793,72116,DRX179828,DRS200430,DRA008853,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.89808,0.89803,0.14106,0.14229,0.74057,0.74073,0.58127,0.58258,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
142,DRR189362,DRX179827,DRS200429,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form telencephalon of SAGFF120A;UAS:GFP adult zebrafish 1,SAMD00182205,,sample name:120A GFP Tel 1|genotype:SAGFF120A;UAS:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182205,DRX179827,120A GFP Tel 1,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182205,,,,5621230800.0,28106154.0,DRR189362,0:100 1:100,A:1511319423;C:1299516107;G:1236814355;T:1573482053;N:98862,100,100,,,1511319423,1299516107,1236814355,1573482053,98862,DRX179827,DRS200429,DRA008853,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.90171,0.90205,0.11967,0.12059,0.74083,0.74113,0.61779,0.61682,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
143,DRR189361,DRX179826,DRS200425,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form whole brain of HuC:GFP adult zebrafish 4,SAMD00182204,,sample name:HuC GFP WB 4|genotype:HuC:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182204,DRX179826,HuC GFP WB 4,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182204,,,,3641515200.0,18207576.0,DRR189361,0:100 1:100,A:1038686472;C:777269450;G:777179582;T:1047994354;N:385342,100,100,,,1038686472,777269450,777179582,1047994354,385342,DRX179826,DRS200425,DRA008852,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.91246,0.9127,0.18566,0.18547,0.70201,0.7024,0.47049,0.47102,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
144,DRR189360,DRX179825,DRS200424,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form whole brain of HuC:GFP adult zebrafish 3,SAMD00182203,,sample name:HuC GFP WB 3|genotype:HuC:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182203,DRX179825,HuC GFP WB 3,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182203,,,,4692211000.0,23461055.0,DRR189360,0:100 1:100,A:1310884816;C:1036187295;G:997846600;T:1347212024;N:80265,100,100,,,1310884816,1036187295,997846600,1347212024,80265,DRX179825,DRS200424,DRA008852,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.89626,0.89739,0.18174,0.18338,0.72443,0.72588,0.4577,0.46684,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
145,DRR189359,DRX179824,DRS200423,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form whole brain of HuC:GFP adult zebrafish 2,SAMD00182202,,sample name:HuC GFP WB 2|genotype:HuC:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182202,DRX179824,HuC GFP WB 2,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182202,,,,7514071000.0,37570355.0,DRR189359,0:100 1:100,A:2098251885;C:1661407212;G:1597423444;T:2156861774;N:126685,100,100,,,2098251885,1661407212,1597423444,2156861774,126685,DRX179824,DRS200423,DRA008852,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.89548,0.89691,0.26231,0.26473,0.70358,0.70471,0.4732,0.4753,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
146,DRR189358,DRX179823,DRS200422,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,GFP cells form whole brain of HuC:GFP adult zebrafish 1,SAMD00182201,,sample name:HuC GFP WB 1|genotype:HuC:GFP|tissue:brain,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00182201,DRX179823,HuC GFP WB 1,1,The cDNA was amplified using SMARTer v4. Sequence libraries were produced from cDNA using Nextera XT DNA library kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00182201,,,,5175824800.0,25879124.0,DRR189358,0:100 1:100,A:1424688686;C:1174545239;G:1128653980;T:1447848363;N:88532,100,100,,,1424688686,1174545239,1128653980,1447848363,88532,DRX179823,DRS200422,DRA008852,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.91906,0.91958,0.20879,0.21088,0.74787,0.74876,0.45243,0.45221,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
147,DRR051067,DRX045959,DRS057267,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,These cells are from the same fish as h62A GFP plus Tel,GFP cells from telencephalon of hspGFF62A;UAS:GFP transgenic zebrafish,SAMD00044994,,sample name:h62A GFP minus Tel|tissue type:brain|genotype:hspGFF62A;UAS:GFP,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00044994,DRX045959,h62A GFP minus Tel,1,cDNA synthesis : clontech SMARTer v3 > Library prep : Illumina Nextera XT DNA Library Preparation Kits,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00044994,,,,17913873600.0,89569368.0,DRR051067,0:100 1:100,A:5009629866;C:3957379257;G:3797879751;T:5144366288;N:4618438,100,100,,,5009629866,3957379257,3797879751,5144366288,4618438,DRX045959,DRS057267,DRA004277,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.89075,0.89087,0.23044,0.23295,0.69493,0.69769,0.5366,0.54852,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2018-01-06,Undetermined,Undetermined,Brain,Nervous System
148,DRR051066,DRX045958,DRS057275,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,Collected from 40 adult fish by using FACS,GFP+ cells from telencephalon of hspGFF62A;UAS:GFP transgenic zebrafish,SAMD00044995,,sample name:h62A GFP plus Tel|tissue type:brain|genotype:hspGFF62A;UAS:GFP,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00044995,DRX045958,h62A GFP plus Tel,1,cDNA synthesis : clontech SMARTer v3 > Library prep : Illumina Nextera XT DNA Library Preparation Kits,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00044995,,,,17421256000.0,87106280.0,DRR051066,0:100 1:100,A:4859368314;C:3846634012;G:3717526030;T:4993260256;N:4467388,100,100,,,4859368314,3846634012,3717526030,4993260256,4467388,DRX045958,DRS057275,DRA004276,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.88127,0.88114,0.22941,0.23155,0.72161,0.72437,0.49284,0.49449,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,nextera,bulk,unknown,unknown,,Japan,2018-01-06,Adult,Adult,Brain,Nervous System
149,DRR051065,DRX045957,DRS057272,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,Telencephalon from adult zebrafrish 30 min post light and electrical shock association in non trace Two Way Active Avoidance conditioning,CS+US telencephalon 30 min post TWAA,SAMD00044990,,sample name:CS+US Tel 30|tissue type:brain|genotype:WT,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00044990,DRX045957,CS+US Tel 30,1,Illumina Truseq RNA Library Prep Kit v2,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00044990,,,,20239329200.0,101196646.0,DRR051065,0:100 1:100,A:5347169722;C:4777492672;G:4750401220;T:5361888239;N:2377347,100,100,,,5347169722,4777492672,4750401220,5361888239,2377347,DRX045957,DRS057272,DRA004275,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.93576,0.93353,0.13979,0.14019,0.70043,0.70203,0.48989,0.49214,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-01-06,Adult,Adult,Brain,Nervous System
150,DRR051064,DRX045956,DRS057265,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,Telencephalon from adult zebrafrish 30 min post light stimulation in Two Way Active Avoidance coditioning,CS telencephalon 30 min post TWAA,SAMD00044991,,sample name:CS Tel 30|tissue type:brain|genotype:WT,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00044991,DRX045956,CS Tel 30,1,Illumina Truseq RNA Library Prep Kit v2,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2000Application ReadForward11Application ReadReverse101,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00044991,,,,29268319600.0,146341598.0,DRR051064,0:100 1:100,A:7777792429;C:6878969107;G:6819275179;T:7788795270;N:3487615,100,100,,,7777792429,6878969107,6819275179,7788795270,3487615,DRX045956,DRS057265,DRA004274,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.93646,0.93664,0.14051,0.14191,0.70199,0.70374,0.49256,0.49684,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-01-06,Adult,Adult,Brain,Nervous System
151,DRR051063,DRX045955,DRS057266,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,These cells are from the same fish as 120A GFP plus Tel,GFP cells from telencephalon of SAGFFLF120A;UAS:GFP transgenic zebrafish,SAMD00044987,,sample name:120A GFP minus Tel|tissue type:brain|genotype:SAGFFLF120A;UAS:GFP,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00044987,DRX045955,120A GFP minus Tel,1,cDNA synthesis : clontech SMARTer v2 > Library prep : Illumina TrunSeq DNA Sample Preparation Kits,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2020Application ReadForward11Application ReadReverse102,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00044987,,,,15411400120.0,76294060.0,DRR051063,0:101 1:101,A:4583085286;C:3082552426;G:3134669086;T:4606055524;N:5037798,101,101,,,4583085286,3082552426,3134669086,4606055524,5037798,DRX045955,DRS057266,DRA004273,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.89184,0.8842,0.30246,0.30334,0.69232,0.705,0.52824,0.51492,101,101,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Japan,2018-01-06,Undetermined,Undetermined,Brain,Nervous System
