rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
67620,SRR17219949,SRX13399948,SRS11303068,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp skin tumor 4,GSM5732243,,source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,Qp skin tumor 4,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp skin tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,GSM5732243,GSM5732243: Qp skin tumor 4; Danio rerio; RNA Seq,GSM5732243,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732243,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101283.fastq.gz,fastq,122886760.0,3072169.0,GSM5732243 r1,0:40,A:41729821;C:25705614;G:27345231;T:28036062;N:70032,40,,,,41729821,25705614,27345231,28036062,70032,SRX13399948,SRS11303068,SRA1343073,GEO,Koch Institute,1,0.82784,,0.32837,,0.87756,,0.66545,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67621,SRR17219947,SRX13399947,SRS11303067,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp skin tumor 3,GSM5732242,,source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,Qp skin tumor 3,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp skin tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,GSM5732242,GSM5732242: Qp skin tumor 3; Danio rerio; RNA Seq,GSM5732242,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732242,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101282.fastq.gz,fastq,283770840.0,7094271.0,GSM5732242 r1,0:40,A:98647149;C:57235772;G:60084594;T:67639169;N:164156,40,,,,98647149,57235772,60084594,67639169,164156,SRX13399947,SRS11303067,SRA1343073,GEO,Koch Institute,1,0.82456,,0.20326,,0.87194,,0.65575,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67622,SRR17219945,SRX13399946,SRS11303065,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp skin tumor 2,GSM5732241,,source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,Qp skin tumor 2,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp skin tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,GSM5732241,GSM5732241: Qp skin tumor 2; Danio rerio; RNA Seq,GSM5732241,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732241,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101281.fastq.gz,fastq,187440520.0,4686013.0,GSM5732241 r1,0:40,A:64031749;C:38508754;G:39411330;T:45381562;N:107125,40,,,,64031749,38508754,39411330,45381562,107125,SRX13399946,SRS11303065,SRA1343073,GEO,Koch Institute,1,0.8171,,0.15628,,0.85593,,0.5865,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67623,SRR17219943,SRX13399945,SRS11303066,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp skin tumor 1,GSM5732240,,source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,Qp skin tumor 1,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp skin tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,GSM5732240,GSM5732240: Qp skin tumor 1; Danio rerio; RNA Seq,GSM5732240,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732240,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101280.fastq.gz,fastq,118902800.0,2972570.0,GSM5732240 r1,0:40,A:41431989;C:24163332;G:24495495;T:28744442;N:67542,40,,,,41431989,24163332,24495495,28744442,67542,SRX13399945,SRS11303066,SRA1343073,GEO,Koch Institute,1,0.82006,,0.15984,,0.8604,,0.56292,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67624,SRR17219941,SRX13399944,SRS11303064,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp eye tumor 8,GSM5732239,,source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,Qp eye tumor 8,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp eye tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732239,GSM5732239: Qp eye tumor 8; Danio rerio; RNA Seq,GSM5732239,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732239,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101279.fastq.gz,fastq,146962160.0,3674054.0,GSM5732239 r1,0:40,A:50428551;C:30417822;G:31827580;T:34204334;N:83873,40,,,,50428551,30417822,31827580,34204334,83873,SRX13399944,SRS11303064,SRA1343073,GEO,Koch Institute,1,0.80609,,0.25781,,0.85583,,0.63728,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67625,SRR17219939,SRX13399943,SRS11303063,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp eye tumor 7,GSM5732238,,source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,Qp eye tumor 7,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp eye tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732238,GSM5732238: Qp eye tumor 7; Danio rerio; RNA Seq,GSM5732238,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732238,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101278.fastq.gz,fastq,215250880.0,5381272.0,GSM5732238 r1,0:40,A:75096682;C:43785266;G:46300057;T:49947139;N:121736,40,,,,75096682,43785266,46300057,49947139,121736,SRX13399943,SRS11303063,SRA1343073,GEO,Koch Institute,1,0.81371,,0.25397,,0.85815,,0.65296,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67626,SRR17219937,SRX13399942,SRS11303062,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp eye tumor 6,GSM5732237,,source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,Qp eye tumor 6,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp eye tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732237,GSM5732237: Qp eye tumor 6; Danio rerio; RNA Seq,GSM5732237,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732237,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101277.fastq.gz,fastq,148936240.0,3723406.0,GSM5732237 r1,0:40,A:49984372;C:31061474;G:32793566;T:35009887;N:86941,40,,,,49984372,31061474,32793566,35009887,86941,SRX13399942,SRS11303062,SRA1343073,GEO,Koch Institute,1,0.82112,,0.28545,,0.85527,,0.64027,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67627,SRR17219935,SRX13399941,SRS11303061,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp eye tumor 5,GSM5732236,,source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,Qp eye tumor 5,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp eye tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732236,GSM5732236: Qp eye tumor 5; Danio rerio; RNA Seq,GSM5732236,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732236,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101276.fastq.gz,fastq,54051040.0,1351276.0,GSM5732236 r1,0:40,A:18297537;C:11096954;G:11777149;T:12846946;N:32454,40,,,,18297537,11096954,11777149,12846946,32454,SRX13399941,SRS11303061,SRA1343073,GEO,Koch Institute,1,0.81006,,0.30042,,0.85072,,0.63453,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67628,SRR17219977,SRX13399940,SRS11303060,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Bp