rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
14,DRR334977,DRX323973,DRS217313,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,totalRNA metatranscriptomic sequences from mock communities consist of five model species,rRNA mock community at 28 degrees rep 3,SAMD00422597,,sample name:rRNA mock community 28 degrees rep 3|biological replicate:3|collection date:2021 01 15|dev stage:Adult|technical replicate:3|temp:28|treatment:rRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422597,DRX323973,t28 3 tRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422597,,,,3791170746.0,37701921.0,DRR334977,0:100.56 1:0,A:967477491;C:926887571;G:898697642;T:998107868;N:174,100,0,,,967477491,926887571,898697642,998107868,174,DRX323973,DRS217313,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.31527,,0.06446,,0.88844,,0.62118,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,random_priming,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
15,DRR334976,DRX323972,DRS217312,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,totalRNA metatranscriptomic sequences from mock communities consist of five model species,rRNA mock community at 28 degrees rep 2,SAMD00422596,,sample name:rRNA mock community 28 degrees rep 2|biological replicate:3|collection date:2021 01 15|dev stage:Adult|technical replicate:2|temp:28|treatment:rRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422596,DRX323972,t28 2 tRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422596,,,,2801693695.0,27860658.0,DRR334976,0:100.56 1:0,A:700189496;C:702936549;G:679920984;T:718646067;N:599,100,0,,,700189496,702936549,679920984,718646067,599,DRX323972,DRS217312,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.43508,,0.08819,,0.85859,,0.69447,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,random_priming,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
16,DRR334975,DRX323971,DRS217311,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,totalRNA metatranscriptomic sequences from mock communities consist of five model species,rRNA mock community at 28 degrees rep 1,SAMD00422595,,sample name:rRNA mock community 28 degrees rep 1|biological replicate:3|collection date:2021 01 15|dev stage:Adult|technical replicate:1|temp:28|treatment:rRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422595,DRX323971,t28 1 tRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422595,,,,3148691934.0,31307464.0,DRR334975,0:100.57 1:0,A:785000734;C:791315678;G:766594599;T:805780465;N:458,100,0,,,785000734,791315678,766594599,805780465,458,DRX323971,DRS217311,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.37139,,0.09061,,0.94065,,0.74047,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,random_priming,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
17,DRR334974,DRX323970,DRS217310,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,totalRNA metatranscriptomic sequences from mock communities consist of five model species,rRNA mock community at 19 degrees rep 3,SAMD00422594,,sample name:rRNA mock community 19 degrees rep 3|biological replicate:2|collection date:2021 01 15|dev stage:Adult|technical replicate:3|temp:19|treatment:rRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422594,DRX323970,t19 3 tRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422594,,,,2856186273.0,28400524.0,DRR334974,0:100.57 1:0,A:695685787;C:733754277;G:715270279;T:711475544;N:386,100,0,,,695685787,733754277,715270279,711475544,386,DRX323970,DRS217310,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.48152,,0.10933,,0.87105,,0.7287,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,random_priming,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
18,DRR334973,DRX323969,DRS217309,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,totalRNA metatranscriptomic sequences from mock communities consist of five model species,rRNA mock community at 19 degrees rep 2,SAMD00422593,,sample name:rRNA mock community 19 degrees rep 2|biological replicate:2|collection date:2021 01 15|dev stage:Adult|technical replicate:2|temp:19|treatment:rRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422593,DRX323969,t19 2 tRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422593,,,,3199929804.0,31816971.0,DRR334973,0:100.57 1:0,A:777149590;C:825478743;G:804835148;T:792466124;N:199,100,0,,,777149590,825478743,804835148,792466124,199,DRX323969,DRS217309,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.4418,,0.10282,,0.89706,,0.74667,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,random_priming,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
19,DRR334972,DRX323968,DRS217308,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,totalRNA metatranscriptomic sequences from mock communities consist of five model species,rRNA mock community at 19 degrees rep 1,SAMD00422592,,sample name:rRNA mock community 19 degrees rep 1|biological replicate:2|collection date:2021 01 15|dev stage:Adult|technical replicate:1|temp:19|treatment:rRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422592,DRX323968,t19 1 tRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422592,,,,3658675391.0,36374718.0,DRR334972,0:100.58 1:0,A:879342063;C:954687406;G:929537615;T:895107890;N:417,100,0,,,879342063,954687406,929537615,895107890,417,DRX323968,DRS217308,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.49439,,0.11691,,0.88239,,0.73925,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,random_priming,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
20,DRR334971,DRX323967,DRS217307,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,totalRNA metatranscriptomic sequences from mock communities consist of five model species,rRNA mock community at 10 degrees rep 3,SAMD00422591,,sample name:rRNA mock community 10 degrees rep 3|biological replicate:1|collection date:2021 01 15|dev stage:Adult|technical replicate:3|temp:10|treatment:rRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422591,DRX323967,t10 3 tRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422591,,,,3017524690.0,30006334.0,DRR334971,0:100.56 1:0,A:771967717;C:738814269;G:712866126;T:793876235;N:343,100,0,,,771967717,738814269,712866126,793876235,343,DRX323967,DRS217307,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.33157,,0.07363,,0.9093,,0.73422,,100,,B,,usable mapping rate,illumina,nextseq_v2,unknown,random_priming,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
21,DRR334970,DRX323966,DRS217306,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,totalRNA metatranscriptomic sequences from mock communities consist of five model species,rRNA mock community at 10 degrees rep 2,SAMD00422590,,sample name:rRNA mock community 10 degrees rep 2|biological replicate:1|collection date:2021 01 15|dev stage:Adult|technical replicate:2|temp:10|treatment:rRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422590,DRX323966,t10 2 tRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422590,,,,3115915184.0,30982336.0,DRR334970,0:100.57 1:0,A:765727966;C:794741415;G:771082024;T:784363609;N:170,100,0,,,765727966,794741415,771082024,784363609,170,DRX323966,DRS217306,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.45458,,0.10504,,0.89357,,0.749,,100,,B,,usable mapping rate,illumina,nextseq_v2,unknown,random_priming,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
22,DRR334969,DRX323965,DRS217305,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,totalRNA metatranscriptomic sequences from mock communities consist of five model species,rRNA mock community at 10 degrees rep 1,SAMD00422589,,sample name:rRNA mock community 10 degrees rep 1|biological replicate:1|collection date:2021 01 15|dev stage:Adult|technical replicate:1|temp:10|treatment:rRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422589,DRX323965,t10 1 tRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422589,,,,3206657309.0,31883532.0,DRR334969,0:100.57 1:0,A:792874386;C:814578518;G:787469614;T:811734581;N:210,100,0,,,792874386,814578518,787469614,811734581,210,DRX323965,DRS217305,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.40156,,0.09664,,0.92898,,0.74114,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,random_priming,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
23,DRR334968,DRX323964,DRS217304,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,mRNA metatranscriptomic sequences from mock communities consist of five model species,mRNA mock community at 28 degrees rep 3,SAMD00422588,,sample name:mRNA mock community 28 degrees rep 3|biological replicate:3|collection date:2021 01 15|dev stage:Adult|technical replicate:3|temp:28|treatment:mRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422588,DRX323964,m28 3 mRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422588,,,,3157078356.0,31416275.0,DRR334968,0:100.49 1:0,A:816263259;C:752748024;G:759884392;T:828182261;N:420,100,0,,,816263259,752748024,759884392,828182261,420,DRX323964,DRS217304,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.64888,,0.01832,,0.73996,,0.46811,,99,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