152,DRR051062,DRX045954,DRS057271,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,Collected from 40 adult fish by using FACS,GFP+ cells from telencephalon of SAGFFLF120A;UAS:GFP transgenic zebrafish,SAMD00044988,,sample name:120A GFP plus Tel|tissue type:brain|genotype:SAGFFLF120A;UAS:GFP,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00044988,DRX045954,120A GFP plus Tel,1,cDNA synthesis : clontech SMARTer v2 > Library prep : Illumina TrunSeq DNA Sample Preparation Kits,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2020Application ReadForward11Application ReadReverse102,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00044988,,,,9916242014.0,49090307.0,DRR051062,0:101 1:101,A:2991626000;C:1935418605;G:1974202781;T:3011783158;N:3211470,101,101,,,2991626000,1935418605,1974202781,3011783158,3211470,DRX045954,DRS057271,DRA004272,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.87779,0.86382,0.2948,0.28993,0.72809,0.74075,0.50317,0.49169,101,101,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Japan,2018-01-06,Adult,Adult,Brain,Nervous System
153,DRR051061,DRX045953,DRS057274,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,Collected from 10 adult fish by using FACS,GFP+ cells from whole brain of SAGFFLF231A;UAS:GFP transgenic zebrafish,SAMD00044989,,sample name:231A GFP plus WB|tissue type:brain|genotype:SAGFFLF231A;UAS:GFP,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00044989,DRX045953,231A GFP plus WB,1,cDNA synthesis : clontech SMARTer v2 > Library prep : Illumina TrunSeq DNA Sample Preparation Kits,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2020Application ReadForward11Application ReadReverse102,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00044989,,,,27230654000.0,136153270.0,DRR051061,0:101 1:99,A:7929214734;C:5506861409;G:5563593280;T:8059057191;N:171927386,101,99,,,7929214734,5506861409,5563593280,8059057191,171927386,DRX045953,DRS057274,DRA004271,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.88462,0.88282,0.26215,0.26067,0.72468,0.73555,0.48369,0.48285,101,99,B,B,biological fallback assumption,illumina,hiseq_era,full_length,cdna_unspecified,smarter,bulk,unknown,unknown,,Japan,2018-01-06,Adult,Adult,Brain,Nervous System
154,DRR051060,DRX045952,DRS057269,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,Telencephalon of adult zebrafrish barin,zebrafihsh telencephalon,SAMD00044992,,sample name:Tel|tissue type:brain|genotype:WT,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00044992,DRX045952,Tel,1,Illumina Truseq RNA Library Prep Kit v2,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2020Application ReadForward11Application ReadReverse102,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00044992,,,,20006128076.0,99040238.0,DRR051060,0:101 1:101,A:5393556813;C:4623783008;G:4592812230;T:5384415659;N:11560366,101,101,,,5393556813,4623783008,4592812230,5384415659,11560366,DRX045952,DRS057269,DRA004270,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.94215,0.94001,0.16398,0.16585,0.69331,0.69479,0.4872,0.48516,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-01-06,Adult,Adult,Brain,Nervous System
155,DRR051059,DRX045951,DRS057270,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,Whole brain of adult zebrafish,zebrafish whole brain,SAMD00044993,,sample name:WB|tissue type:brain|genotype:WT,,,,,,,,,Illumina HiSeq 2500 paired end sequencing of SAMD00044993,DRX045951,WB,1,Illumina Truseq RNA Library Prep Kit v2,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,2020Application ReadForward11Application ReadReverse102,DRP003977,Illumina HiSeq 2500 paired end sequencing of SAMD00044993,,,,25283347776.0,125165088.0,DRR051059,0:101 1:101,A:6845696813;C:5810492697;G:5775241119;T:6837142940;N:14774207,101,101,,,6845696813,5810492697,5775241119,6837142940,14774207,DRX045951,DRS057270,DRA004269,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),2,0.94203,0.94067,0.15107,0.15158,0.68651,0.6882,0.49596,0.49589,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-01-06,Adult,Adult,Brain,Nervous System
156,DRR067143,DRX061087,DRS034141,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for Bergmann glial cells using Tg line SAGFFLF251A sample 2,SAMD00057666,,sample name:Zebrafish 251A 02|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:cerebellum|cell type:bergmann glial cells|dev stage:14 dpf|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057666,DRX061087,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057666,,,,2040373922.0,10100861.0,DRR067143,0:101 1:101,A:577691972;C:445051245;G:472607289;T:544962357;N:61059,101,101,,,577691972,445051245,472607289,544962357,61059,DRX061087,DRS034141,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.83407,0.83802,0.12612,0.12666,0.73675,0.74079,0.4948,0.49282,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
157,DRR067142,DRX061086,DRS034140,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for Bergmann glial cells using Tg line SAGFFLF251A sample 1,SAMD00057665,,sample name:Zebrafish 251A 01|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:cerebellum|cell type:bergmann glial cells|dev stage:14 dpf|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057665,DRX061086,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057665,,,,2033951534.0,10069067.0,DRR067142,0:101 1:101,A:589558269;C:431084184;G:460501802;T:552746498;N:60781,101,101,,,589558269,431084184,460501802,552746498,60781,DRX061086,DRS034140,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.8958,0.90339,0.13764,0.1385,0.72563,0.72865,0.49373,0.49916,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
158,DRR067141,DRX061085,DRS034139,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for Purkinje cells using Tg line aldoca:GAP Venus sample 3,SAMD00057664,,sample name:Zebrafish aldoca 03|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:cerebellum|cell type:purkinje cells|dev stage:14 dpf|replicate:biological replicate 3,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057664,DRX061085,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057664,,,,1931908608.0,9563904.0,DRR067141,0:101 1:101,A:558444394;C:409856521;G:429168864;T:534380258;N:58571,101,101,,,558444394,409856521,429168864,534380258,58571,DRX061085,DRS034139,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.88632,0.89109,0.15695,0.15773,0.75694,0.7599,0.46875,0.49236,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
159,DRR067140,DRX061084,DRS034138,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for Purkinje cells using Tg line aldoca:GAP Venus sample 2,SAMD00057663,,sample name:Zebrafish aldoca 02|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:cerebellum|cell type:purkinje cells|dev stage:14 dpf|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057663,DRX061084,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057663,,,,1851108406.0,9163903.0,DRR067140,0:101 1:101,A:537339104;C:390802782;G:416335529;T:506575762;N:55229,101,101,,,537339104,390802782,416335529,506575762,55229,DRX061084,DRS034138,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.9055,0.91341,0.1515,0.15333,0.76495,0.76719,0.49219,0.49012,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
160,DRR067139,DRX061083,DRS034137,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for Purkinje cells using Tg line aldoca:GAP Venus sample 1,SAMD00057662,,sample name:Zebrafish aldoca 01|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:cerebellum|cell type:purkinje cells|dev stage:14 dpf|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057662,DRX061083,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057662,,,,2000078962.0,9901381.0,DRR067139,0:101 1:101,A:583169141;C:420603631;G:446949308;T:549297272;N:59610,101,101,,,583169141,420603631,446949308,549297272,59610,DRX061083,DRS034137,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.9056,0.90932,0.15092,0.15179,0.76173,0.7654,0.49028,0.49604,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
161,DRR067138,DRX061082,DRS034136,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for granule cells using Tg line gSA2AzGFF152B sample 2,SAMD00057661,,sample name:Zebrafish 152B 02|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:cerebellum|cell type:granule cells|dev stage:14 dpf|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057661,DRX061082,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057661,,,,1997432156.0,9888278.0,DRR067138,0:101 1:101,A:578466824;C:423038930;G:449779231;T:546086391;N:60780,101,101,,,578466824,423038930,449779231,546086391,60780,DRX061082,DRS034136,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.90322,0.91109,0.1463,0.14811,0.75452,0.75633,0.48303,0.48557,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