tumor 9,GSM5732257,,source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,Bp tumor 9,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Bp tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732257,GSM5732257: Bp tumor 9; Danio rerio; RNA Seq,GSM5732257,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732257,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101299.fastq.gz,fastq,210377040.0,5259426.0,GSM5732257 r1,0:40,A:74755471;C:40672211;G:42048467;T:52783767;N:117124,40,,,,74755471,40672211,42048467,52783767,117124,SRX13399940,SRS11303060,SRA1343073,GEO,Koch Institute,1,0.81918,,0.19474,,0.84352,,0.58427,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67629,SRR17219975,SRX13399939,SRS11303059,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Bp tumor 8,GSM5732256,,source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,Bp tumor 8,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Bp tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732256,GSM5732256: Bp tumor 8; Danio rerio; RNA Seq,GSM5732256,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732256,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101298.fastq.gz,fastq,61311760.0,1532794.0,GSM5732256 r1,0:40,A:21165931;C:12861878;G:13049767;T:14199958;N:34226,40,,,,21165931,12861878,13049767,14199958,34226,SRX13399939,SRS11303059,SRA1343073,GEO,Koch Institute,1,0.82689,,0.32586,,0.8829,,0.64682,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67630,SRR17219973,SRX13399938,SRS11303057,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Bp tumor 7,GSM5732255,,source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,Bp tumor 7,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Bp tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732255,GSM5732255: Bp tumor 7; Danio rerio; RNA Seq,GSM5732255,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732255,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101297.fastq.gz,fastq,77653280.0,1941332.0,GSM5732255 r1,0:40,A:25595564;C:16454184;G:17705274;T:17852242;N:46016,40,,,,25595564,16454184,17705274,17852242,46016,SRX13399938,SRS11303057,SRA1343073,GEO,Koch Institute,1,0.82555,,0.35244,,0.87414,,0.64795,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67631,SRR17219971,SRX13399937,SRS11303056,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Bp tumor 6,GSM5732254,,source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,Bp tumor 6,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Bp tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732254,GSM5732254: Bp tumor 6; Danio rerio; RNA Seq,GSM5732254,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732254,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101296.fastq.gz,fastq,153995840.0,3849896.0,GSM5732254 r1,0:40,A:54845937;C:30246084;G:30853649;T:37960198;N:89972,40,,,,54845937,30246084,30853649,37960198,89972,SRX13399937,SRS11303056,SRA1343073,GEO,Koch Institute,1,0.81951,,0.24749,,0.85492,,0.63444,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67632,SRR17219969,SRX13399936,SRS11303058,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Bp tumor 5,GSM5732253,,source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,Bp tumor 5,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Bp tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732253,GSM5732253: Bp tumor 5; Danio rerio; RNA Seq,GSM5732253,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732253,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101295.fastq.gz,fastq,145077520.0,3626938.0,GSM5732253 r1,0:40,A:50896676;C:28947088;G:29778646;T:35373335;N:81775,40,,,,50896676,28947088,29778646,35373335,81775,SRX13399936,SRS11303058,SRA1343073,GEO,Koch Institute,1,0.83261,,0.15352,,0.8714,,0.66861,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67633,SRR17219967,SRX13399935,SRS11303055,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Bp tumor 4,GSM5732252,,source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,Bp tumor 4,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Bp tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732252,GSM5732252: Bp tumor 4; Danio rerio; RNA Seq,GSM5732252,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732252,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101294.fastq.gz,fastq,164977400.0,4124435.0,GSM5732252 r1,0:40,A:56984652;C:35127348;G:35228728;T:37543026;N:93646,40,,,,56984652,35127348,35228728,37543026,93646,SRX13399935,SRS11303055,SRA1343073,GEO,Koch Institute,1,0.8376,,0.16272,,0.8871,,0.60385,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67634,SRR17219933,SRX13399934,SRS11303054,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp eye tumor 4,GSM5732235,,source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,Qp eye tumor 4,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp eye tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732235,GSM5732235: Qp eye tumor 4; Danio rerio; RNA Seq,GSM5732235,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732235,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101275.fastq.gz,fastq,69014880.0,1725372.0,GSM5732235 r1,0:40,A:23878875;C:13623172;G:14194689;T:17279107;N:39037,40,,,,23878875,13623172,14194689,17279107,39037,SRX13399934,SRS11303054,SRA1343073,GEO,Koch Institute,1,0.80282,,0.22626,,0.83489,,0.6254,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67635,SRR17219931,SRX13399933,SRS11303053,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp eye tumor 3,GSM5732234,,source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,Qp eye tumor 3,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp eye tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732234,GSM5732234: Qp eye tumor 3; Danio rerio; RNA Seq,GSM5732234,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732234,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101274.fastq.gz,fastq,85565720.0,2139143.0,GSM5732234 r1,0:40,A:30643576;C:16725788;G:16483878;T:21663657;N:48821,40,,,,30643576,16725788,16483878,21663657,48821,SRX13399933,SRS11303053,SRA1343073,GEO,Koch Institute,1,0.80932,,0.18194,,0.84952,,0.59231,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67636,SRR17219929,SRX13399932,SRS11303052,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp eye tumor 2,GSM5732233,,source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,Qp eye tumor 2,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp eye tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732233,GSM5732233: Qp eye tumor 2; Danio rerio; RNA Seq,GSM5732233,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732233,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101273.fastq.gz,fastq,49625960.0,1240649.0,GSM5732233 r1,0:40,A:16689341;C:10162844;G:10888880;T:11856436;N:28459,40,,,,16689341,10162844,10888880,11856436,28459,SRX13399932,SRS11303052,SRA1343073,GEO,Koch Institute,1,0.81618,,0.26509,,0.84827,,0.65117,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67637,SRR17219927,SRX13399931,SRS11303050,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp eye tumor 1,GSM5732232,,source name:Qp eye tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,Qp eye tumor 1,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp eye tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732232,GSM5732232: Qp eye tumor 1; Danio rerio; RNA Seq,GSM5732232,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732232,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101272.fastq.gz,fastq,73671880.0,1841797.0,GSM5732232 r1,0:40,A:26063623;C:14422230;G:14515642;T:18627765;N:42620,40,,,,26063623,14422230,14515642,18627765,42620,SRX13399931,SRS11303050,SRA1343073,GEO,Koch Institute,1,0.80786,,0.21001,,0.84938,,0.6324,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67638,SRR17219925,SRX13399930,SRS11303051,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 10,GSM5732231,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 10,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732231,GSM5732231: Qm tumor 10; Danio rerio; RNA Seq,GSM5732231,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732231,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101271.fastq.gz,fastq,101188800.0,2529720.0,GSM5732231 r1,0:40,A:35586693;C:19763784;G:20181202;T:25598600;N:58521,40,,,,35586693,19763784,20181202,25598600,58521,SRX13399930,SRS11303051,SRA1343073,GEO,Koch Institute,1,0.80571,,0.20498,,0.84273,,0.61432,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67639,SRR17219923,SRX13399929,SRS11303049,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 9,GSM5732230,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 9,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732230,GSM5732230: Qm tumor 9; Danio rerio; RNA Seq,GSM5732230,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732230,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101270.fastq.gz,fastq,116338960.0,2908474.0,GSM5732230 r1,0:40,A:40934240;C:23631257;G:23574658;T:28131114;N:67691,40,,,,40934240,23631257,23574658,28131114,67691,SRX13399929,SRS11303049,SRA1343073,GEO,Koch Institute,1,0.8118,,0.18354,,0.85354,,0.60389,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67640,SRR17219921,SRX13399928,SRS11303048,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 8,GSM5732229,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 8,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732229,GSM5732229: Qm tumor 8; Danio rerio; RNA Seq,GSM5732229,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732229,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101269.fastq.gz,fastq,113227280.0,2830682.0,GSM5732229 r1,0:40,A:38328913;C:23480607;G:24489533;T:26864215;N:64012,40,,,,38328913,23480607,24489533,26864215,64012,SRX13399928,SRS11303048,SRA1343073,GEO,Koch Institute,1,0.82097,,0.20002,,0.85904,,0.65238,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67641,SRR17219919,SRX13399927,SRS11303047,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 7,GSM5732228,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 7,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732228,GSM5732228: Qm tumor 7; Danio rerio; RNA Seq,GSM5732228,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732228,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101268.fastq.gz,fastq,104497160.0,2612429.0,GSM5732228 r1,0:40,A:35306615;C:21368264;G:22765419;T:24995701;N:61161,40,,,,35306615,21368264,22765419,24995701,61161,SRX13399927,SRS11303047,SRA1343073,GEO,Koch Institute,1,0.82081,,0.20118,,0.85082,,0.60839,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67642,SRR17219965,SRX13399926,SRS11303046,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Bp tumor 3,GSM5732251,,source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,Bp tumor 3,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Bp tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732251,GSM5732251: Bp tumor 3; Danio rerio; RNA Seq,GSM5732251,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732251,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101293.fastq.gz,fastq,160349920.0,4008748.0,GSM5732251 r1,0:40,A:52636356;C:34485561;G:37062014;T:36075665;N:90324,40,,,,52636356,34485561,37062014,36075665,90324,SRX13399926,SRS11303046,SRA1343073,GEO,Koch Institute,1,0.83192,,0.18947,,0.86645,,0.63435,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67643,SRR17219963,SRX13399925,SRS11303045,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Bp tumor 2,GSM5732250,,source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,Bp tumor 2,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Bp tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732250,GSM5732250: Bp tumor 2; Danio rerio; RNA Seq,GSM5732250,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732250,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101291.fastq.gz,fastq,86530240.0,2163256.0,GSM5732250 r1,0:40,A:28567808;C:18531588;G:20031608;T:19348376;N:50860,40,,,,28567808,18531588,20031608,19348376,50860,SRX13399925,SRS11303045,SRA1343073,GEO,Koch Institute,1,0.8305,,0.33333,,0.89286,,0.68581,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67644,SRR17219961,SRX13399924,SRS11303044,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Bp tumor 1,GSM5732249,,source name:Bp tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,Bp tumor 1,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Bp tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:BRAF V600E|genotype:tp53 / |tissue:uveal melanoma tumor,GSM5732249,GSM5732249: Bp tumor 1; Danio rerio; RNA Seq,GSM5732249,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732249,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101290.fastq.gz,fastq,129363640.0,3234091.0,GSM5732249 r1,0:40,A:44511787;C:27719005;G:28065443;T:28993522;N:73883,40,,,,44511787,27719005,28065443,28993522,73883,SRX13399924,SRS11303044,SRA1343073,GEO,Koch