24,DRR334967,DRX323963,DRS217303,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,mRNA metatranscriptomic sequences from mock communities consist of five model species,mRNA mock community at 28 degrees rep 2,SAMD00422587,,sample name:mRNA mock community 28 degrees rep 2|biological replicate:3|collection date:2021 01 15|dev stage:Adult|technical replicate:2|temp:28|treatment:mRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422587,DRX323963,m28 2 mRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422587,,,,3155807651.0,31404635.0,DRR334967,0:100.49 1:0,A:819014350;C:749873295;G:756284406;T:830635394;N:206,100,0,,,819014350,749873295,756284406,830635394,206,DRX323963,DRS217303,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.76742,,0.02238,,0.72427,,0.47376,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
25,DRR334966,DRX323962,DRS217302,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,mRNA metatranscriptomic sequences from mock communities consist of five model species,mRNA mock community at 28 degrees rep 1,SAMD00422586,,sample name:mRNA mock community 28 degrees rep 1|biological replicate:3|collection date:2021 01 15|dev stage:Adult|technical replicate:1|temp:28|treatment:mRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422586,DRX323962,m28 1 mRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422586,,,,2589772286.0,25765782.0,DRR334966,0:100.51 1:0,A:679223577;C:610675892;G:617869465;T:682003195;N:157,100,0,,,679223577,610675892,617869465,682003195,157,DRX323962,DRS217302,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.42984,,0.03367,,0.73555,,0.49223,,100,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
26,DRR334965,DRX323961,DRS217318,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,mRNA metatranscriptomic sequences from mock communities consist of five model species,mRNA mock community at 19 degrees rep 3,SAMD00422602,,sample name:mRNA mock community 19 degrees rep 3|biological replicate:2|collection date:2021 01 15|dev stage:Adult|technical replicate:3|temp:19|treatment:mRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422602,DRX323961,m19 3 mRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422602,,,,3124746628.0,31095367.0,DRR334965,0:100.49 1:0,A:821891547;C:734660854;G:739230475;T:828963220;N:532,100,0,,,821891547,734660854,739230475,828963220,532,DRX323961,DRS217318,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.72881,,0.03264,,0.69449,,0.47416,,99,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
27,DRR334964,DRX323960,DRS217317,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,mRNA metatranscriptomic sequences from mock communities consist of five model species,mRNA mock community at 19 degrees rep 2,SAMD00422601,,sample name:mRNA mock community 19 degrees rep 2|biological replicate:2|collection date:2021 01 15|dev stage:Adult|technical replicate:2|temp:19|treatment:mRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422601,DRX323960,m19 2 mRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422601,,,,3171661466.0,31561473.0,DRR334964,0:100.49 1:0,A:836793307;C:742872021;G:750053514;T:841942389;N:235,100,0,,,836793307,742872021,750053514,841942389,235,DRX323960,DRS217317,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.63153,,0.03639,,0.69027,,0.48494,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
28,DRR334963,DRX323959,DRS217316,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,mRNA metatranscriptomic sequences from mock communities consist of five model species,mRNA mock community at 19 degrees rep 1,SAMD00422600,,sample name:mRNA mock community 19 degrees rep 1|biological replicate:2|collection date:2021 01 15|dev stage:Adult|technical replicate:1|temp:19|treatment:mRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422600,DRX323959,m19 1 mRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422600,,,,2916453082.0,29023768.0,DRR334963,0:100.48 1:0,A:761416880;C:692014182;G:696272089;T:766749729;N:202,100,0,,,761416880,692014182,696272089,766749729,202,DRX323959,DRS217316,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.71651,,0.03406,,0.68696,,0.47496,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
29,DRR334962,DRX323958,DRS217315,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,mRNA metatranscriptomic sequences from mock communities consist of five model species,mRNA mock community at 10 degrees rep 3,SAMD00422599,,sample name:mRNA mock community 10 degrees rep 3|biological replicate:1|collection date:2021 01 15|dev stage:Adult|technical replicate:3|temp:10|treatment:mRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422599,DRX323958,m10 3 mRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422599,,,,2600103192.0,25872833.0,DRR334962,0:100.50 1:0,A:668944597;C:625686885;G:631010166;T:674461210;N:334,100,0,,,668944597,625686885,631010166,674461210,334,DRX323958,DRS217315,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.57077,,0.02949,,0.71918,,0.47633,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
30,DRR334961,DRX323957,DRS217314,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,mRNA metatranscriptomic sequences from mock communities consist of five model species,mRNA mock community at 10 degrees rep 2,SAMD00422598,,sample name:mRNA mock community 10 degrees rep 2|biological replicate:1|collection date:2021 01 15|dev stage:Adult|technical replicate:2|temp:10|treatment:mRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422598,DRX323957,m10 2 mRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422598,,,,2608660833.0,25958804.0,DRR334961,0:100.49 1:0,A:683370128;C:615324906;G:621209484;T:688756167;N:148,100,0,,,683370128,615324906,621209484,688756167,148,DRX323957,DRS217314,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.63764,,0.04316,,0.69656,,0.48579,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
31,DRR334960,DRX323956,DRS217301,DRP008001,PRJDB12578,Allometric scaling of RNA abundance from genes to communities,DRP008001,Other,The metabolic theory of ecology MTE and growth rate hypothesis GRH help explain the mechanistic basis of size allometry and temperature dependence on growth rate and whole body RNA content in organisms. However testing RNA allometric scaling with next generation sequencing is yet to be done. Here we validated the assumptions of GRH and MTE on messenger RNA and ribosome abundance using mock community metatranscriptome analysis. Our findings highlight that fast growing smaller species harbor greater RNA abundance per mass of tissue compared with species having larger body sizes and slower growth rates. We found that genome size and body size impose significant constraints in interspecific RNA abundance scaling while the assumed temperature dependence appeared to be weak. Lastly allometric scaling integration in community level models may extend the use of metatranscriptomics as a reliable tool for estimating ecosystem processes.,,,mRNA metatranscriptomic sequences from mock communities consist of five model species,mRNA mock community at 10 degrees rep 1,SAMD00422585,,sample name:mRNA mock community 10 degrees rep 1|biological replicate:1|collection date:2021 01 15|dev stage:Adult|technical replicate:1|temp:10|treatment:mRNA,,,,,,,,,NextSeq 2000 sequencing of SAMD00422585,DRX323956,m10 1 mRNA.fastq,1,NEBNext Kit for Illumina,,RNA-Seq,METATRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 2000,1010Application ReadForward1,DRP008001,NextSeq 2000 sequencing of SAMD00422585,,,,2879915507.0,28651533.0,DRR334960,0:100.52 1:0,A:761972464;C:675761096;G:678969165;T:763212637;N:145,100,0,,,761972464,675761096,678969165,763212637,145,DRX323956,DRS217301,DRA013226,"SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica","SINICA|Machida Laboratory Biodiversity Research Center, Academia Sinica",1,0.47851,,0.05671,,0.72622,,0.49269,,101,,B,,usable mapping rate,illumina,nextseq_v2,unknown,poly_a,nebnext,bulk,unknown,unknown,,Taiwan,2021-12-23,Adult,Adult,Undetermined,Undetermined