162,DRR067137,DRX061081,DRS034135,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for granule cells using Tg line gSA2AzGFF152B sample 1,SAMD00057660,,sample name:Zebrafish 152B 01|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:cerebellum|cell type:granule cells|dev stage:14 dpf|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057660,DRX061081,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057660,,,,1908437218.0,9447709.0,DRR067137,0:101 1:101,A:552150223;C:401993096;G:427236477;T:527000978;N:56444,101,101,,,552150223,401993096,427236477,527000978,56444,DRX061081,DRS034135,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.90474,0.91043,0.17336,0.17401,0.76108,0.76359,0.483,0.48537,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
163,DRR067136,DRX061080,DRS034134,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for Inferior olive nuclei using Tg line hspGFFDMC28C sample 3,SAMD00057659,,sample name:Zebrafish 28C 03|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:hindbrain|cell type:inferior olive nuclei|dev stage:14 dpf|replicate:biological replicate 3,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057659,DRX061080,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057659,,,,1982971178.0,9816689.0,DRR067136,0:101 1:101,A:504064758;C:488246993;G:520130333;T:470469799;N:59295,101,101,,,504064758,488246993,520130333,470469799,59295,DRX061080,DRS034134,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.53386,0.54375,0.06072,0.06189,0.76351,0.76641,0.4872,0.48857,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
164,DRR067135,DRX061079,DRS034133,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for Inferior olive nuclei using Tg line hspGFFDMC28C sample 2,SAMD00057658,,sample name:Zebrafish 28C 02|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:hindbrain|cell type:inferior olive nuclei|dev stage:14 dpf|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057658,DRX061079,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057658,,,,1961048320.0,9708160.0,DRR067135,0:101 1:101,A:557469151;C:424691789;G:455244994;T:523583601;N:58785,101,101,,,557469151,424691789,455244994,523583601,58785,DRX061079,DRS034133,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.84854,0.8526,0.10311,0.1042,0.75227,0.75499,0.49321,0.49435,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
165,DRR067134,DRX061078,DRS034132,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for Inferior olive nuclei using Tg line hspGFFDMC28C sample 1,SAMD00057657,,sample name:Zebrafish 28C 01|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:hindbrain|cell type:inferior olive nuclei|dev stage:14 dpf|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057657,DRX061078,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057657,,,,1931802760.0,9563380.0,DRR067134,0:101 1:101,A:546501397;C:422500710;G:452200521;T:510543489;N:56643,101,101,,,546501397,422500710,452200521,510543489,56643,DRX061078,DRS034132,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.85439,0.85613,0.09867,0.09897,0.76871,0.77082,0.48943,0.48936,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
166,DRR067133,DRX061077,DRS034131,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for eurydendroid cells using Tg line hspzGFFgDMC156A sample 2,SAMD00057656,,sample name:Zebrafish 156A 02|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:cerebellum|cell type:eurydendroid cells|dev stage:14 dpf|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057656,DRX061077,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057656,,,,2054289096.0,10169748.0,DRR067133,0:101 1:101,A:563764176;C:464768863;G:497506420;T:528187503;N:62134,101,101,,,563764176,464768863,497506420,528187503,62134,DRX061077,DRS034131,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.69311,0.6968,0.12309,0.12389,0.76428,0.76676,0.48379,0.48227,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
167,DRR067132,DRX061076,DRS034130,DRP003275,PRJDB4941,Gene expression profiling of granule cells and Purkinje cells in zebrafish cerebellum,DRP003275,Other,An RNA seq analysis was performed using zebrafish granule cells Purkinje cells IO neurons and glial cells. The transcriptomes were sequenced using Illumina HiSeq with paired end libraries employing the Quartz seq method for low amount total RNA.,,,,Zebrafish RNA seq for eurydendroid cells using Tg line hspzGFFgDMC156A sample 1,SAMD00057655,,sample name:Zebrafish 156A 01|strain:Tg|biomaterial provider:Bioscience and Biotechnology Center Nagoya University|tissue type:cerebellum|cell type:eurydendroid cells|dev stage:14 dpf|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 1500 paired end sequencing of SAMD00057655,DRX061076,1,1,Quartz seq for low amount total RNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 1500,2020Application ReadForward11Application ReadReverse102,DRP003275,Illumina HiSeq 1500 paired end sequencing of SAMD00057655,,,,2152665722.0,10656761.0,DRR067132,0:101 1:101,A:585252781;C:495382257;G:522677749;T:549287359;N:65576,101,101,,,585252781,495382257,522677749,549287359,65576,DRX061076,DRS034130,DRA004955,RIKEN_CLST_DBFDI|Phyloinformatics Unit,RIKEN CLST,2,0.67771,0.68253,0.12949,0.1303,0.77216,0.77542,0.4951,0.49452,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,quartzseq,,Japan,2016-09-19,Larval,Larval,Brain,Nervous System
260,DRR162481,DRX153100,DRS083161,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 39 mpf zebrafish replicate5,SAMD00152429,,sample name:b39 5|age:39 month|biological replicate:5|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152429,DRX153100,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152429,,,,1252728200.0,6263641.0,DRR162481,0:100 1:100,A:367502128;C:257734618;G:257260262;T:368202459;N:2028733,100,100,,,367502128,257734618,257260262,368202459,2028733,DRX153100,DRS083161,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.92142,0.8899,0.17636,0.1685,0.70686,0.7166,0.53271,0.54366,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
261,DRR162480,DRX153099,DRS083160,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 39 mpf zebrafish replicate4,SAMD00152428,,sample name:b39 4|age:39 month|biological replicate:4|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152428,DRX153099,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152428,,,,1426772800.0,7133864.0,DRR162480,0:100 1:100,A:408404333;C:303657580;G:303201065;T:408996815;N:2513007,100,100,,,408404333,303657580,303201065,408996815,2513007,DRX153099,DRS083160,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.92435,0.89379,0.16127,0.15446,0.69844,0.70554,0.53646,0.533,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
262,DRR162479,DRX153098,DRS083159,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 39 mpf zebrafish replicate3,SAMD00152427,,sample name:b39 3|age:39 month|biological replicate:3|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152427,DRX153098,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152427,,,,1197809800.0,5989049.0,DRR162479,0:100 1:100,A:348955835;C:249141949;G:248747996;T:348970452;N:1993568,100,100,,,348955835,249141949,248747996,348970452,1993568,DRX153098,DRS083159,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.92402,0.89389,0.1731,0.1668,0.70938,0.72892,0.55061,0.56711,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
263,DRR162478,DRX153097,DRS083158,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 39 mpf zebrafish replicate2,SAMD00152426,,sample name:b39 2|age:39 month|biological replicate:2|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152426,DRX153097,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152426,,,,1389632200.0,6948161.0,DRR162478,0:100 1:100,A:397337261;C:295934915;G:295794427;T:398240347;N:2325250,100,100,,,397337261,295934915,295794427,398240347,2325250,DRX153097,DRS083158,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.92803,0.89621,0.15624,0.14998,0.69988,0.70985,0.54263,0.53655,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
264,DRR162477,DRX153096,DRS083157,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 39 mpf zebrafish replicate1,SAMD00152425,,sample name:b39 1|age:39 month|biological replicate:1|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152425,DRX153096,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152425,,,,1413538400.0,7067692.0,DRR162477,0:100 1:100,A:427890787;C:277522619;G:278488081;T:427755965;N:1880948,100,100,,,427890787,277522619,278488081,427755965,1880948,DRX153096,DRS083157,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.90967,0.88004,0.20536,0.19647,0.71384,0.72021,0.55413,0.55769,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