Institute,1,0.83185,,0.31848,,0.88534,,0.65619,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67645,SRR17219959,SRX13399923,SRS11303043,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp skin tumor 9,GSM5732248,,source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,Qp skin tumor 9,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp skin tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,GSM5732248,GSM5732248: Qp skin tumor 9; Danio rerio; RNA Seq,GSM5732248,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732248,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101289.fastq.gz,fastq,152510400.0,3812760.0,GSM5732248 r1,0:40,A:52274113;C:31326291;G:31850664;T:36971245;N:88087,40,,,,52274113,31326291,31850664,36971245,88087,SRX13399923,SRS11303043,SRA1343073,GEO,Koch Institute,1,0.82364,,0.24647,,0.85871,,0.66872,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67646,SRR17219957,SRX13399922,SRS11303042,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp skin tumor 8,GSM5732247,,source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,Qp skin tumor 8,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp skin tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,GSM5732247,GSM5732247: Qp skin tumor 8; Danio rerio; RNA Seq,GSM5732247,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732247,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101287.fastq.gz,fastq,76828360.0,1920709.0,GSM5732247 r1,0:40,A:26523726;C:15399788;G:16949111;T:17911010;N:44725,40,,,,26523726,15399788,16949111,17911010,44725,SRX13399922,SRS11303042,SRA1343073,GEO,Koch Institute,1,0.82316,,0.38565,,0.87801,,0.65616,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67647,SRR17219955,SRX13399921,SRS11303041,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp skin tumor 7,GSM5732246,,source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,Qp skin tumor 7,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp skin tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,GSM5732246,GSM5732246: Qp skin tumor 7; Danio rerio; RNA Seq,GSM5732246,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732246,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101286.fastq.gz,fastq,77108080.0,1927702.0,GSM5732246 r1,0:40,A:26570402;C:15649619;G:16889594;T:17953263;N:45202,40,,,,26570402,15649619,16889594,17953263,45202,SRX13399921,SRS11303041,SRA1343073,GEO,Koch Institute,1,0.81122,,0.33667,,0.87178,,0.66288,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67648,SRR17219953,SRX13399920,SRS11303040,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp skin tumor 6,GSM5732245,,source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,Qp skin tumor 6,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp skin tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,GSM5732245,GSM5732245: Qp skin tumor 6; Danio rerio; RNA Seq,GSM5732245,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732245,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101285.fastq.gz,fastq,124624040.0,3115601.0,GSM5732245 r1,0:40,A:41502232;C:26253849;G:27083319;T:29714036;N:70604,40,,,,41502232,26253849,27083319,29714036,70604,SRX13399920,SRS11303040,SRA1343073,GEO,Koch Institute,1,0.81706,,0.26109,,0.85811,,0.65526,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67649,SRR17219951,SRX13399919,SRS11303039,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qp skin tumor 5,GSM5732244,,source name:Qp skin tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,Qp skin tumor 5,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qp skin tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / |tissue:cutaneous melanoma tumor,GSM5732244,GSM5732244: Qp skin tumor 5; Danio rerio; RNA Seq,GSM5732244,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732244,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101284.fastq.gz,fastq,97066400.0,2426660.0,GSM5732244 r1,0:40,A:32977109;C:19973503;G:20845864;T:23215430;N:54494,40,,,,32977109,19973503,20845864,23215430,54494,SRX13399919,SRS11303039,SRA1343073,GEO,Koch Institute,1,0.82484,,0.28858,,0.86561,,0.64518,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67650,SRR17219917,SRX13399918,SRS11303037,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 6,GSM5732227,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 6,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732227,GSM5732227: Qm tumor 6; Danio rerio; RNA Seq,GSM5732227,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732227,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101267.fastq.gz,fastq,94190240.0,2354756.0,GSM5732227 r1,0:40,A:32749934;C:18714126;G:19617591;T:23052224;N:56365,40,,,,32749934,18714126,19617591,23052224,56365,SRX13399918,SRS11303037,SRA1343073,GEO,Koch Institute,1,0.8137,,0.21484,,0.85395,,0.6013,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67651,SRR17219915,SRX13399917,SRS11303036,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 5,GSM5732226,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 5,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732226,GSM5732226: Qm tumor 5; Danio rerio; RNA Seq,GSM5732226,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732226,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101266.fastq.gz,fastq,142630800.0,3565770.0,GSM5732226 r1,0:40,A:50773272;C:29136199;G:28699617;T:33938415;N:83297,40,,,,50773272,29136199,28699617,33938415,83297,SRX13399917,SRS11303036,SRA1343073,GEO,Koch Institute,1,0.81831,,0.21344,,0.86935,,0.62355,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67652,SRR17219913,SRX13399916,SRS11303038,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 4,GSM5732225,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 4,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732225,GSM5732225: Qm tumor 4; Danio rerio; RNA Seq,GSM5732225,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732225,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101265.fastq.gz,fastq,72664840.0,1816621.0,GSM5732225 r1,0:40,A:24936806;C:14864464;G:15139082;T:17684025;N:40463,40,,,,24936806,14864464,15139082,17684025,40463,SRX13399916,SRS11303038,SRA1343073,GEO,Koch Institute,1,0.81563,,0.19935,,0.84956,,0.61926,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67653,SRR17219911,SRX13399915,SRS11303035,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 3,GSM5732224,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 