25162,SRR25655085,SRX21381122,SRS18622091,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 8 AU1038 STRSS4,GSM7712891,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 8 AU1038 STRSS4,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712891,GSM7712891: Sample 8 AU1038 STRSS4; Danio rerio; ncRNA Seq,GSM7712891 r1,GSM7712891,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS04_10932AAD_TGTCCTAC-ACATGAGT_R1_001.fastq.gz,fastq,641236400.0,12824728.0,GSM7712891 r1,0:50,A:183546979;C:159774155;G:156033079;T:141881902;N:285,50,,,,183546979,159774155,156033079,141881902,285,SRX21381122,SRS18622091,SRA1693666,CNAG,CNAG,1,0.4736,,0.03992,,0.96788,,0.87662,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25163,SRR25655086,SRX21381121,SRS18622090,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 7 AU1037 STRSS3,GSM7712890,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 7 AU1037 STRSS3,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712890,GSM7712890: Sample 7 AU1037 STRSS3; Danio rerio; ncRNA Seq,GSM7712890 r1,GSM7712890,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS03_10931AAD_GCACGATT-CGTCTGCA_R1_001.fastq.gz,fastq,434646850.0,8692937.0,GSM7712890 r1,0:50,A:126760670;C:102577685;G:109591447;T:95716876;N:172,50,,,,126760670,102577685,109591447,95716876,172,SRX21381121,SRS18622090,SRA1693666,CNAG,CNAG,1,0.52132,,0.04615,,0.96477,,0.85481,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25164,SRR25655087,SRX21381120,SRS18622089,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 6 AU1036 STRSS2,GSM7712889,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 6 AU1036 STRSS2,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712889,GSM7712889: Sample 6 AU1036 STRSS2; Danio rerio; ncRNA Seq,GSM7712889 r1,GSM7712889,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS02_10930AAD_ATGAAGCG-GCGGACAG_R1_001.fastq.gz,fastq,907610650.0,18152213.0,GSM7712889 r1,0:50,A:271494673;C:215304417;G:220608756;T:200202267;N:537,50,,,,271494673,215304417,220608756,200202267,537,SRX21381120,SRS18622089,SRA1693666,CNAG,CNAG,1,0.44189,,0.03477,,0.97335,,0.88092,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25165,SRR25655088,SRX21381119,SRS18622088,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 5 AU1035 STRSS1,GSM7712888,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 5 AU1035 STRSS1,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712888,GSM7712888: Sample 5 AU1035 STRSS1; Danio rerio; ncRNA Seq,GSM7712888 r1,GSM7712888,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS01_10929AAD_CACTTCGA-TAGGCTTC_R1_001.fastq.gz,fastq,711276100.0,14225522.0,GSM7712888 r1,0:50,A:207284968;C:173540770;G:172961619;T:157488473;N:270,50,,,,207284968,173540770,172961619,157488473,270,SRX21381119,SRS18622088,SRA1693666,CNAG,CNAG,1,0.47865,,0.03881,,0.97001,,0.87616,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25166,SRR25655089,SRX21381118,SRS18622087,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 4 AU1028 CTRL4,GSM7712887,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 4 AU1028 CTRL4,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712887,GSM7712887: Sample 4 AU1028 CTRL4; Danio rerio; ncRNA Seq,GSM7712887 r1,GSM7712887,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL04_10928AAD_GACTAGGC-GCCTCGAC_R1_001.fastq.gz,fastq,568037350.0,11360747.0,GSM7712887 r1,0:50,A:165826590;C:133109854;G:141956673;T:127143732;N:501,50,,,,165826590,133109854,141956673,127143732,501,SRX21381118,SRS18622087,SRA1693666,CNAG,CNAG,1,0.48051,,0.0347,,0.97268,,0.87465,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25167,SRR25655090,SRX21381117,SRS18622086,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 3 AU1027 CTRL3,GSM7712886,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 3 AU1027 CTRL3,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712886,GSM7712886: Sample 3 AU1027 CTRL3; Danio rerio; ncRNA Seq,GSM7712886 r1,GSM7712886,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL03_10927AAD_AGTATACT-CGAATCGG_R1_001.fastq.gz,fastq,651469300.0,13029386.0,GSM7712886 r1,0:50,A:191788726;C:154951271;G:161329211;T:143399936;N:156,50,,,,191788726,154951271,161329211,143399936,156,SRX21381117,SRS18622086,SRA1693666,CNAG,CNAG,1,0.45412,,0.04073,,0.96934,,0.88507,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25168,SRR25655091,SRX21381116,SRS18622085,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 2 AU1026 CTRL2,GSM7712885,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 2 AU1026 CTRL2,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712885,GSM7712885: Sample 2 AU1026 CTRL2; Danio rerio; ncRNA Seq,GSM7712885 r1,GSM7712885,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL02_10926AAD_CCGCGTAG-TTCTGATT_R1_001.fastq.gz,fastq,754615100.0,15092302.0,GSM7712885 r1,0:50,A:217013981;C:184328493;G:188964773;T:164307508;N:345,50,,,,217013981,184328493,188964773,164307508,345,SRX21381116,SRS18622085,SRA1693666,CNAG,CNAG,1,0.48926,,0.04654,,0.96418,,0.8889,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25169,SRR25655092,SRX21381115,SRS18622084,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 1 AU1024 CTRL1,GSM7712884,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 1 AU1024 CTRL1,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712884,GSM7712884: Sample 1 AU1024 CTRL1; Danio rerio; ncRNA Seq,GSM7712884 r1,GSM7712884,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL01_10925AAD_TTAGCCTA-AATCATCA_R1_001.fastq.gz,fastq,670580700.0,13411614.0,GSM7712884 r1,0:50,A:194653643;C:158916446;G:165941477;T:151068917;N:217,50,,,,194653643,158916446,165941477,151068917,217,SRX21381115,SRS18622084,SRA1693666,CNAG,CNAG,1,0.47093,,0.03457,,0.97187,,0.8867,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
30658,SRR28054753,SRX23704452,SRS20534448,SRP491086,PRJNA1078753,Integrated mRNA and miRNA sequencing analyses unveil the underlying mechanism of tobacco pollutant induced developmental toxicity in zebrafish embryos,PRJNA1078753,Other,Tobacco pollutants are prevalent in the environment leading to inadvertent exposure of pregnant females. Studies of these pollutants' toxic effects on development have not fully elucidated the potential underlying mechanisms. Therefore in this study we aim at investigate the developmental toxicity induced by cigarette smoke extract CSE at concentrations of 0.25% 1% and 2.5% using a zebrafish embryo toxicity test and integrated transcriptomic analysis of microRNA miRNA and messenger RNA mRNA. The findings revealed that CSE caused developmental toxicity including increased mortality and decreased incubation rate in a dose dependent manner. Moreover CSE induced malformations and apoptosis specifically in the head and heart of zebrafish larvae. We used mRNA and miRNA sequencing analyses to compare changes in the expression of genes and miRNAs in zebrafish larvae. The bioinformatics analysis indicates that the mechanism underlying CSE induced developmental toxicity was associated with genetic repair impairment apoptosis disorder and lipid metabolism disturbance. The enrichment analysis and RT qPCR show that the ctsba gene plays a crucial function in embryo developmental apoptosis and the fads2 gene mainly regulates lipid metabolic toxicity. The results of this study improve the understanding of CSE induced developmental toxicity in zebrafish embryos and contribute insights into the formulation of novel preventive strategies against tobacco pollutants during early embryonic development.,,,,,S21K1230,,library ID:H 3|title:High 3|library strategy:OTHER|library source:METATRANSCRIPTIOMIC|library selection:other|library layout:paired|platform:ILLUMINA|instrument model:RNA seq|filetype:fastq|filename:S21K1230 rep1 1 URNA S74 L003 R1 001.fastq|filename2:S21K1230 rep1 1 URNA S74 L003 R2 001.fastq|host:missing|isolation source:missing|collection date:missing|geographic location:missing|latitude and longitude:missing|age:missing|breed:missing|cultivar:missing|dev stage:missing|ecotype:missing|isolate:missing|sex:missing|strain:missing|tissue:missing|BioSampleModel:Model organism or animal,,,,,,,,,High 3,H 3,H 3,missing,,,RNA-Seq,METATRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP491086,,,S21K1230_rep1_1_URNA_S74_L003_R1_001.fastq.gz S21K1230_rep1_1_URNA_S74_L003_R2_001.fastq.gz,fastq fastq,6117817800.0,20392726.0,S21K1230 rep1 1 URNA S74 L003 R1 001.fastq.gz,0:150 1:150,A:1635728688;C:1405168032;G:1464072107;T:1612834762;N:14211,150,150,,,1635728688,1405168032,1464072107,1612834762,14211,SRX23704452,SRS20534448,SRA1806456,The Second Affiliated Hospital of Shantou University Medical College|Department of Burns and Plastic Surgery,The Second Affiliated Hospital of Shantou University Medical College,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,China,2024-02-22,Undetermined,Multi-stage,Undetermined,Undetermined
34282,SRR31640757,SRX27004210,SRS23468967,SRP550004,PRJNA1195374,Cortex Dictamni induces retinitis pigmentosa in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2,PRJNA1195374,Other,Ethnopharmacological relevance: Cortex Dictamni CD is the dried root skin of Dictamnus dasycarpus Turcz widely used in the field of traditional Chinese medicine. mainly for the treatment of skin diseases. Recent adverse reactions to CD limited the clinical application in combination with other traditional Chinese medicines.Aim of the study: To investigate the retinitis pigmentosa RP effects of CD using the zebrafish model and elucidate the underlying molecular mechanism of CD induced RP in zebrafish.Materials and methods: The 3 dpf zebrafish larvae were divided into control and CD group. RNA sequencing followed with qRT PCR validating miRNAs and mRNAs. Dual luciferase reporter assay confirmed mmu mir 6240 p3 2's interaction with pde6a. HT22 cells were transfected treated with CD and evaluated for migration invasion malondialdehyde level superoxide dismutase and acetylcholine activities.Results: The results showed 6228 differentially expressed genes and 66 miRNAs differentially expressed in zebrafish exposed to CD. The personal correlation coefficient results showed that mmu mir 6240 p3 2 had the highest correlation coefficient with pde6a and had a negative regulatory relationship. The results of dual luciferase reporter gene further showed that pde6a gene was the direct target of mmu mir 6240 p3 2. Cell experiment results showed that inhibiting mir 6240 p3 2 can upregulate pde6a expression alleviate HT22 cell injury and reverse the inhibition of cell migration and invasion induced by CD.Conclusions: CD induces RP in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2. These findings have important implications for understanding the potential side effects of CD and for developing safer therapeutic strategies involving traditional Chinese medicines.,,,,,CD1,,strain:not applicable|isolate:not applicable|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|collection date:not applicable|geo loc name:not applicable|sex:not applicable|tissue:not applicable|treatment:Experiment group replicate1|BioSampleModel:Model organism or animal,,,,,,,,,microRNA seq of Danio rerio: Experiment group,BXP 1,BXP 1,,,,miRNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP550004,,,BXP_1.fq.gz,fastq,816499035.0,16009785.0,BXP 1.fq.gz,0:51,A:191280900;C:189440771;G:247005615;T:188686493;N:85256,51,,,,191280900,189440771,247005615,188686493,85256,SRX27004210,SRS23468967,SRA2029520,Heilongjiang University of Chinese Medicine|College of Traditional Chinese Medicine,Heilongjiang University of Chinese Medicine,,,,,,,,,,,,T,,under 1.2% mapping rate,illumina,novaseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2024-12-07,Undetermined,Larval,Undetermined,Undetermined