265,DRR162476,DRX153095,DRS083156,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 16 mpf zebrafish replicate5,SAMD00152424,,sample name:b16 5|age:16 month|biological replicate:5|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152424,DRX153095,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152424,,,,1256635000.0,6283175.0,DRR162476,0:100 1:100,A:385448452;C:241878013;G:242164401;T:385408510;N:1735624,100,100,,,385448452,241878013,242164401,385408510,1735624,DRX153095,DRS083156,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.91032,0.87693,0.19953,0.19064,0.72575,0.73474,0.49199,0.5657,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
266,DRR162475,DRX153094,DRS083155,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 16 mpf zebrafish replicate4,SAMD00152423,,sample name:b16 4|age:16 month|biological replicate:4|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152423,DRX153094,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152423,,,,2577820600.0,12889103.0,DRR162475,0:100 1:100,A:783031561;C:503484597;G:503899732;T:784003178;N:3401532,100,100,,,783031561,503484597,503899732,784003178,3401532,DRX153094,DRS083155,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.91098,0.87948,0.20945,0.19993,0.71758,0.72543,0.56796,0.56453,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
267,DRR162474,DRX153093,DRS083154,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 16 mpf zebrafish replicate3,SAMD00152422,,sample name:b16 3|age:16 month|biological replicate:3|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152422,DRX153093,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152422,,,,1147257600.0,5736288.0,DRR162474,0:100 1:100,A:357829214;C:214920802;G:215124134;T:357870811;N:1512639,100,100,,,357829214,214920802,215124134,357870811,1512639,DRX153093,DRS083154,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.90822,0.88184,0.20468,0.19612,0.73992,0.74627,0.58395,0.50711,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
268,DRR162473,DRX153092,DRS083153,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 16 mpf zebrafish replicate2,SAMD00152421,,sample name:b16 2|age:16 month|biological replicate:2|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152421,DRX153092,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152421,,,,1399740200.0,6998701.0,DRR162473,0:100 1:100,A:420492615;C:278464854;G:278362101;T:420657546;N:1763084,100,100,,,420492615,278464854,278362101,420657546,1763084,DRX153092,DRS083153,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.91795,0.88458,0.19015,0.18122,0.71374,0.72318,0.55157,0.55554,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
269,DRR162472,DRX153091,DRS083152,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 16 mpf zebrafish replicate1,SAMD00152420,,sample name:b16 1|age:16 month|biological replicate:1|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152420,DRX153091,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152420,,,,1109512400.0,5547562.0,DRR162472,0:100 1:100,A:336800225;C:217086705;G:217195789;T:336929233;N:1500448,100,100,,,336800225,217086705,217195789,336929233,1500448,DRX153091,DRS083152,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.91025,0.87734,0.20046,0.19197,0.71774,0.72482,0.52937,0.56111,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
270,DRR162471,DRX153090,DRS083151,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 7 mpf zebrafish replicate5,SAMD00152419,,sample name:b07 5|age:7 month|biological replicate:5|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152419,DRX153090,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152419,,,,1472475400.0,7362377.0,DRR162471,0:100 1:100,A:448100356;C:287211180;G:287652290;T:447581010;N:1930564,100,100,,,448100356,287211180,287652290,447581010,1930564,DRX153090,DRS083151,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.90584,0.87079,0.21738,0.2083,0.71415,0.7344,0.5518,0.55812,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
271,DRR162470,DRX153089,DRS083150,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 7 mpf zebrafish replicate4,SAMD00152418,,sample name:b07 4|age:7 month|biological replicate:4|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152418,DRX153089,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152418,,,,1173234000.0,5866170.0,DRR162470,0:100 1:100,A:349147253;C:236479543;G:237153294;T:348938811;N:1515099,100,100,,,349147253,236479543,237153294,348938811,1515099,DRX153089,DRS083150,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.91933,0.88973,0.18681,0.17878,0.71108,0.71867,0.5448,0.55274,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
272,DRR162469,DRX153088,DRS083149,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 7 mpf zebrafish replicate3,SAMD00152417,,sample name:b07 3|age:7 month|biological replicate:3|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152417,DRX153088,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152417,,,,1322055600.0,6610278.0,DRR162469,0:100 1:100,A:387777992;C:270907178;G:273067585;T:387904272;N:2398573,100,100,,,387777992,270907178,273067585,387904272,2398573,DRX153088,DRS083149,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.91753,0.88469,0.17775,0.17007,0.70656,0.71685,0.5466,0.54528,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
273,DRR162468,DRX153087,DRS083148,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 7 mpf zebrafish replicate2,SAMD00152416,,sample name:b07 2|age:7 month|biological replicate:2|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152416,DRX153087,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152416,,,,1160349000.0,5801745.0,DRR162468,0:100 1:100,A:350211581;C:228387129;G:229679563;T:349919152;N:2151575,100,100,,,350211581,228387129,229679563,349919152,2151575,DRX153087,DRS083148,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.91146,0.87717,0.20422,0.19494,0.7083,0.72082,0.55642,0.56386,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
274,DRR162467,DRX153086,DRS083147,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 7 mpf zebrafish replicate1,SAMD00152415,,sample name:b07 1|age:7 month|biological replicate:1|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152415,DRX153086,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152415,,,,1162314600.0,5811573.0,DRR162467,0:100 1:100,A:344932586;C:233867698;G:235450342;T:345967852;N:2096122,100,100,,,344932586,233867698,235450342,345967852,2096122,DRX153086,DRS083147,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.91102,0.88248,0.1897,0.18307,0.70786,0.71687,0.55008,0.54646,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Adult,Adult,Brain,Nervous System
275,DRR162466,DRX153085,DRS083146,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 2 mpf zebrafish replicate5,SAMD00152414,,sample name:b02 5|age:2 month|biological replicate:5|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152414,DRX153085,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152414,,,,1184455800.0,5922279.0,DRR162466,0:100 1:100,A:357035323;C:233685447;G:235595745;T:356085837;N:2053448,100,100,,,357035323,233685447,235595745,356085837,2053448,DRX153085,DRS083146,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.90819,0.87146,0.20659,0.19751,0.71246,0.72251,0.52523,0.52531,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Juvenile,Juvenile,Brain,Nervous System
276,DRR162465,DRX153084,DRS083145,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 2 mpf zebrafish replicate4,SAMD00152413,,sample name:b02 4|age:2 month|biological replicate:4|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152413,DRX153084,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152413,,,,1389141000.0,6945705.0,DRR162465,0:100 1:100,A:423029010;C:270113394;G:270981952;T:422602360;N:2414284,100,100,,,423029010,270113394,270981952,422602360,2414284,DRX153084,DRS083145,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.90961,0.87739,0.21147,0.20152,0.71492,0.72563,0.53639,0.53779,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Juvenile,Juvenile,Brain,Nervous System
277,DRR162464,DRX153083,DRS083144,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 2 mpf zebrafish replicate3,SAMD00152412,,sample name:b02 3|age:2 month|biological replicate:3|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152412,DRX153083,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152412,,,,2322459000.0,11612295.0,DRR162464,0:100 1:100,A:701085106;C:457451297;G:460424165;T:699185460;N:4312972,100,100,,,701085106,457451297,460424165,699185460,4312972,DRX153083,DRS083144,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.92479,0.89382,0.16108,0.1547,0.73312,0.74121,0.55089,0.55507,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Juvenile,Juvenile,Brain,Nervous System
278,DRR162463,DRX153082,DRS083143,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 2 mpf zebrafish replicate2,SAMD00152411,,sample name:b02 2|age:2 month|biological replicate:2|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152411,DRX153082,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152411,,,,1188406400.0,5942032.0,DRR162463,0:100 1:100,A:354575190;C:238508166;G:239587004;T:353623510;N:2112530,100,100,,,354575190,238508166,239587004,353623510,2112530,DRX153082,DRS083143,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.90922,0.8787,0.20709,0.2009,0.71614,0.7362,0.52768,0.53049,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Juvenile,Juvenile,Brain,Nervous System