3,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732224,GSM5732224: Qm tumor 3; Danio rerio; RNA Seq,GSM5732224,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732224,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101264.fastq.gz,fastq,137738640.0,3443466.0,GSM5732224 r1,0:40,A:46262332;C:28700073;G:30367217;T:32328223;N:80795,40,,,,46262332,28700073,30367217,32328223,80795,SRX13399915,SRS11303035,SRA1343073,GEO,Koch Institute,1,0.82243,,0.19809,,0.86103,,0.62402,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67654,SRR17219909,SRX13399914,SRS11303034,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 2,GSM5732223,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 2,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732223,GSM5732223: Qm tumor 2; Danio rerio; RNA Seq,GSM5732223,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732223,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101263.fastq.gz,fastq,100736440.0,2518411.0,GSM5732223 r1,0:40,A:35350874;C:19629100;G:20709910;T:24987897;N:58659,40,,,,35350874,19629100,20709910,24987897,58659,SRX13399914,SRS11303034,SRA1343073,GEO,Koch Institute,1,0.816,,0.19534,,0.85498,,0.58105,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67655,SRR17219907,SRX13399913,SRS11303033,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qm tumor 1,GSM5732222,,source name:Qm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,Qm tumor 1,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:mitfa / |tissue:uveal melanoma tumor,GSM5732222,GSM5732222: Qm tumor 1; Danio rerio; RNA Seq,GSM5732222,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732222,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101262.fastq.gz,fastq,105944280.0,2648607.0,GSM5732222 r1,0:40,A:37210955;C:21008075;G:21663482;T:26000794;N:60974,40,,,,37210955,21008075,21663482,26000794,60974,SRX13399913,SRS11303033,SRA1343073,GEO,Koch Institute,1,0.81581,,0.20031,,0.86334,,0.6085,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67656,SRR17219905,SRX13399912,SRS11303032,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 10,GSM5732221,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 10,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732221,GSM5732221: Qpm tumor 10; Danio rerio; RNA Seq,GSM5732221,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732221,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101261.fastq.gz,fastq,101472840.0,2536821.0,GSM5732221 r1,0:40,A:34475762;C:20816302;G:21286989;T:24838307;N:55480,40,,,,34475762,20816302,21286989,24838307,55480,SRX13399912,SRS11303032,SRA1343073,GEO,Koch Institute,1,0.81061,,0.20131,,0.84613,,0.60722,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67657,SRR17219903,SRX13399911,SRS11303031,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 9,GSM5732220,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 9,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732220,GSM5732220: Qpm tumor 9; Danio rerio; RNA Seq,GSM5732220,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732220,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101260.fastq.gz,fastq,99755640.0,2493891.0,GSM5732220 r1,0:40,A:34870327;C:19628149;G:20126136;T:25072821;N:58207,40,,,,34870327,19628149,20126136,25072821,58207,SRX13399911,SRS11303031,SRA1343073,GEO,Koch Institute,1,0.80894,,0.20798,,0.84678,,0.61006,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67658,SRR17219901,SRX13399910,SRS11303030,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 8,GSM5732219,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 8,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732219,GSM5732219: Qpm tumor 8; Danio rerio; RNA Seq,GSM5732219,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732219,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101259.fastq.gz,fastq,164204720.0,4105118.0,GSM5732219 r1,0:40,A:57421304;C:32261871;G:33727368;T:40700224;N:93953,40,,,,57421304,32261871,33727368,40700224,93953,SRX13399910,SRS11303030,SRA1343073,GEO,Koch Institute,1,0.81413,,0.19281,,0.85001,,0.62212,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67659,SRR17219899,SRX13399909,SRS11303027,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 7,GSM5732217,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 7,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732217,GSM5732217: Qpm tumor 7; Danio rerio; RNA Seq,GSM5732217,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732217,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101258.fastq.gz,fastq,170806960.0,4270174.0,GSM5732217 r1,0:40,A:59047625;C:34088876;G:36165441;T:41402090;N:102928,40,,,,59047625,34088876,36165441,41402090,102928,SRX13399909,SRS11303027,SRA1343073,GEO,Koch Institute,1,0.81948,,0.19309,,0.85222,,0.62553,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67660,SRR17219897,SRX13399908,SRS11303029,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 6,GSM5732215,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 6,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732215,GSM5732215: Qpm tumor 6; Danio rerio; RNA Seq,GSM5732215,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732215,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101257.fastq.gz,fastq,115180880.0,2879522.0,GSM5732215 r1,0:40,A:39638720;C:23294416;G:23781904;T:28400153;N:65687,40,,,,39638720,23294416,23781904,28400153,65687,SRX13399908,SRS11303029,SRA1343073,GEO,Koch Institute,1,0.80861,,0.19172,,0.84528,,0.62263,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67661,SRR17219895,SRX13399907,SRS11303028,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 5,GSM5732214,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 5,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732214,GSM5732214: Qpm tumor 5; Danio rerio; RNA Seq,GSM5732214,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732214,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101256.fastq.gz,fastq,98789880.0,2469747.0,GSM5732214 r1,0:40,A:34779177;C:19539836;G:19833227;T:24577420;N:60220,40,,,,34779177,19539836,19833227,24577420,60220,SRX13399907,SRS11303028,SRA1343073,GEO,Koch Institute,1,0.8048,,0.19299,,0.85216,,0.5989,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67662,SRR17219893,SRX13399906,SRS11303026,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 4,GSM5732212,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 4,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732212,GSM5732212: Qpm tumor 4; Danio rerio; RNA