34283,SRR31640758,SRX27004209,SRS23468966,SRP550004,PRJNA1195374,Cortex Dictamni induces retinitis pigmentosa in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2,PRJNA1195374,Other,Ethnopharmacological relevance: Cortex Dictamni CD is the dried root skin of Dictamnus dasycarpus Turcz widely used in the field of traditional Chinese medicine. mainly for the treatment of skin diseases. Recent adverse reactions to CD limited the clinical application in combination with other traditional Chinese medicines.Aim of the study: To investigate the retinitis pigmentosa RP effects of CD using the zebrafish model and elucidate the underlying molecular mechanism of CD induced RP in zebrafish.Materials and methods: The 3 dpf zebrafish larvae were divided into control and CD group. RNA sequencing followed with qRT PCR validating miRNAs and mRNAs. Dual luciferase reporter assay confirmed mmu mir 6240 p3 2's interaction with pde6a. HT22 cells were transfected treated with CD and evaluated for migration invasion malondialdehyde level superoxide dismutase and acetylcholine activities.Results: The results showed 6228 differentially expressed genes and 66 miRNAs differentially expressed in zebrafish exposed to CD. The personal correlation coefficient results showed that mmu mir 6240 p3 2 had the highest correlation coefficient with pde6a and had a negative regulatory relationship. The results of dual luciferase reporter gene further showed that pde6a gene was the direct target of mmu mir 6240 p3 2. Cell experiment results showed that inhibiting mir 6240 p3 2 can upregulate pde6a expression alleviate HT22 cell injury and reverse the inhibition of cell migration and invasion induced by CD.Conclusions: CD induces RP in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2. These findings have important implications for understanding the potential side effects of CD and for developing safer therapeutic strategies involving traditional Chinese medicines.,,,,,Control3,,strain:not applicable|isolate:not applicable|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|collection date:not applicable|geo loc name:not applicable|sex:not applicable|tissue:not applicable|treatment:Control group replicate3|BioSampleModel:Model organism or animal,,,,,,,,,microRNA seq of Danio rerio: Control group,Control 3,Control 3,,,,miRNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP550004,,,Control_3.fq.gz,fastq,662560023.0,12991373.0,Control 3.fq.gz,0:51,A:151053320;C:152811933;G:203340354;T:155283230;N:71186,51,,,,151053320,152811933,203340354,155283230,71186,SRX27004209,SRS23468966,SRA2029520,Heilongjiang University of Chinese Medicine|College of Traditional Chinese Medicine,Heilongjiang University of Chinese Medicine,,,,,,,,,,,,T,,under 1.2% mapping rate,illumina,novaseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2024-12-07,Undetermined,Larval,Undetermined,Undetermined
34284,SRR31640759,SRX27004208,SRS23468963,SRP550004,PRJNA1195374,Cortex Dictamni induces retinitis pigmentosa in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2,PRJNA1195374,Other,Ethnopharmacological relevance: Cortex Dictamni CD is the dried root skin of Dictamnus dasycarpus Turcz widely used in the field of traditional Chinese medicine. mainly for the treatment of skin diseases. Recent adverse reactions to CD limited the clinical application in combination with other traditional Chinese medicines.Aim of the study: To investigate the retinitis pigmentosa RP effects of CD using the zebrafish model and elucidate the underlying molecular mechanism of CD induced RP in zebrafish.Materials and methods: The 3 dpf zebrafish larvae were divided into control and CD group. RNA sequencing followed with qRT PCR validating miRNAs and mRNAs. Dual luciferase reporter assay confirmed mmu mir 6240 p3 2's interaction with pde6a. HT22 cells were transfected treated with CD and evaluated for migration invasion malondialdehyde level superoxide dismutase and acetylcholine activities.Results: The results showed 6228 differentially expressed genes and 66 miRNAs differentially expressed in zebrafish exposed to CD. The personal correlation coefficient results showed that mmu mir 6240 p3 2 had the highest correlation coefficient with pde6a and had a negative regulatory relationship. The results of dual luciferase reporter gene further showed that pde6a gene was the direct target of mmu mir 6240 p3 2. Cell experiment results showed that inhibiting mir 6240 p3 2 can upregulate pde6a expression alleviate HT22 cell injury and reverse the inhibition of cell migration and invasion induced by CD.Conclusions: CD induces RP in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2. These findings have important implications for understanding the potential side effects of CD and for developing safer therapeutic strategies involving traditional Chinese medicines.,,,,,Control2,,strain:not applicable|isolate:not applicable|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|collection date:not applicable|geo loc name:not applicable|sex:not applicable|tissue:not applicable|treatment:Control group replicate2|BioSampleModel:Model organism or animal,,,,,,,,,microRNA seq of Danio rerio: Control group,Control 2,Control 2,,,,miRNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP550004,,,Control_2.fq.gz,fastq,648856119.0,12722669.0,Control 2.fq.gz,0:51,A:149869576;C:151844056;G:195830503;T:151241215;N:70769,51,,,,149869576,151844056,195830503,151241215,70769,SRX27004208,SRS23468963,SRA2029520,Heilongjiang University of Chinese Medicine|College of Traditional Chinese Medicine,Heilongjiang University of Chinese Medicine,,,,,,,,,,,,T,,under 1.2% mapping rate,illumina,novaseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2024-12-07,Undetermined,Larval,Undetermined,Undetermined
34285,SRR31640760,SRX27004207,SRS23468962,SRP550004,PRJNA1195374,Cortex Dictamni induces retinitis pigmentosa in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2,PRJNA1195374,Other,Ethnopharmacological relevance: Cortex Dictamni CD is the dried root skin of Dictamnus dasycarpus Turcz widely used in the field of traditional Chinese medicine. mainly for the treatment of skin diseases. Recent adverse reactions to CD limited the clinical application in combination with other traditional Chinese medicines.Aim of the study: To investigate the retinitis pigmentosa RP effects of CD using the zebrafish model and elucidate the underlying molecular mechanism of CD induced RP in zebrafish.Materials and methods: The 3 dpf zebrafish larvae were divided into control and CD group. RNA sequencing followed with qRT PCR validating miRNAs and mRNAs. Dual luciferase reporter assay confirmed mmu mir 6240 p3 2's interaction with pde6a. HT22 cells were transfected treated with CD and evaluated for migration invasion malondialdehyde level superoxide dismutase and acetylcholine activities.Results: The results showed 6228 differentially expressed genes and 66 miRNAs differentially expressed in zebrafish exposed to CD. The personal correlation coefficient results showed that mmu mir 6240 p3 2 had the highest correlation coefficient with pde6a and had a negative regulatory relationship. The results of dual luciferase reporter gene further showed that pde6a gene was the direct target of mmu mir 6240 p3 2. Cell experiment results showed that inhibiting mir 6240 p3 2 can upregulate pde6a expression alleviate HT22 cell injury and reverse the inhibition of cell migration and invasion induced by CD.Conclusions: CD induces RP in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2. These findings have important implications for understanding the potential side effects of CD and for developing safer therapeutic strategies involving traditional Chinese medicines.,,,,,Control1,,strain:not applicable|isolate:not applicable|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|collection date:not applicable|geo loc name:not applicable|sex:not applicable|tissue:not applicable|treatment:Control group replicate1|BioSampleModel:Model organism or animal,,,,,,,,,microRNA seq of Danio rerio: Control group,Control 1,Control 1,,,,miRNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP550004,,,Control_1.fq.gz,fastq,835887501.0,16389951.0,Control 1.fq.gz,0:51,A:193253330;C:196900031;G:252690178;T:192797500;N:246462,51,,,,193253330,196900031,252690178,192797500,246462,SRX27004207,SRS23468962,SRA2029520,Heilongjiang University of Chinese Medicine|College of Traditional Chinese Medicine,Heilongjiang University of Chinese Medicine,,,,,,,,,,,,T,,under 1.2% mapping rate,illumina,novaseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2024-12-07,Undetermined,Larval,Undetermined,Undetermined