279,DRR162462,DRX153081,DRS083142,DRP004696,PRJDB7713,Age associated transcriptome analysis in 5 tissues of zebrafish,DRP004696,Transcriptome Analysis,We performed transcriptome analysis for brain gill heart liver and muscle from 2 month 7 month 16 month and 39 mpf zebrafish. We analyzed age associated gene expression pattern in zebrafish and compared with similar public transcriptome data of rat Yu et al. 2014.,,,,brain sample from 2 mpf zebrafish replicate1,SAMD00152410,,sample name:b02 1|age:2 month|biological replicate:1|tissue:brain,,,,,,,,,Illumina HiSeq 2000 paired end sequencing of SAMD00152410,DRX153081,1,1,Illumina TruSeq Stranded mRNA HT Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,DRP004696,Illumina HiSeq 2000 paired end sequencing of SAMD00152410,,,,1033492200.0,5167461.0,DRR162462,0:100 1:100,A:310135217;C:205335529;G:207428012;T:308760225;N:1833217,100,100,,,310135217,205335529,207428012,308760225,1833217,DRX153081,DRS083142,DRA007711,UT-AQUA|Laboratory of Aquatic Molecular Biology and Biotechnology,"Department of Aquatic Bioscience, Graduate School of Agriculture and Life Sciences, The University of Tokyo",2,0.9176,0.8829,0.18651,0.17848,0.72099,0.73119,0.54307,0.54697,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Japan,2018-12-24,Juvenile,Juvenile,Brain,Nervous System
8064,ERR035545,ERX013540,ERS017861,ERP000447,PRJEB2368,Sanger zebrafish sequencing,E-MTAB-460,Other,,,,Protocols: Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.,Zebrafish adult brain,SAMEA782568,Wellcome Sanger Institute,ENA first public:2011 02 03|ENA last update:2018 03 08|External Id:SAMEA782568|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2011 02 03T12:40:41Z|INSDC last update:2018 03 08T15:25:22Z|INSDC status:public|StrainOrLine:Singapore|Submitter Id:E MTAB 460:Zebrafish adult brain|broker name:ArrayExpress|common name:zebrafish|developmental stage:adult|organism part:brain|sample name:E MTAB 460:Zebrafish adult brain|sex:mixed,,,,,,,,,Sanger zebrafish sequencing,E MTAB 460 part2:5625 1,ZFbrain 2 RNA 1523492,Sanger zebrafish sequencing,Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments. Total RNA was enriched for polyA+ RNA by 2 rounds of polyA pull down with magnetic beads and included a DNase treatment between the 2 rounds. RNA was chemically fragmented LiCl precipitated reverse transcribed with random primers a second strand synthesized and made into a standard Illumina library with a fragment size of 250 to 300 bp.,Experimental Factor: ORGANISM PART:brain,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,1600Application ReadForward11Technical ReadReverse772Application ReadReverse85,ERP000447,Illumina Genome Analyzer II paired end sequencing; Sanger zebrafish sequencing,ENA FIRST PUBLIC:2011 06 14|ENA LAST UPDATE:2018 11 16,5625_1.srf,srf,4576566720.0,28603542.0,E MTAB 460 part2:5625 1.srf,0:76 1:8 2:76,A:1227184716;C:942715631;G:951021478;T:1219839320;N:6977239,76,8,76,,1227184716,942715631,951021478,1219839320,6977239,ERX013540,ERS017861,ERA033503,SC|Wellcome Trust Sanger Institute,SC|Wellcome Trust Sanger Institute,2,0.86503,0.86182,0.22392,0.22256,0.69664,0.69865,0.51454,0.51606,76,76,B,B,biological fallback assumption,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,United Kingdom,2011-02-03,Adult,Adult,Brain,Nervous System
8069,ERR023147,ERX009449,ERS017861,ERP000447,PRJEB2368,Sanger zebrafish sequencing,E-MTAB-460,Other,,,,Protocols: Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.,Zebrafish adult brain,SAMEA782568,Wellcome Sanger Institute,ENA first public:2011 02 03|ENA last update:2018 03 08|External Id:SAMEA782568|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2011 02 03T12:40:41Z|INSDC last update:2018 03 08T15:25:22Z|INSDC status:public|StrainOrLine:Singapore|Submitter Id:E MTAB 460:Zebrafish adult brain|broker name:ArrayExpress|common name:zebrafish|developmental stage:adult|organism part:brain|sample name:E MTAB 460:Zebrafish adult brain|sex:mixed,,,,,,,,,Sanger zebrafish sequencing,E MTAB 460:3537 7,RNA from Zebrafish adult brain,Sanger zebrafish sequencing,Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.,Experimental Factor: ORGANISM PART:brain,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,1520Application ReadForward11Application ReadReverse77,ERP000447,Illumina Genome Analyzer II paired end sequencing; Sanger zebrafish sequencing,ENA FIRST PUBLIC:2011 02 03|ENA LAST UPDATE:2018 11 16,3537_7.srf,srf,3047469128.0,20049139.0,E MTAB 460:3537 7.srf,0:76 1:76,A:951431181;C:561974807;G:565451314;T:964940357;N:3671469,76,76,,,951431181,561974807,565451314,964940357,3671469,ERX009449,ERS017861,ERA015648,SC|Wellcome Trust Sanger Institute,SC|Wellcome Trust Sanger Institute,2,0.89672,0.89537,0.31092,0.31152,0.75724,0.7583,0.56639,0.56663,76,76,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2011-02-03,Adult,Adult,Brain,Nervous System
8070,ERR023144,ERX009448,ERS017861,ERP000447,PRJEB2368,Sanger zebrafish sequencing,E-MTAB-460,Other,,,,Protocols: Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.,Zebrafish adult brain,SAMEA782568,Wellcome Sanger Institute,ENA first public:2011 02 03|ENA last update:2018 03 08|External Id:SAMEA782568|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2011 02 03T12:40:41Z|INSDC last update:2018 03 08T15:25:22Z|INSDC status:public|StrainOrLine:Singapore|Submitter Id:E MTAB 460:Zebrafish adult brain|broker name:ArrayExpress|common name:zebrafish|developmental stage:adult|organism part:brain|sample name:E MTAB 460:Zebrafish adult brain|sex:mixed,,,,,,,,,Sanger zebrafish sequencing,E MTAB 460:3212 6,RNA from Zebrafish adult brain,Sanger zebrafish sequencing,Zebrafish tissue was collected from Singapore strain incross fish grown at 28C. Collected samples were snap frozen on dry ice and stored at 70 C Total RNA was extracted using Trizol Reagent Invitrogen following the manufacturer's instructions. Pellets were re suspended in 10 mM Tris pH 7.5 and the RNA was quantified using a NanoDrop ND 1000 Spectrophotometer Axon Instruments.,Experimental Factor: ORGANISM PART:brain,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,1520Application ReadForward11Application ReadReverse77,ERP000447,Illumina Genome Analyzer II paired end sequencing; Sanger zebrafish sequencing,ENA FIRST PUBLIC:2011 02 03|ENA LAST UPDATE:2018 11 16,3212_6.srf,srf,1970995248.0,12967074.0,E MTAB 460:3212 6.srf,0:76 1:76,A:601407561;C:370471604;G:371296333;T:608476094;N:19343656,76,76,,,601407561,370471604,371296333,608476094,19343656,ERX009448,ERS017861,ERA015648,SC|Wellcome Trust Sanger Institute,SC|Wellcome Trust Sanger Institute,2,0.90042,0.89919,0.30246,0.30122,0.75534,0.75349,0.57375,0.56725,76,76,B,B,biological fallback assumption,illumina,early_illumina,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2011-02-03,Adult,Adult,Brain,Nervous System
10170,ERR375749,ERX348126,ERS337052,ERP003756,PRJEB4464,Zebrafish olfactory transcriptomics,Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742,Transcriptome Analysis,The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.,,,,,SAMEA2168448,SC,ArrayExpress Genotype:Wildtype|ArrayExpress OrganismPart:Olfactory epithelium|ArrayExpress Sex:male|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 11 25T10:18:08Z|ENA LAST UPDATE:2018 03 08T16:38:06Z|External Id:SAMEA2168448|INSDC center name:SC|INSDC first public:2013 11 25T10:18:08Z|INSDC last update:2018 03 08T16:38:06Z|INSDC status:public|Submitter Id:ZF OE3 sc 2013 08 12T10:36:21Z 1677721|common name:zebrafish|sample description:RNA from OE|sample name:ZF OE3 sc 2013 08 12T10:36:21Z 1677721|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 10586 2#3,7941068,Illumina sequencing of library 7941068 constructed from sample accession ERS337052 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 2. This submission includes reads tagged with the sequence TTAGGC.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP003756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 11 25|ENA LAST UPDATE:2018 11 16,10586_2#3.cram,cram,11298599000.0,56492995.0,SC RUN 10586 2#3,0:100 1:100,A:3356877540;C:2323057831;G:2299363865;T:3303865798;N:15433966,100,100,,,3356877540,2323057831,2299363865,3303865798,15433966,ERX348126,ERS337052,ERA267455,SC,Wellcome Sanger Institute,2,0.91061,0.90958,0.1659,0.16567,0.68398,0.68645,0.53954,0.54231,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-11-25,Undetermined,Undetermined,Brain,Nervous System