Seq,GSM5732212,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732212,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101255.fastq.gz,fastq,156209080.0,3905227.0,GSM5732212 r1,0:40,A:54435131;C:31318276;G:32371758;T:37994070;N:89845,40,,,,54435131,31318276,32371758,37994070,89845,SRX13399906,SRS11303026,SRA1343073,GEO,Koch Institute,1,0.81902,,0.18706,,0.84524,,0.62441,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67663,SRR17219891,SRX13399905,SRS11303025,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 3,GSM5732211,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 3,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732211,GSM5732211: Qpm tumor 3; Danio rerio; RNA Seq,GSM5732211,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732211,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101254.fastq.gz,fastq,148839960.0,3720999.0,GSM5732211 r1,0:40,A:52156979;C:30408766;G:31252231;T:34935943;N:86041,40,,,,52156979,30408766,31252231,34935943,86041,SRX13399905,SRS11303025,SRA1343073,GEO,Koch Institute,1,0.82271,,0.19102,,0.8633,,0.64179,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67664,SRR17219889,SRX13399904,SRS11303024,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 2,GSM5732209,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 2,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732209,GSM5732209: Qpm tumor 2; Danio rerio; RNA Seq,GSM5732209,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732209,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101253.fastq.gz,fastq,128233680.0,3205842.0,GSM5732209 r1,0:40,A:44051377;C:26029222;G:27011242;T:31066810;N:75029,40,,,,44051377,26029222,27011242,31066810,75029,SRX13399904,SRS11303024,SRA1343073,GEO,Koch Institute,1,0.81523,,0.2073,,0.84285,,0.58754,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
67665,SRR17219887,SRX13399903,SRS11303023,SRP350562,PRJNA788496,MITF deficiency accelerates GNAQ driven uveal melanoma,GSE190802,Transcriptome Analysis,Cutaneous melanoma CM and uveal melanoma UM both originate from the melanocytic lineage but are primarily driven by distinct oncogenic drivers  BRAF/NRAS or GNAQ/GNA11 respectively. The melanocytic master transcriptional regulator  MITF  is essential for both CM development and maintenance  but its role in UM is largely unexplored. Here  we use zebrafish models to dissect the key UM oncogenic signaling events  and establish the role of MITF in UM tumors. Using a melanocytic lineage expression system  we showed that patient derived mutations of GNAQ GNAQQ209L or its upstream CYSLTR2 receptor CYSLTR2L129Q both drive UM when combined with a cooperating mutation  tp53M214K/M214K. The tumor initiating potential of the major GNAQ/11 effector pathways  YAP and PLCß ERK  was also investigated in this system  and thus showed that while activated YAP YAPAA induced UM with high potency  the patient derived PLC?4 mutation PLCB4D630Y very rarely yielded UM tumors in the tp53M214K/M214K context. Remarkably  mitfa deficiency was profoundly UM promoting  dramatically accelerating the onset and progression of tumors induced by TgGNAQQ209L;tp53M214K/M214K or TgCYSLTR2L129Q;tp53M214K/M214K. Moreover  mitfa loss was sufficient to cooperate with GNAQQ209L to drive tp53 wildtype UM development  and allowed TgPLCB4D630Y;tp53M214K/M214K melanocyte lineage cells to readily form tumors. Notably  all of the mitfa /  UM tumors  including those arising in Tgmitfa:PLCB4D630Y;tp53M214K/M214K;mitfa /  fish  displayed nuclear YAP while lacking hyperactive ERK indicative of PLCß signaling. Collectively  these data show that YAP signaling is the major mediator of UM  and that MITF acts as bona fide tumor suppressor in UM  in direct opposition to its essential role in CM. Overall design: Comparison of zebrarfish uveal melanomal tumors from 5 genotypes/anatomical locations: Tgmitfa:GNAQ Q209L  tp53 /   mitfa /  n=10; Tgmitfa:GNAQ Q209L  mitfa /  n=10; Tgmitfa:GNAQ Q209L  tp53 /   eye n=8; Tgmitfa:GNAQ Q209L  tp53 /   skin n=9; Tgmitfa:BRAF V600E  tp53 /  n=9;,,,,Qpm tumor 1,GSM5732208,,source name:Qpm tumor|genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,Qpm tumor 1,NextSeq 500 using v3 chemistry. Software: Control v2.0.0.24  RTA 2.4.6. BCL files were converted to fastq using bcl2qseq. Indexes were split using custom scripts allowing 1 mismatch. Reads were quantified using 3’ digital gene expression reads and RSEM version 1.2.15 with alignments prepared using bowtie2 version 2.2.3 Genome build: Zv10 with an ensembl version 80 annotation Supplementary files format and content: aha 120821 Counts.txt.gz is a tab delimited text file of raw count data Supplementary files format and content: aha 120821 l2cpm.txt.gz is a tab delimited text file of log2 counts per million with a plus 1 offset,Qpm tumor,Fish were anesthetized in 0.1% Tricaine for 20 minutes and tumors were manually dissected from the fish and immediately processed in Trizol reagent invitrogen,Trizol extraction Invitrogen 3’ Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. 3’DGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = 5’  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer’s recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : 5’ iCiGiCACACTCTTTCCCTACACGACGCrGrGrG 3’  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90’ and inactivation at 80C for 10’. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies 5’ /5Biosg/ACACTCTTTCCCTACACGACGC 3’ directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* 3’  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,,genetic background:AB/Tübingen TAB5/14|transgene:Tgmitfa:GNAQ Q209L|genotype:tp53 / ; mitfa / |tissue:uveal melanoma tumor,GSM5732208,GSM5732208: Qpm tumor 1; Danio rerio; RNA Seq,GSM5732208,,1,Trizol extraction Invitrogen three prime Digital gene expression libraries were created by cleaning  RNA samples were cleaned using SPRI beads 1.8X  quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 10ng of total RNA was used for library preparation. three primeDGE custom primers 3V6NEXT bmc#1 24 were added to a final concentration of 1 uM. five prime /5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN three prime  where  5Biosg = five prime  biotin  [BC6] = 6bp barcode specific to each sample/well  N10 = Unique Molecular Identifiers  Integrated DNA technologies  to generate two subpools of 24 samples each. post addition of the oligonucleotides  Maxima H Minus RT was added per manufacturer's recommendations with Template Switching oligo 5V6NEXT 10uM  [5V6NEXT : five prime iCiGiCACACTCTTTCCCTACACGACGCrGrGrG three prime  where  iC: iso dC  iG: iso dG  rG: RNA G ]  followed by incubation at 42C for 90' and inactivation at 80C for 10'. Following the template switching reaction  cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 17 ul of water followed by digestion with Exonuclease I at 37C for 30 minutes  and inactivated at 80C for 20 minutes. Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix Clontech and the SINGV6 primer 10 pmol  Integrated DNA Technologies five prime /5Biosg/ACACTCTTTCCCTACACGACGC three prime directly to the exonuclease reaction. 8 cycles of PCR were performed followed by clean up using regular SPRI beads at 0.6X  and eluted with 20ul of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5 bmc primer 25μM  Integrated DNA Technologies  five prime AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T* three prime  where  * = phosphorothioate bonds.  in place of the normal N500 primer.  Final libraries were cleaned using SPRI beads at 0.7X and quantified using the Fragment Analyzer and qPCR,GEO Accession:GSM5732208,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP350562,,,D16-101252.fastq.gz,fastq,141895280.0,3547382.0,GSM5732208 r1,0:40,A:48598049;C:29057904;G:30058661;T:34100467;N:80199,40,,,,48598049,29057904,30058661,34100467,80199,SRX13399903,SRS11303023,SRA1343073,GEO,Koch Institute,1,0.82023,,0.20855,,0.85878,,0.62752,,40,,B,,usable mapping rate,illumina,nextseq,3prime,cdna_unspecified,nextera,bulk,bulk,bulk,,Unknown,2021-12-13,Undetermined,Undetermined,Cancer or Tumor,Cancer or Tumor
71533,SRR21659014,SRX17658778,SRS15191045,SRP398439,PRJNA882818,Defining function of wild type and three patient specific TP53 mutations in a zebrafish model of embryonal rhabdomyosarcoma,GSE213869,Transcriptome Analysis,RNAseq analyses comparing gene expression in zebrafish embryonal rhabdomyosarcoma tumors expressing kRASG12D/tp53 / /GFP or /kRASG12Dtp53 /  + TP53 P153?/GFP Overall design: The RNAseq samples being submitted are of zebrafish  embryonal rhabdomyosarcoma tumors generated in th CG1 syngeneic background expressing kRASG12D/tp53 / /GFP and /kRASG12Dtp53 /  + TP53 P153?/GFP,,pubmed:37266578,,ProDel3 c,GSM6595573,,source name:rhabdomyosarcoma tumors in zebrafish|tissue:zebrafish|geo loc name:missing|collection date:missing,ProDel3 c,Illumina Casava v1.8.2 software used for base calling All RNA seq FastQ reads were aligned with the reference genome danRer11 using TopHat2 default settings. The aligned BAM files sorted SAMTools and then processed using HTSeq count to obtain the counts per gene gene count measurements were obtained using HTSeq count Assembly: danRer11 Supplementary files format and content: The processed data files are in tabular format.  The first column contains the gene symbols and the second column contain the read counts of the gene using htseq count.,rhabdomyosarcoma tumors in zebrafish,,post tissue grinding and homogenization in RNA lysis buffer  total RNA was isolated from harvested tumors using the RNAeasy Kit Qiagen; Valencia  CA according to the manufacturer’s recommendation. post quantification with Nanodrop Thermo Scientific; Rockford  IL  RNA was stored at  80ºC. Total RNA was used for RNA Seq library preparation by following the KAPA Stranded RNA Seq Kit,For expression of mutant human TP53 experiments  tumors were generated by injecting XhoI linearized rag2 kRASG12D and rag2 GFP along with Xmn1 linearized rag2 TP53 P153△  35 ng/ml of rag2 kRASG12D  15 ng/ml rag2 GFP or mutant TP53 and 10 ng/ml of rag2 GFP into the one cell stage of syngeneic zebrafish CG1/tp53 /  embryos <1 hpf Ignatius et al.  2012. Animals were monitored for tumor onset beginning at 10 dpf by scoring for GFP fluorescence under an Olympus MVX10 stereomicroscope with an X Cite series 120Q fluorescence illuminator. Scoring for tumor initiation was conducted for 60 days. 3 tumors each expressing kRASG12D/GFP/tp53 /   or kRASG12D/GFP/tp53 /  +TP53 P153△ were transplanted into secondary CG1 recipients and engrafted tumors were isolated  prepared as single cell suspensions and sorted by flowcytometry. Tumor cells were then processed to isolate RNA which was then submitted for RNAseq analyses Ignatius et al.  2012.,tissue:zebrafish|tp53 /  + TP53 P153△,GSM6595573,GSM6595573: ProDel3 c; Danio rerio; RNA Seq,GSM6595573 r1,GSM6595573,1,post tissue grinding and homogenization in RNA lysis buffer  total RNA was isolated from harvested tumors using the RNAeasy Kit Qiagen; Valencia  CA according to the manufacturer's recommendation. post quantification with Nanodrop Thermo Scientific; Rockford  IL  RNA was stored at  80ºC. Total RNA was used for RNA Seq library preparation by following the KAPA Stranded RNA Seq Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 3000,,SRP398439,,,ProDel3_c_S41_R1.fastq,fastq,1583531283.0,31049633.0,GSM6595573 r1,0:51 1:0,A:371274884;C:377726847;G:377321846;T:456738328;N:469378,51,0,,,371274884,377726847,377321846,456738328,469378,SRX17658778,SRS15191045,SRA1503133,"Population Health Sciences, UT Health Science Center at San Antonio","Population Health Sciences, UT Health Science Center at San Antonio",1,0.9215,,0.08584,,0.73028,,0.52093,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,United States,2022-09-21,Multi-stage,Multi-stage,Cancer or Tumor,Cancer or Tumor
71534,SRR21659015,SRX17658777,SRS15191044,SRP398439,PRJNA882818,Defining function of wild type and three patient specific TP53 mutations in a zebrafish model of embryonal rhabdomyosarcoma,GSE213869,Transcriptome Analysis,RNAseq analyses comparing gene expression in zebrafish embryonal rhabdomyosarcoma tumors expressing kRASG12D/tp53 / /GFP or /kRASG12Dtp53 /  + TP53 P153?/GFP Overall design: The RNAseq samples being submitted are of zebrafish  embryonal rhabdomyosarcoma tumors generated in th CG1 syngeneic background expressing kRASG12D/tp53 / /GFP and /kRASG12Dtp53 /  + TP53 P153?/GFP,,pubmed:37266578,,ProDel2 b,GSM6595572,,source name:rhabdomyosarcoma tumors in zebrafish|tissue:zebrafish|geo loc name:missing|collection date:missing,ProDel2 b,Illumina Casava v1.8.2 software used for base calling All RNA seq FastQ reads were aligned with the reference genome danRer11 using TopHat2 default settings. The aligned BAM files sorted SAMTools and then processed using HTSeq count to obtain the counts per gene gene count measurements were obtained using HTSeq count Assembly: danRer11 Supplementary files format and content: The processed data files are in tabular format.  