34290,SRR31640765,SRX27004202,SRS23468965,SRP550004,PRJNA1195374,Cortex Dictamni induces retinitis pigmentosa in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2,PRJNA1195374,Other,Ethnopharmacological relevance: Cortex Dictamni CD is the dried root skin of Dictamnus dasycarpus Turcz widely used in the field of traditional Chinese medicine. mainly for the treatment of skin diseases. Recent adverse reactions to CD limited the clinical application in combination with other traditional Chinese medicines.Aim of the study: To investigate the retinitis pigmentosa RP effects of CD using the zebrafish model and elucidate the underlying molecular mechanism of CD induced RP in zebrafish.Materials and methods: The 3 dpf zebrafish larvae were divided into control and CD group. RNA sequencing followed with qRT PCR validating miRNAs and mRNAs. Dual luciferase reporter assay confirmed mmu mir 6240 p3 2's interaction with pde6a. HT22 cells were transfected treated with CD and evaluated for migration invasion malondialdehyde level superoxide dismutase and acetylcholine activities.Results: The results showed 6228 differentially expressed genes and 66 miRNAs differentially expressed in zebrafish exposed to CD. The personal correlation coefficient results showed that mmu mir 6240 p3 2 had the highest correlation coefficient with pde6a and had a negative regulatory relationship. The results of dual luciferase reporter gene further showed that pde6a gene was the direct target of mmu mir 6240 p3 2. Cell experiment results showed that inhibiting mir 6240 p3 2 can upregulate pde6a expression alleviate HT22 cell injury and reverse the inhibition of cell migration and invasion induced by CD.Conclusions: CD induces RP in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2. These findings have important implications for understanding the potential side effects of CD and for developing safer therapeutic strategies involving traditional Chinese medicines.,,,,,CD3,,strain:not applicable|isolate:not applicable|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|collection date:not applicable|geo loc name:not applicable|sex:not applicable|tissue:not applicable|treatment:Experiment group replicate3|BioSampleModel:Model organism or animal,,,,,,,,,microRNA seq of Danio rerio: Experiment group,BXP 3,BXP 3,,,,miRNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP550004,,,BXP_3.fq.gz,fastq,656139327.0,12865477.0,BXP 3.fq.gz,0:51,A:152349522;C:156353407;G:196379918;T:150985088;N:71392,51,,,,152349522,156353407,196379918,150985088,71392,SRX27004202,SRS23468965,SRA2029520,Heilongjiang University of Chinese Medicine|College of Traditional Chinese Medicine,Heilongjiang University of Chinese Medicine,,,,,,,,,,,,T,,under 1.2% mapping rate,illumina,novaseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2024-12-07,Undetermined,Larval,Undetermined,Undetermined
34291,SRR31640766,SRX27004201,SRS23468964,SRP550004,PRJNA1195374,Cortex Dictamni induces retinitis pigmentosa in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2,PRJNA1195374,Other,Ethnopharmacological relevance: Cortex Dictamni CD is the dried root skin of Dictamnus dasycarpus Turcz widely used in the field of traditional Chinese medicine. mainly for the treatment of skin diseases. Recent adverse reactions to CD limited the clinical application in combination with other traditional Chinese medicines.Aim of the study: To investigate the retinitis pigmentosa RP effects of CD using the zebrafish model and elucidate the underlying molecular mechanism of CD induced RP in zebrafish.Materials and methods: The 3 dpf zebrafish larvae were divided into control and CD group. RNA sequencing followed with qRT PCR validating miRNAs and mRNAs. Dual luciferase reporter assay confirmed mmu mir 6240 p3 2's interaction with pde6a. HT22 cells were transfected treated with CD and evaluated for migration invasion malondialdehyde level superoxide dismutase and acetylcholine activities.Results: The results showed 6228 differentially expressed genes and 66 miRNAs differentially expressed in zebrafish exposed to CD. The personal correlation coefficient results showed that mmu mir 6240 p3 2 had the highest correlation coefficient with pde6a and had a negative regulatory relationship. The results of dual luciferase reporter gene further showed that pde6a gene was the direct target of mmu mir 6240 p3 2. Cell experiment results showed that inhibiting mir 6240 p3 2 can upregulate pde6a expression alleviate HT22 cell injury and reverse the inhibition of cell migration and invasion induced by CD.Conclusions: CD induces RP in zebrafish by inhibiting pde6a post transcriptional activity via mmu mir 6240 p3 2. These findings have important implications for understanding the potential side effects of CD and for developing safer therapeutic strategies involving traditional Chinese medicines.,,,,,CD2,,strain:not applicable|isolate:not applicable|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|collection date:not applicable|geo loc name:not applicable|sex:not applicable|tissue:not applicable|treatment:Experiment group replicate2|BioSampleModel:Model organism or animal,,,,,,,,,microRNA seq of Danio rerio: Experiment group,BXP 2,BXP 2,,,,miRNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP550004,,,BXP_2.fq.gz,fastq,644434827.0,12635977.0,BXP 2.fq.gz,0:51,A:151820167;C:153674905;G:190467723;T:148402934;N:69098,51,,,,151820167,153674905,190467723,148402934,69098,SRX27004201,SRS23468964,SRA2029520,Heilongjiang University of Chinese Medicine|College of Traditional Chinese Medicine,Heilongjiang University of Chinese Medicine,,,,,,,,,,,,T,,under 1.2% mapping rate,illumina,novaseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2024-12-07,Undetermined,Larval,Undetermined,Undetermined
36504,SRR535848,SRX174964,SRS352998,SRP014772,PRJNA172016,Danio rerio strain:*AB Variation,PRJNA172016,Other,Forward genetic screens have elucidated molecular pathways required for innumerable aspects of life however identifying the causal mutations from such screens has long been the bottleneck in the process particularly in vertebrates. We have developed an RNA Seq based approach that identifies both the region of the genome linked to a mutation and candidate lesions that may be causal for the phenotype of interest. We show that our method successfully identifies zebrafish mutations that cause nonsense or missense changes to codons alter transcript splicing or alter gene expression levels. Furthermore we develop an online accessible or downloadable bioinformatics pipeline allowing for easy implementation of all steps of the method. Overall we show that RNA Seq is a fast reliable and cost effective method to map and identify mutations that will greatly facilitate the power of forward genetics in vertebrate models.,,,RNA seq data from Miller et al submitted. Data was generated in order to map ENU induced mutations in zebrafish. This data hox20 was created from 20 pooled hoxb1bb1219 fish that were the siblings of wt20.,Miller hox20.bam,Miller hox20.bam,,,,,,,,,,,Miller hox20.bam,Miller hox20.bam,1,50 bp Paired End,,,RNA-Seq,TRANSCRIPTOMIC,RT-PCR,SINGLE,ILLUMINA,Illumina HiSeq 2000,1800Application ReadForward1,SRP014772,,,hox20.bam,bam,2051648571.0,22151528.0,Miller hox20.bam,0:49 1:49,A:528770281;C:501621137;G:487051170;T:534176088;N:29895,49,49,,,528770281,501621137,487051170,534176088,29895,SRX174964,SRS352998,SRA056859,Fred Hutchinson Cancer Research Center|Moens,Fred Hutchinson Cancer Research Center,2,0.9629,0.96282,0.07314,0.07288,0.6714,0.67125,0.4665,0.4637,49,49,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2012-11-30,Undetermined,Undetermined,Undetermined,Undetermined