10171,ERR375748,ERX348125,ERS337051,ERP003756,PRJEB4464,Zebrafish olfactory transcriptomics,Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742,Transcriptome Analysis,The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.,,,,,SAMEA2168447,SC,ArrayExpress Genotype:Wildtype|ArrayExpress OrganismPart:Olfactory epithelium|ArrayExpress Sex:male|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 11 25T10:18:08Z|ENA LAST UPDATE:2018 03 08T16:38:13Z|External Id:SAMEA2168447|INSDC center name:SC|INSDC first public:2013 11 25T10:18:08Z|INSDC last update:2018 03 08T16:38:13Z|INSDC status:public|Submitter Id:ZF OE2 sc 2013 08 12T10:36:20Z 1677720|common name:zebrafish|sample description:RNA from OE|sample name:ZF OE2 sc 2013 08 12T10:36:20Z 1677720|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 10586 2#2,7941067,Illumina sequencing of library 7941067 constructed from sample accession ERS337051 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 2. This submission includes reads tagged with the sequence CGATGT.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP003756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 11 25|ENA LAST UPDATE:2018 11 16,10586_2#2.cram,cram,10462424000.0,52312120.0,SC RUN 10586 2#2,0:100 1:100,A:3035632557;C:2208885147;G:2197231235;T:3006145790;N:14529271,100,100,,,3035632557,2208885147,2197231235,3006145790,14529271,ERX348125,ERS337051,ERA267455,SC,Wellcome Sanger Institute,2,0.91417,0.91329,0.15428,0.15477,0.66882,0.66896,0.52191,0.51898,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-11-25,Undetermined,Undetermined,Brain,Nervous System
10172,ERR375747,ERX348124,ERS337050,ERP003756,PRJEB4464,Zebrafish olfactory transcriptomics,Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742,Transcriptome Analysis,The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.,,,,,SAMEA2168446,SC,ArrayExpress Genotype:Wildtype|ArrayExpress OrganismPart:Olfactory epithelium|ArrayExpress Sex:male|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 11 25T10:18:08Z|ENA LAST UPDATE:2018 03 08T16:38:06Z|External Id:SAMEA2168446|INSDC center name:SC|INSDC first public:2013 11 25T10:18:08Z|INSDC last update:2018 03 08T16:38:06Z|INSDC status:public|Submitter Id:ZF OE1 sc 2013 08 12T10:36:17Z 1677719|common name:zebrafish|sample description:RNA from OE|sample name:ZF OE1 sc 2013 08 12T10:36:17Z 1677719|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 10586 2#1,7941066,Illumina sequencing of library 7941066 constructed from sample accession ERS337050 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 2. This submission includes reads tagged with the sequence ATCACG.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP003756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 11 25|ENA LAST UPDATE:2018 11 16,10586_2#1.cram,cram,10377603200.0,51888016.0,SC RUN 10586 2#1,0:100 1:100,A:3021582125;C:2187474575;G:2170525378;T:2983668309;N:14352813,100,100,,,3021582125,2187474575,2170525378,2983668309,14352813,ERX348124,ERS337050,ERA267455,SC,Wellcome Sanger Institute,2,0.90978,0.90815,0.15565,0.15454,0.67322,0.67476,0.52923,0.51842,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-11-25,Undetermined,Undetermined,Brain,Nervous System
10173,ERR375746,ERX348123,ERS337052,ERP003756,PRJEB4464,Zebrafish olfactory transcriptomics,Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742,Transcriptome Analysis,The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.,,,,,SAMEA2168448,SC,ArrayExpress Genotype:Wildtype|ArrayExpress OrganismPart:Olfactory epithelium|ArrayExpress Sex:male|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 11 25T10:18:08Z|ENA LAST UPDATE:2018 03 08T16:38:06Z|External Id:SAMEA2168448|INSDC center name:SC|INSDC first public:2013 11 25T10:18:08Z|INSDC last update:2018 03 08T16:38:06Z|INSDC status:public|Submitter Id:ZF OE3 sc 2013 08 12T10:36:21Z 1677721|common name:zebrafish|sample description:RNA from OE|sample name:ZF OE3 sc 2013 08 12T10:36:21Z 1677721|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 10586 1#3,7941068,Illumina sequencing of library 7941068 constructed from sample accession ERS337052 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 1. This submission includes reads tagged with the sequence TTAGGC.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP003756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 11 25|ENA LAST UPDATE:2018 11 16,10586_1#3.cram,cram,11455059800.0,57275299.0,SC RUN 10586 1#3,0:100 1:100,A:3406564785;C:2353388363;G:2329218644;T:3351844154;N:14043854,100,100,,,3406564785,2353388363,2329218644,3351844154,14043854,ERX348123,ERS337052,ERA267455,SC,Wellcome Sanger Institute,2,0.91087,0.90879,0.16647,0.16616,0.6832,0.68436,0.54098,0.53604,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-11-25,Undetermined,Undetermined,Brain,Nervous System
10174,ERR375745,ERX348122,ERS337051,ERP003756,PRJEB4464,Zebrafish olfactory transcriptomics,Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742,Transcriptome Analysis,The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.,,,,,SAMEA2168447,SC,ArrayExpress Genotype:Wildtype|ArrayExpress OrganismPart:Olfactory epithelium|ArrayExpress Sex:male|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 11 25T10:18:08Z|ENA LAST UPDATE:2018 03 08T16:38:13Z|External Id:SAMEA2168447|INSDC center name:SC|INSDC first public:2013 11 25T10:18:08Z|INSDC last update:2018 03 08T16:38:13Z|INSDC status:public|Submitter Id:ZF OE2 sc 2013 08 12T10:36:20Z 1677720|common name:zebrafish|sample description:RNA from OE|sample name:ZF OE2 sc 2013 08 12T10:36:20Z 1677720|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 10586 1#2,7941067,Illumina sequencing of library 7941067 constructed from sample accession ERS337051 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 1. This submission includes reads tagged with the sequence CGATGT.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP003756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 11 25|ENA LAST UPDATE:2018 11 16,10586_1#2.cram,cram,10636681200.0,53183406.0,SC RUN 10586 1#2,0:100 1:100,A:3088549841;C:2244455059;G:2232424530;T:3058125106;N:13126664,100,100,,,3088549841,2244455059,2232424530,3058125106,13126664,ERX348122,ERS337051,ERA267455,SC,Wellcome Sanger Institute,2,0.9134,0.91251,0.15433,0.154,0.66849,0.66949,0.52089,0.53096,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-11-25,Undetermined,Undetermined,Brain,Nervous System
10175,ERR375744,ERX348121,ERS337050,ERP003756,PRJEB4464,Zebrafish olfactory transcriptomics,Zebrafish_olfactory_transcriptomics-sc-2013-08-12T10:32:48Z-2742,Transcriptome Analysis,The olfactory gene repertoire is largely species specific shaped by the nature and necessity of chemosensory information for survival in each species' niche. The relative expression of olfactory receptors can be quantified by RNA sequencing. We investigated the olfactory transcriptome of zebrafish because : i of its phylogenetic location in the vertebrate tree ii it has only one olfactory organ yet it has representatives of all the mammalian chemosensory receptor families iii its biology is well known iv is a commonly used model organism and it is suitable for subsequent functional analysis.,,,,,SAMEA2168446,SC,ArrayExpress Genotype:Wildtype|ArrayExpress OrganismPart:Olfactory epithelium|ArrayExpress Sex:male|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 11 25T10:18:08Z|ENA LAST UPDATE:2018 03 08T16:38:06Z|External Id:SAMEA2168446|INSDC center name:SC|INSDC first public:2013 11 25T10:18:08Z|INSDC last update:2018 03 08T16:38:06Z|INSDC status:public|Submitter Id:ZF OE1 sc 2013 08 12T10:36:17Z 1677719|common name:zebrafish|sample description:RNA from OE|sample name:ZF OE1 sc 2013 08 12T10:36:17Z 1677719|scientific name:Danio rerio,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,SC EXP 10586 1#1,7941066,Illumina sequencing of library 7941066 constructed from sample accession ERS337050 for study accession ERP003756. This is part of an Illumina multiplexed sequencing run 10586 1. This submission includes reads tagged with the sequence ATCACG.,Illumina cDNA protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP003756,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 11 25|ENA LAST UPDATE:2018 11 16,10586_1#1.cram,cram,10534775800.0,52673879.0,SC RUN 10586 1#1,0:100 1:100,A:3069581091;C:2219273001;G:2202030288;T:3030929981;N:12961439,100,100,,,3069581091,2219273001,2202030288,3030929981,12961439,ERX348121,ERS337050,ERA267455,SC,Wellcome Sanger Institute,2,0.91028,0.90986,0.15668,0.15607,0.67456,0.67472,0.52998,0.49845,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-11-25,Undetermined,Undetermined,Brain,Nervous System