The first column contains the gene symbols and the second column contain the read counts of the gene using htseq count.,rhabdomyosarcoma tumors in zebrafish,,post tissue grinding and homogenization in RNA lysis buffer  total RNA was isolated from harvested tumors using the RNAeasy Kit Qiagen; Valencia  CA according to the manufacturer’s recommendation. post quantification with Nanodrop Thermo Scientific; Rockford  IL  RNA was stored at  80ºC. Total RNA was used for RNA Seq library preparation by following the KAPA Stranded RNA Seq Kit,For expression of mutant human TP53 experiments  tumors were generated by injecting XhoI linearized rag2 kRASG12D and rag2 GFP along with Xmn1 linearized rag2 TP53 P153△  35 ng/ml of rag2 kRASG12D  15 ng/ml rag2 GFP or mutant TP53 and 10 ng/ml of rag2 GFP into the one cell stage of syngeneic zebrafish CG1/tp53 /  embryos <1 hpf Ignatius et al.  2012. Animals were monitored for tumor onset beginning at 10 dpf by scoring for GFP fluorescence under an Olympus MVX10 stereomicroscope with an X Cite series 120Q fluorescence illuminator. Scoring for tumor initiation was conducted for 60 days. 3 tumors each expressing kRASG12D/GFP/tp53 /   or kRASG12D/GFP/tp53 /  +TP53 P153△ were transplanted into secondary CG1 recipients and engrafted tumors were isolated  prepared as single cell suspensions and sorted by flowcytometry. Tumor cells were then processed to isolate RNA which was then submitted for RNAseq analyses Ignatius et al.  2012.,tissue:zebrafish|tp53 /  + TP53 P153△,GSM6595572,GSM6595572: ProDel2 b; Danio rerio; RNA Seq,GSM6595572 r1,GSM6595572,1,post tissue grinding and homogenization in RNA lysis buffer  total RNA was isolated from harvested tumors using the RNAeasy Kit Qiagen; Valencia  CA according to the manufacturer's recommendation. post quantification with Nanodrop Thermo Scientific; Rockford  IL  RNA was stored at  80ºC. Total RNA was used for RNA Seq library preparation by following the KAPA Stranded RNA Seq Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 3000,,SRP398439,,,ProDel2_b_S44_R1.fastq,fastq,2345978580.0,45999580.0,GSM6595572 r1,0:51 1:0,A:552533223;C:559993030;G:552168331;T:680585870;N:698126,51,0,,,552533223,559993030,552168331,680585870,698126,SRX17658777,SRS15191044,SRA1503133,"Population Health Sciences, UT Health Science Center at San Antonio","Population Health Sciences, UT Health Science Center at San Antonio",1,0.92533,,0.088,,0.72894,,0.52635,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,United States,2022-09-21,Multi-stage,Multi-stage,Cancer or Tumor,Cancer or Tumor
71535,SRR21659016,SRX17658776,SRS15191043,SRP398439,PRJNA882818,Defining function of wild type and three patient specific TP53 mutations in a zebrafish model of embryonal rhabdomyosarcoma,GSE213869,Transcriptome Analysis,RNAseq analyses comparing gene expression in zebrafish embryonal rhabdomyosarcoma tumors expressing kRASG12D/tp53 / /GFP or /kRASG12Dtp53 /  + TP53 P153?/GFP Overall design: The RNAseq samples being submitted are of zebrafish  embryonal rhabdomyosarcoma tumors generated in th CG1 syngeneic background expressing kRASG12D/tp53 / /GFP and /kRASG12Dtp53 /  + TP53 P153?/GFP,,pubmed:37266578,,ProDel1 a,GSM6595571,,source name:rhabdomyosarcoma tumors in zebrafish|tissue:zebrafish|geo loc name:missing|collection date:missing,ProDel1 a,Illumina Casava v1.8.2 software used for base calling All RNA seq FastQ reads were aligned with the reference genome danRer11 using TopHat2 default settings. The aligned BAM files sorted SAMTools and then processed using HTSeq count to obtain the counts per gene gene count measurements were obtained using HTSeq count Assembly: danRer11 Supplementary files format and content: The processed data files are in tabular format.  The first column contains the gene symbols and the second column contain the read counts of the gene using htseq count.,rhabdomyosarcoma tumors in zebrafish,,post tissue grinding and homogenization in RNA lysis buffer  total RNA was isolated from harvested tumors using the RNAeasy Kit Qiagen; Valencia  CA according to the manufacturer’s recommendation. post quantification with Nanodrop Thermo Scientific; Rockford  IL  RNA was stored at  80ºC. Total RNA was used for RNA Seq library preparation by following the KAPA Stranded RNA Seq Kit,For expression of mutant human TP53 experiments  tumors were generated by injecting XhoI linearized rag2 kRASG12D and rag2 GFP along with Xmn1 linearized rag2 TP53 P153△  35 ng/ml of rag2 kRASG12D  15 ng/ml rag2 GFP or mutant TP53 and 10 ng/ml of rag2 GFP into the one cell stage of syngeneic zebrafish CG1/tp53 /  embryos <1 hpf Ignatius et al.  2012. Animals were monitored for tumor onset beginning at 10 dpf by scoring for GFP fluorescence under an Olympus MVX10 stereomicroscope with an X Cite series 120Q fluorescence illuminator. Scoring for tumor initiation was conducted for 60 days. 3 tumors each expressing kRASG12D/GFP/tp53 /   or kRASG12D/GFP/tp53 /  +TP53 P153△ were transplanted into secondary CG1 recipients and engrafted tumors were isolated  prepared as single cell suspensions and sorted by flowcytometry. Tumor cells were then processed to isolate RNA which was then submitted for RNAseq analyses Ignatius et al.  2012.,tissue:zebrafish|tp53 /  + TP53 P153△,GSM6595571,GSM6595571: ProDel1 a; Danio rerio; RNA Seq,GSM6595571 r1,GSM6595571,1,post tissue grinding and homogenization in RNA lysis buffer  total RNA was isolated from harvested tumors using the RNAeasy Kit Qiagen; Valencia  CA according to the manufacturer's recommendation. post quantification with Nanodrop Thermo Scientific; Rockford  IL  RNA was stored at  80ºC. Total RNA was used for RNA Seq library preparation by following the KAPA Stranded RNA Seq Kit,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 3000,,SRP398439,,,ProDel1_a_S39_R1.fastq,fastq,1771640397.0,34738047.0,GSM6595571 r1,0:51 1:0,A:416983341;C:417769921;G:421189840;T:515172446;N:524849,51,0,,,416983341,417769921,421189840,515172446,524849,SRX17658776,SRS15191043,SRA1503133,"Population Health Sciences, UT Health Science Center at San Antonio","Population Health Sciences, UT Health Science Center at San Antonio",1,0.91616,,0.08481,,0.70435,,0.51658,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,bulk,bulk,,United States,2022-09-21,Multi-stage,Multi-stage,Cancer or Tumor,Cancer or Tumor