37961,SRR1205174,SRX501301,SRS582373,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl neo 5hr 3,GSM1357182,,tissue:GFP negative cells from 5 dpf larvae|drug:neomycin|time:5hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,cntl neo 5hr 3,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:5hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,GSM1357182,GSM1357182: cntl neo 5hr 3; Danio rerio; RNA Seq,GSM1357182,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357182,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_neo_5_3.fastq.gz,fastq,1630216750.0,32604335.0,GSM1357182 r1,0:50 1:0,A:435441738;C:384703554;G:377838654;T:432163463;N:69341,50,0,,,435441738,384703554,377838654,432163463,69341,SRX501301,SRS582373,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93632,,0.20492,,0.67551,,0.50281,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37962,SRR1205173,SRX501300,SRS582372,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl neo 5hr 2,GSM1357181,,tissue:GFP negative cells from 5 dpf larvae|drug:neomycin|time:5hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,cntl neo 5hr 2,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:5hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,GSM1357181,GSM1357181: cntl neo 5hr 2; Danio rerio; RNA Seq,GSM1357181,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357181,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_neo_5_2.fastq.gz,fastq,1812797550.0,36255951.0,GSM1357181 r1,0:50 1:0,A:484800524;C:426109547;G:417833682;T:483968870;N:84927,50,0,,,484800524,426109547,417833682,483968870,84927,SRX501300,SRS582372,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93602,,0.21513,,0.67517,,0.49404,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37963,SRR1205172,SRX501299,SRS582371,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl neo 5hr 1,GSM1357180,,tissue:GFP negative cells from 5 dpf larvae|drug:neomycin|time:5hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,cntl neo 5hr 1,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:5hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,GSM1357180,GSM1357180: cntl neo 5hr 1; Danio rerio; RNA Seq,GSM1357180,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357180,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_neo_5_1.fastq.gz,fastq,1616736500.0,32334730.0,GSM1357180 r1,0:50 1:0,A:425328931;C:388105733;G:379129548;T:424100489;N:71799,50,0,,,425328931,388105733,379129548,424100489,71799,SRX501299,SRS582371,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.9361,,0.23516,,0.68091,,0.50961,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37964,SRR1205171,SRX501298,SRS582370,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp neo 5hr 3,GSM1357179,,tissue:GFP positive cells from 5 dpf larvae|drug:neomycin|time:5hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,gfp neo 5hr 3,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:5hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,GSM1357179,GSM1357179: gfp neo 5hr 3; Danio rerio; RNA Seq,GSM1357179,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357179,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_neo_5_3.fastq.gz,fastq,1856512100.0,37130242.0,GSM1357179 r1,0:50 1:0,A:492227117;C:440944515;G:431529818;T:491731276;N:79374,50,0,,,492227117,440944515,431529818,491731276,79374,SRX501298,SRS582370,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93677,,0.28732,,0.71435,,0.50496,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37965,SRR1205170,SRX501297,SRS582369,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp neo 5hr 2,GSM1357178,,tissue:GFP positive cells from 5 dpf larvae|drug:neomycin|time:5hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,gfp neo 5hr 2,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:5hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,GSM1357178,GSM1357178: gfp neo 5hr 2; Danio rerio; RNA Seq,GSM1357178,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357178,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_neo_5_2.fastq.gz,fastq,1605154400.0,32103088.0,GSM1357178 r1,0:50 1:0,A:431076570;C:373656204;G:367046732;T:433299718;N:75176,50,0,,,431076570,373656204,367046732,433299718,75176,SRX501297,SRS582369,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93022,,0.29198,,0.69656,,0.47675,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37966,SRR1205169,SRX501296,SRS582368,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp neo 5hr 1,GSM1357177,,tissue:GFP positive cells from 5 dpf larvae|drug:neomycin|time:5hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,gfp neo 5hr 1,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:5hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,GSM1357177,GSM1357177: gfp neo 5hr 1; Danio rerio; RNA Seq,GSM1357177,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357177,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_neo_5_1.fastq.gz,fastq,1902899900.0,38057998.0,GSM1357177 r1,0:50 1:0,A:511489376;C:443148505;G:433716076;T:514461324;N:84619,50,0,,,511489376,443148505,433716076,514461324,84619,SRX501296,SRS582368,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.92977,,0.29647,,0.69583,,0.48582,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37967,SRR1205168,SRX501295,SRS582367,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl neo 3hr 3,GSM1357176,,tissue:GFP negative cells from 5 dpf larvae|drug:neomycin|time:3hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,cntl neo 3hr 3,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:3hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,GSM1357176,GSM1357176: cntl neo 3hr 3; Danio rerio; RNA Seq,GSM1357176,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357176,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_neo_3_3.fastq.gz,fastq,1555198750.0,31103975.0,GSM1357176 r1,0:50 1:0,A:416734314;C:365733903;G:359113904;T:413549150;N:67479,50,0,,,416734314,365733903,359113904,413549150,67479,SRX501295,SRS582367,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93432,,0.21789,,0.67363,,0.49063,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37968,SRR1205167,SRX501294,SRS582366,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl neo 3hr 2,GSM1357175,,tissue:GFP negative cells from 5 dpf larvae|drug:neomycin|time:3hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,cntl neo 3hr 2,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:3hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,GSM1357175,GSM1357175: cntl neo 3hr 2; Danio rerio; RNA Seq,GSM1357175,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357175,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_neo_3_2.fastq.gz,fastq,1701011300.0,34020226.0,GSM1357175 r1,0:50 1:0,A:453767169;C:401144167;G:392795706;T:453224665;N:79593,50,0,,,453767169,401144167,392795706,453224665,79593,SRX501294,SRS582366,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93437,,0.19214,,0.66884,,0.48995,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37969,SRR1205166,SRX501293,SRS582365,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl neo 3hr 1,GSM1357174,,tissue:GFP negative cells from 5 dpf larvae|drug:neomycin|time:3hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,cntl neo 3hr 1,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:3hr|gfp status:negative|genotype:TgsqET20|experiment date:Apr2012,GSM1357174,GSM1357174: cntl neo 3hr 1; Danio rerio; RNA Seq,GSM1357174,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357174,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_neo_3_1.fastq.gz,fastq,1228792200.0,24575844.0,GSM1357174 r1,0:50 1:0,A:328509222;C:288306723;G:283185002;T:328736353;N:54900,50,0,,,328509222,288306723,283185002,328736353,54900,SRX501293,SRS582365,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93269,,0.21003,,0.66592,,0.48875,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37970,SRR1205165,SRX501292,SRS582364,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp neo 3hr 3,GSM1357173,,tissue:GFP positive cells from 5 dpf larvae|drug:neomycin|time:3hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,gfp neo 3hr 3,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:3hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,GSM1357173,GSM1357173: gfp neo 3hr 3; Danio rerio; RNA Seq,GSM1357173,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357173,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_neo_3_3.fastq.gz,fastq,1406657700.0,28133154.0,GSM1357173 r1,0:50 1:0,A:379997165;C:326224852;G:320555458;T:379818406;N:61819,50,0,,,379997165,326224852,320555458,379818406,61819,SRX501292,SRS582364,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.9327,,0.3167,,0.70709,,0.48722,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37971,SRR1205164,SRX501291,SRS582363,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp neo 3hr 2,GSM1357172,,tissue:GFP positive cells from 5 dpf larvae|drug:neomycin|time:3hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,gfp neo 3hr 2,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:3hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,GSM1357172,GSM1357172: gfp neo 3hr 2; Danio rerio; RNA Seq,GSM1357172,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357172,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_neo_3_2.fastq.gz,fastq,1409177900.0,28183558.0,GSM1357172 r1,0:50 1:0,A:377366991;C:329654609;G:322942817;T:379147506;N:65977,50,0,,,377366991,329654609,322942817,379147506,65977,SRX501291,SRS582363,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.92559,,0.27573,,0.69968,,0.48668,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37972,SRR1205163,SRX501290,SRS582362,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp neo 3hr 1,GSM1357171,,tissue:GFP positive cells from 5 dpf larvae|drug:neomycin|time:3hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,gfp neo 3hr 1,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:3hr|gfp status:positive|genotype:TgsqET20|experiment date:Apr2012,GSM1357171,GSM1357171: gfp neo 3hr 1; Danio rerio; RNA