19493,ERR14085264,ERX13487656,ERS22622156,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Day 1 Replicate 3,Day 1 Replicate 3,SAMEA117549392,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009436 Day 1 Replicate 3|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009436 Day 1 Replicate 3|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9517,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19137_1dpl3_R1.fastq.gz 19138_1dpl3_R2.fastq.gz,fastq fastq,9165478634.0,30349267.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9517,0:151 1:151,A:2646232308;C:1796801479;G:2124056448;T:2588021406;N:10366993,151,151,,,2646232308,1796801479,2124056448,2588021406,10366993,ERX13487656,ERS22622156,ERA31046063,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19494,ERR14085263,ERX13487655,ERS22622154,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Day 1 Replicate 2,Day 1 Replicate 2,SAMEA117549391,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009435 Day 1 Replicate 2|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009435 Day 1 Replicate 2|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9516,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19135_1dpl2_R1.fastq.gz 19136_1dpl2_R2.fastq.gz,fastq fastq,9442039362.0,31265031.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9516,0:151 1:151,A:2725446078;C:1808614751;G:2223018565;T:2675393466;N:9566502,151,151,,,2725446078,1808614751,2223018565,2675393466,9566502,ERX13487655,ERS22622154,ERA31046062,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19495,ERR14085271,ERX13487663,ERS22622318,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Day 7 Replicate 3,Day 7 Replicate 3,SAMEA117549418,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009442 Day 7 Replicate 3|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009442 Day 7 Replicate 3|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9523,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19149_7dpl5_R1.fastq.gz 19150_7dpl5_R2.fastq.gz,fastq fastq,9932206502.0,32888101.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9523,0:151 1:151,A:2877130874;C:2050638794;G:2165950578;T:2827301936;N:11184320,151,151,,,2877130874,2050638794,2165950578,2827301936,11184320,ERX13487663,ERS22622318,ERA31046070,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19496,ERR14085261,ERX13487653,ERS22622089,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Day 1 Replicate 1,Day 1 Replicate 1,SAMEA117549390,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009434 Day 1 Replicate 1|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009434 Day 1 Replicate 1|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9515,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19133_1dpl1_R1.fastq.gz 19134_1dpl1_R2.fastq.gz,fastq fastq,9389201442.0,31090071.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9515,0:151 1:151,A:2731715362;C:1816017173;G:2148260573;T:2683133097;N:10075237,151,151,,,2731715362,1816017173,2148260573,2683133097,10075237,ERX13487653,ERS22622089,ERA31046060,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19497,ERR14085274,ERX13487666,ERS22622321,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Control Replicate 3,Control Replicate 3,SAMEA117549421,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009445 Control Replicate 3|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009445 Control Replicate 3|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9526,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19155_C7_R1.fastq.gz 19156_C7_R2.fastq.gz,fastq fastq,9909221282.0,32811991.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9526,0:151 1:151,A:2850780132;C:1946613930;G:2307229799;T:2793332914;N:11264507,151,151,,,2850780132,1946613930,2307229799,2793332914,11264507,ERX13487666,ERS22622321,ERA31046073,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19498,ERR14085268,ERX13487660,ERS22622316,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Day 7 Replicate 1,Day 7 Replicate 1,SAMEA117549416,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009440 Day 7 Replicate 1|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009440 Day 7 Replicate 1|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9521,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19145_7dpl1_R1.fastq.gz 19146_7dpl1_R2.fastq.gz,fastq fastq,9208706914.0,30492407.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9521,0:151 1:151,A:2666375656;C:1820213036;G:2101314534;T:2611250093;N:9553595,151,151,,,2666375656,1820213036,2101314534,2611250093,9553595,ERX13487660,ERS22622316,ERA31046067,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19499,ERR14085276,ERX13487668,ERS22622315,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Day 4 Replicate 3,Day 4 Replicate 3,SAMEA117549415,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009439 Day 4 Replicate 3|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009439 Day 4 Replicate 3|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9520,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19143_4dpl4_R1.fastq.gz 19144_4dpl4_R2.fastq.gz,fastq fastq,9313489740.0,30839370.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9520,0:151 1:151,A:2667044089;C:1836529353;G:2193641971;T:2605720804;N:10553523,151,151,,,2667044089,1836529353,2193641971,2605720804,10553523,ERX13487668,ERS22622315,ERA31046075,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19500,ERR14085272,ERX13487664,ERS22622319,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Control Replicate 1,Control Replicate 1,SAMEA117549419,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009443 Control Replicate 1|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009443 Control Replicate 1|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9524,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19151_C5_R1.fastq.gz 19152_C5_R2.fastq.gz,fastq fastq,13295515874.0,44024887.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9524,0:151 1:151,A:3841326329;C:2750684077;G:2915049240;T:3777029141;N:11427087,151,151,,,3841326329,2750684077,2915049240,3777029141,11427087,ERX13487664,ERS22622319,ERA31046071,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19501,ERR14085265,ERX13487657,ERS22622177,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Day 4 Replicate 1,Day 4 Replicate 1,SAMEA117549413,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009437 Day 4 Replicate 1|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009437 Day 4 Replicate 1|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9518,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19139_4dpl2_R1.fastq.gz 19140_4dpl2_R2.fastq.gz,fastq fastq,12509373332.0,41421766.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9518,0:151 1:151,A:3636942004;C:2502487228;G:2790329437;T:3565530654;N:14084009,151,151,,,3636942004,2502487228,2790329437,3565530654,14084009,ERX13487657,ERS22622177,ERA31046064,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19502,ERR14085266,ERX13487658,ERS22622210,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Day 4 Replicate 2,Day 4 Replicate 2,SAMEA117549414,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009438 Day 4 Replicate 2|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009438 Day 4 Replicate 2|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9519,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19141_4dpl3_R1.fastq.gz 19142_4dpl3_R2.fastq.gz,fastq fastq,9691702460.0,32091730.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9519,0:151 1:151,A:2791714294;C:1934967288;G:2210755028;T:2743302083;N:10963767,151,151,,,2791714294,1934967288,2210755028,2743302083,10963767,ERX13487658,ERS22622210,ERA31046065,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19503,ERR14085269,ERX13487661,ERS22622317,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Day 7 Replicate 2,Day 7 Replicate 2,SAMEA117549417,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009441 Day 7 Replicate 2|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009441 Day 7 Replicate 2|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9522,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19147_7dpl4_R1.fastq.gz 19148_7dpl4_R2.fastq.gz,fastq fastq,9862024420.0,32655710.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9522,0:151 1:151,A:2841799545;C:2048598598;G:2166200803;T:2794242657;N:11182817,151,151,,,2841799545,2048598598,2166200803,2794242657,11182817,ERX13487661,ERS22622317,ERA31046068,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
19504,ERR14085273,ERX13487665,ERS22622320,ERP167301,PRJEB83711,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,"inda-STUDY-IIT-Delhi,Indraprastha Institute of Information Technology Shilpi Minocha, KSBS, IIT-Delhi New Delhi,India-2024-12-18 14:20:14.533-243",Other,Regeneration of damaged brain tissue is a complex biological process that varies significantly across species. Zebrafish possess a remarkable ability to regenerate central nervous system structures making them an invaluable model for studying the molecular and cellular mechanisms underlying neuroregeneration. In this study we employed a previously standardized telencephalic stab wound injury model to investigate transcriptional and cellular responses during zebrafish brain regeneration. This well characterized model allows for precise analysis of injury induced regenerative processes by comparing different temporal stages of recovery. Using RNA sequencing at four key time points: control 1 day post lesion 4 dpl and 7 dpl we identified dynamic changes in gene expression and revealed critical signaling pathways associated with regeneration. Among these the p38 MAPK signaling cascade emerged as a key regulator. Our findings underscore the multifaceted role of p38 MAPK which modulates progenitor cell proliferation differentiation and neurogenesis during regeneration. These insights align with known roles of p38 MAPK in neural stem cell biology while highlighting its distinct contributions in a regenerative context. This work provides a comprehensive overview of early transcriptional events and highlights novel molecular players involved in CNS repair further establishing the zebrafish as a robust model for regenerative research. Our findings open avenues for applying these pathways to develop therapeutic strategies aimed at enhancing brain repair in humans.,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,,RNA seq Control Replicate 2,Control Replicate 2,SAMEA117549420,"Indian Institute of Technology Delhi,Indraprastha Institute of Information Technology",ENA first public:2024 12 19|INSDC center name:Indian Institute of Technology Delhi Indraprastha Institute of Information Technology|INSDC status:public|Submitter Id:SAMIN0009444 Control Replicate 2|broker name:IBDC|collection date:2022 12 23|common name:zebrafish|geographic location country and/or sea:India|geographic location region and locality:New Delhi India|sample name:SAMIN0009444 Control Replicate 2|scientific name:Danio rerio,,,,,,,,,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9525,1,1,NaN,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP167301,Illumina NovaSeq 6000 paired end sequencing; From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration,ENA FIRST PUBLIC:2024 12 19|ENA LAST UPDATE:2024 12 19,19153_C6_R1.fastq.gz 19154_C6_R2.fastq.gz,fastq fastq,11398526732.0,37743466.0,RUN From injury to recovery: Transcriptomic dynamics in Zebrafish brain regeneration 9525,0:151 1:151,A:3315198872;C:2268180334;G:2561003095;T:3244771542;N:9372889,151,151,,,3315198872,2268180334,2561003095,3244771542,9372889,ERX13487665,ERS22622320,ERA31046072,Indian Biological Data Centre|European Nucleotide Archive,Indian Biological Data Centre,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,India,2024-12-19,Undetermined,Undetermined,Brain,Nervous System
24927,SRR25557778,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L001_R1_001.fastq.gz,fastq,420092501.0,5668059.0,GSM7688794 r1,0:74.12,A:113006440;C:96725832;G:99320773;T:110915967;N:123489,74,,,,113006440,96725832,99320773,110915967,123489,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94757,,0.06229,,0.72364,,0.46676,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24928,SRR25557779,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L002_R1_001.fastq.gz,fastq,421869780.0,5690053.0,GSM7688794 r2,0:74.14,A:113530489;C:97144227;G:99697959;T:111388539;N:108566,74,,,,113530489,97144227,99697959,111388539,108566,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94921,,0.06226,,0.72462,,0.4738,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24929,SRR25557780,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L003_R1_001.fastq.gz,fastq,425064659.0,5734041.0,GSM7688794 r3,0:74.13,A:114342253;C:97873100;G:100532599;T:112196433;N:120274,74,,,,114342253,97873100,100532599,112196433,120274,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94886,,0.06112,,0.72425,,0.47055,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24930,SRR25557781,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L004_R1_001.fastq.gz,fastq,416990548.0,5624902.0,GSM7688794 r4,0:74.13,A:112153356;C:96009158;G:98613145;T:110097476;N:117413,74,,,,112153356,96009158,98613145,110097476,117413,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94869,,0.06229,,0.72506,,0.47222,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24931,SRR25557782,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L001_R1_001.fastq.gz,fastq,434485284.0,5881416.0,GSM7688793 r1,0:73.87,A:116640351;C:100176557;G:102659919;T:114799536;N:208921,73,,,,116640351,100176557,102659919,114799536,208921,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94533,,0.07176,,0.72464,,0.47632,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24932,SRR25557783,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L002_R1_001.fastq.gz,fastq,435203869.0,5886556.0,GSM7688793 r2,0:73.93,A:116869356;C:100363580;G:102830644;T:114973504;N:166785,73,,,,116869356,100363580,102830644,114973504,166785,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94542,,0.07203,,0.72421,,0.47733,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24933,SRR25557784,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L003_R1_001.fastq.gz,fastq,439897269.0,5951878.0,GSM7688793 r3,0:73.91,A:118101648;C:101426657;G:103990006;T:116184480;N:194478,73,,,,118101648,101426657,103990006,116184480,194478,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94486,,0.07224,,0.72448,,0.47915,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24934,SRR25557785,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L004_R1_001.fastq.gz,fastq,431385256.0,5836029.0,GSM7688793 r4,0:73.92,A:115804970;C:99459059;G:101962932;T:113975935;N:182360,73,,,,115804970,99459059,101962932,113975935,182360,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94432,,0.07229,,0.7261,,0.47463,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24935,SRR25557786,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L001_R1_001.fastq.gz,fastq,513309395.0,6929648.0,GSM7688792 r1,0:74.07,A:137428462;C:118688804;G:122019962;T:134991729;N:180438,74,,,,137428462,118688804,122019962,134991729,180438,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94188,,0.07029,,0.73772,,0.47692,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24936,SRR25557787,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L002_R1_001.fastq.gz,fastq,517356735.0,6982196.0,GSM7688792 r2,0:74.10,A:138524037;C:119650852;G:122965491;T:136056171;N:160184,74,,,,138524037,119650852,122965491,136056171,160184,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94281,,0.06967,,0.73963,,0.48142,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24937,SRR25557788,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L003_R1_001.fastq.gz,fastq,519422328.0,7010631.0,GSM7688792 r3,0:74.09,A:139040684;C:120128748;G:123529198;T:136551898;N:171800,74,,,,139040684,120128748,123529198,136551898,171800,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94297,,0.06942,,0.73726,,0.47499,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24938,SRR25557789,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L004_R1_001.fastq.gz,fastq,511640294.0,6905748.0,GSM7688792 r4,0:74.09,A:136914638;C:118302866;G:121704665;T:134543505;N:174620,74,,,,136914638,118302866,121704665,134543505,174620,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94176,,0.07029,,0.73868,,0.47987,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24939,SRR25557790,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L001_R1_001.fastq.gz,fastq,429446821.0,5803178.0,GSM7688791 r1,0:74.00,A:114793535;C:99506379;G:102226914;T:112748761;N:171232,74,,,,114793535,99506379,102226914,112748761,171232,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94175,,0.06669,,0.73673,,0.48179,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24940,SRR25557791,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L002_R1_001.fastq.gz,fastq,434629893.0,5870828.0,GSM7688791 r2,0:74.03,A:116216940;C:100703527;G:103463365;T:114092681;N:153380,74,,,,116216940,100703527,103463365,114092681,153380,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94143,,0.0676,,0.73791,,0.48091,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24941,SRR25557792,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L003_R1_001.fastq.gz,fastq,435879881.0,5888685.0,GSM7688791 r3,0:74.02,A:116548094;C:100971153;G:103794902;T:114400770;N:164962,74,,,,116548094,100971153,103794902,114400770,164962,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94195,,0.06686,,0.73785,,0.48044,,73,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System
24942,SRR25557793,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L004_R1_001.fastq.gz,fastq,429478475.0,5801978.0,GSM7688791 r4,0:74.02,A:114799280;C:99474677;G:102302775;T:112737475;N:164268,74,,,,114799280,99474677,102302775,112737475,164268,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94118,,0.06706,,0.73892,,0.47732,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System