Seq,GSM1357171,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357171,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_neo_3_1.fastq.gz,fastq,1364255100.0,27285102.0,GSM1357171 r1,0:50 1:0,A:367031933;C:317262942;G:311363762;T:368536308;N:60155,50,0,,,367031933,317262942,311363762,368536308,60155,SRX501290,SRS582362,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93433,,0.34822,,0.70504,,0.49052,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37973,SRR1205162,SRX501289,SRS582361,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp nt 1hr 3,GSM1357170,,tissue:GFP positive cells from 5 dpf larvae|drug:no drug|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,gfp nt 1hr 3,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:no drug|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,GSM1357170,GSM1357170: gfp nt 1hr 3; Danio rerio; RNA Seq,GSM1357170,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357170,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_nt_1_3.fastq.gz,fastq,2032585500.0,40651710.0,GSM1357170 r1,0:50 1:0,A:540423336;C:478257444;G:470055372;T:543729414;N:119934,50,0,,,540423336,478257444,470055372,543729414,119934,SRX501289,SRS582361,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93511,,0.2696,,0.70425,,0.49291,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37974,SRR1205161,SRX501288,SRS582360,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp nt 1hr 2,GSM1357169,,tissue:GFP positive cells from 5 dpf larvae|drug:no drug|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,gfp nt 1hr 2,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:no drug|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,GSM1357169,GSM1357169: gfp nt 1hr 2; Danio rerio; RNA Seq,GSM1357169,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357169,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_nt_1_2.fastq.gz,fastq,1562346650.0,31246933.0,GSM1357169 r1,0:50 1:0,A:414164641;C:369142355;G:361974997;T:416978503;N:86154,50,0,,,414164641,369142355,361974997,416978503,86154,SRX501288,SRS582360,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93897,,0.31695,,0.70991,,0.50448,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37975,SRR1205160,SRX501287,SRS582359,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp nt 1hr 1,GSM1357168,,tissue:GFP positive cells from 5 dpf larvae|drug:no drug|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,gfp nt 1hr 1,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:no drug|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,GSM1357168,GSM1357168: gfp nt 1hr 1; Danio rerio; RNA Seq,GSM1357168,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357168,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_nt_1_1.fastq.gz,fastq,1689050050.0,33781001.0,GSM1357168 r1,0:50 1:0,A:453271567;C:394505701;G:386090706;T:455068897;N:113179,50,0,,,453271567,394505701,386090706,455068897,113179,SRX501287,SRS582359,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93627,,0.28408,,0.70585,,0.48065,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37976,SRR1205159,SRX501286,SRS582358,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp neo 1hr 3,GSM1357167,,tissue:GFP positive cells from 5 dpf larvae|drug:neomycin|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,gfp neo 1hr 3,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,GSM1357167,GSM1357167: gfp neo 1hr 3; Danio rerio; RNA Seq,GSM1357167,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357167,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_neo_1_3.fastq.gz,fastq,1611919200.0,32238384.0,GSM1357167 r1,0:50 1:0,A:428150047;C:380113504;G:372605259;T:430955158;N:95232,50,0,,,428150047,380113504,372605259,430955158,95232,SRX501286,SRS582358,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.94024,,0.31287,,0.71601,,0.50103,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37977,SRR1205158,SRX501285,SRS582357,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp neo 1hr 2,GSM1357166,,tissue:GFP positive cells from 5 dpf larvae|drug:neomycin|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,gfp neo 1hr 2,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,GSM1357166,GSM1357166: gfp neo 1hr 2; Danio rerio; RNA Seq,GSM1357166,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357166,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_neo_1_2.fastq.gz,fastq,1653679950.0,33073599.0,GSM1357166 r1,0:50 1:0,A:439492851;C:388625865;G:381772828;T:443698911;N:89495,50,0,,,439492851,388625865,381772828,443698911,89495,SRX501285,SRS582357,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.94345,,0.38847,,0.7357,,0.50373,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37978,SRR1205157,SRX501284,SRS582356,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,gfp neo 1hr 1,GSM1357165,,tissue:GFP positive cells from 5 dpf larvae|drug:neomycin|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,gfp neo 1hr 1,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP positive cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:1hr|gfp status:positive|genotype:TgsqET20|experiment date:Mar2012,GSM1357165,GSM1357165: gfp neo 1hr 1; Danio rerio; RNA Seq,GSM1357165,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357165,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,gfp_neo_1_1.fastq.gz,fastq,1873022200.0,37460444.0,GSM1357165 r1,0:50 1:0,A:501397145;C:438845045;G:428481612;T:504171995;N:126403,50,0,,,501397145,438845045,428481612,504171995,126403,SRX501284,SRS582356,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.933,,0.24769,,0.70591,,0.50587,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37979,SRR1205156,SRX501283,SRS582355,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl nt 1hr 3,GSM1357164,,tissue:GFP negative cells from 5 dpf larvae|drug:no drug|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,cntl nt 1hr 3,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:no drug|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,GSM1357164,GSM1357164: cntl nt 1hr 3; Danio rerio; RNA Seq,GSM1357164,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357164,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_nt_1_3.fastq.gz,fastq,1523970250.0,30479405.0,GSM1357164 r1,0:50 1:0,A:404458518;C:360948466;G:353690676;T:404782977;N:89613,50,0,,,404458518,360948466,353690676,404782977,89613,SRX501283,SRS582355,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93995,,0.21232,,0.66772,,0.48499,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37980,SRR1205155,SRX501282,SRS582354,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl nt 1hr 2,GSM1357163,,tissue:GFP negative cells from 5 dpf larvae|drug:no drug|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,cntl nt 1hr 2,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:no drug|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,GSM1357163,GSM1357163: cntl nt 1hr 2; Danio rerio; RNA Seq,GSM1357163,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357163,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_nt_1_2.fastq.gz,fastq,1649622150.0,32992443.0,GSM1357163 r1,0:50 1:0,A:434980357;C:392949654;G:385359402;T:436242531;N:90206,50,0,,,434980357,392949654,385359402,436242531,90206,SRX501282,SRS582354,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.94128,,0.24395,,0.67549,,0.50787,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37981,SRR1205154,SRX501281,SRS582353,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl nt 1hr 1,GSM1357162,,tissue:GFP negative cells from 5 dpf larvae|drug:no drug|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,cntl nt 1hr 1,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:no drug|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,GSM1357162,GSM1357162: cntl nt 1hr 1; Danio rerio; RNA Seq,GSM1357162,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357162,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_nt_1_1.fastq.gz,fastq,1953710600.0,39074212.0,GSM1357162 r1,0:50 1:0,A:518489677;C:462970545;G:452495723;T:519623507;N:131148,50,0,,,518489677,462970545,452495723,519623507,131148,SRX501281,SRS582353,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93818,,0.2175,,0.66229,,0.50468,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37982,SRR1205153,SRX501280,SRS582352,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl neo 1hr 3,GSM1357161,,tissue:GFP negative cells from 5 dpf larvae|drug:neomycin|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,cntl neo 1hr 3,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,GSM1357161,GSM1357161: cntl neo 1hr 3; Danio rerio; RNA Seq,GSM1357161,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357161,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_neo_1_3.fastq.gz,fastq,1934085200.0,38681704.0,GSM1357161 r1,0:50 1:0,A:513203802;C:458221455;G:449581302;T:512967391;N:111250,50,0,,,513203802,458221455,449581302,512967391,111250,SRX501280,SRS582352,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93811,,0.22613,,0.66671,,0.49681,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37983,SRR1205152,SRX501279,SRS582351,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl neo 1hr 2,GSM1357160,,tissue:GFP negative cells from 5 dpf larvae|drug:neomycin|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,cntl neo 1hr 2,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,GSM1357160,GSM1357160: cntl neo 1hr 2; Danio rerio; RNA Seq,GSM1357160,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357160,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_neo_1_2.fastq.gz,fastq,1836127900.0,36722558.0,GSM1357160 r1,0:50 1:0,A:485828745;C:436091545;G:426562682;T:487543575;N:101353,50,0,,,485828745,436091545,426562682,487543575,101353,SRX501279,SRS582351,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93856,,0.23223,,0.67154,,0.5021,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
37984,SRR1205151,SRX501278,SRS582350,SRP040561,PRJNA242641,Gene expression analysis of hair cell regeneration in the zebrafish lateral line,GSE56176,Transcriptome Analysis,Deafness due to the terminal loss of inner ear hair cells is one of the most common sensory diseases. However non mammalian animals e.g. birds amphibian and fish regenerate damaged hair cells. In order to better understand the reasons underpinning such regeneration disparities in vertebrates we set out to define the changes in gene expression associated with the regeneration of hair cells in the zebrafish lateral line at high resolution. We performed RNA Seq analyses on regenerating support cells purified by fluorescence activated cell sorting FACS. The zebrafish lateral line provides an experimentally accessible system to define the complex signaling events triggered by injury and regeneration because these cells can be acutely killed by exposure to neomycin post which they regenerate rapidly. Lateral line hair cells are located in the center of a mechanosensory organ known as the neuromast and are surrounded by inner support cells and an outer ring of mantle cells. TgsqET20 larvae express GFP strongly in mantle cells and to a lesser degree in inner support cells. We isolated GFP positive and GFP negative cells from 5 dpf dpf TgsqET20 larvae at 1 3 and 5 hours post neomycin treatment as well as from a non treated control. Overall design: Transgenic zebrafish TgsqET20 larvae at 5 dpf were exposed to neomycin dissociated and FACS sorted into GFP positive and GFP negative populations at xxx 3 and 5 hours following treatment along with a mock treated 1 hr control. The experiment was performed in triplicate for a total of 24 samples.,,pubmed:24706903,,cntl neo 1hr 1,GSM1357159,,tissue:GFP negative cells from 5 dpf larvae|drug:neomycin|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,cntl neo 1hr 1,Data was processed with CASAVA version 1.8.2 Sequence reads in fastq format were mapped to danRer7using tophat 1.4.1 with options –g 1 and a GTF description of transcripts based on Ensembl 63. FPKM values for these transcripts were generated using cufflinks v1.3. Genome build: danRer7 Supplementary files format and content: FPKM values per gene.,GFP negative cells from 5 dpf larvae,For neomycin treatment 5dpf larvae were treated for 30min with 300μM neomycin Fisher BioReagents diluted in 0.5X E2 medium rinsed three times and recovered in 0.5X E2 medium at 28.5°C for the indicated time.,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,Larvae were generated by paired matings and raised in 0.5X E2 medium at 28.5°C. GFP positive larvae were sorted from wild type larvae at 48 hpf under fluorescent stereoscope.,drug:neomycin|time:1hr|gfp status:negative|genotype:TgsqET20|experiment date:Mar2012,GSM1357159,GSM1357159: cntl neo 1hr 1; Danio rerio; RNA Seq,GSM1357159,,1,Two hundred 5dpf untreated TgsqET20 control or neomycin treated TgsqET20 larvae were anesthetized collected in a 2mL tube dissociated with trypsin and filtered to remove un dissociated tissue. A two gate FACS strategy was used to select only living target cells from excesses of dead cells and cellular debris of the larval cell suspensions see Materials and Methods of associated manuscript for detailed FACS protocol. Approximately 30 000 GFP or GFP+ cells were used for total RNA extraction using Trizol Invitrogen following the manufacturer’s manual. Libraries for RNA sequencing were made with poly A selected mRNA using the Illumina TruSeq RNA library construction kit v2 Illumina. The resulting libraries were purified using Agencourt AMPure XP system Backman Coulter then quantified using a Bioanalyzer or Qubit Fluorometer Life Technologies.,GEO Accession:GSM1357159,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP040561,,loader:latf load,cntl_neo_1_1.fastq.gz,fastq,1687481850.0,33749637.0,GSM1357159 r1,0:50 1:0,A:448529802;C:398804686;G:391019451;T:449013498;N:114413,50,0,,,448529802,398804686,391019451,449013498,114413,SRX501278,SRS582350,SRA149178,GEO,"Seidel, Genomics, Stowers Institute",1,0.93698,,0.21557,,0.66436,,0.49756,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-03-25,Multi-stage,Multi-stage,Undetermined,Undetermined
39627,SRR1931774,SRX970023,SRS885229,SRP056603,PRJNA279522,tRNA sequencing in Danio rerio,PRJNA279522,Other,Small RNA sequencing to look for disruption of CCA nucleotidyltransferase activity post TRNT1 knockdown.,,,,WT Danio rerio,tRNAseq000 WT,,breed:not collected|age:5 day|sex:not collected|tissue:whole|phenotype:normal morphology|BioSampleModel:Model organism or animal,,,,,,,,,tRNA sequencing WT,tRNA sequencing WT,WT,1,,,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,1500Application ReadForward1,SRP056603,,,2-WT_S1_L001_R1_001.fastq.gz,fastq,1588656656.0,10577741.0,tRNA sequencing WT,0:150.19 1:0,A:478698865;C:376122807;G:338649726;T:395185202;N:56,150,0,,,478698865,376122807,338649726,395185202,56,SRX970023,SRS885229,SRA248889,University of Iowa|Stephen A. Wynn Institute for Vision Research,University of Iowa,1,3e-05,,0.0,,0.99989,,0.4,,151,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2015-08-09,Larval,Larval,Undetermined,Undetermined
39628,SRR1931761,SRX970012,SRS885221,SRP056603,PRJNA279522,tRNA sequencing in Danio rerio,PRJNA279522,Other,Small RNA sequencing to look for disruption of CCA nucleotidyltransferase activity post TRNT1 knockdown.,,,,TRNT1 KD,tRNAseq000 MO,,breed:not collected|age:5 day|sex:not collected|tissue:whole|phenotype:normal morphology|BioSampleModel:Model organism or animal,,,,,,,,,tRNA sequencing of TRNT1 KD,tRNA sequencing of TRNT1 KD,1,1,,,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,1500Application ReadForward1,SRP056603,,,3-mutant1-TRNT-M0_S2_L001_R1_001.fastq.gz,fastq,1355519463.0,9025087.0,tRNA sequencing of TRNT1 KD,0:150.19 1:0,A:399052503;C:312898077;G:288848586;T:354720282;N:15,150,0,,,399052503,312898077,288848586,354720282,15,SRX970012,SRS885221,SRA248889,University of Iowa|Stephen A. Wynn Institute for Vision Research,University of Iowa,1,0.00012,,0.0,,0.99965,,0.78947,,151,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2015-08-09,Larval,Larval,Undetermined,Undetermined
48909,SRR7615221,SRX4479802,SRS3604791,SRP155604,PRJNA479418,Lariat intronic RNAs in the cytoplasm of vertebrate cells,PRJNA479418,Other,Introns are non coding DNA sequences interspersed among the coding sequences of genes. Shortly post transcription the intronic sequences are spliced out of the primary RNA transcript as lariat RNAs circular molecules with a short tail. Most of these lariats are destroyed within minutes in the cell nucleus. We report here that many such intronic RNAs are in fact exported to the cytoplasm where they remain as stable circular molecules. These cytoplasmic introns are derived from hundreds of different genes of widely different functions. We find them in cells of human mouse chicken frog and zebrafish. The widespread occurrence of so many stable lariat RNAs in the cytoplasm suggests that they play some as yet unexpected role in cell metabolism.,,,,,zebrafish eggs plusRNaseR,,strain:AB strain|dev stage:Germline|sex:female|tissue:Egg|treatment:n1|rna treatment:rRNA depletion and RNase R|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of Zebrafish egg plus RNaseR,Zf pR,Zf pR,rRNA depletion ribozero fellowed by TruSeq Stranded Total RNA illumina,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP155604,,,150112_Zebrafish_egg_plusRNaseR_50bp.fastq,fastq,1453087900.0,29061758.0,150112 Zebrafish egg plusRNaseR 50bp.fastq,0:50,A:316388483;C:426462939;G:363020331;T:347178488;N:37659,50,,,,316388483,426462939,363020331,347178488,37659,SRX4479802,SRS3604791,SRA746415,Carnegie Institution for Science|Department of Embryology,Carnegie Institution for Science,1,0.83263,,0.31979,,0.81592,,0.51542,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,ribozero,bulk,unknown,unknown,,United States,2018-07-28,Undetermined,Undetermined,Undetermined,Undetermined
48910,SRR7615223,SRX4479800,SRS3604789,SRP155604,PRJNA479418,Lariat intronic RNAs in the cytoplasm of vertebrate cells,PRJNA479418,Other,Introns are non coding DNA sequences interspersed among the coding sequences of genes. Shortly post transcription the intronic sequences are spliced out of the primary RNA transcript as lariat RNAs circular molecules with a short tail. Most of these lariats are destroyed within minutes in the cell nucleus. We report here that many such intronic RNAs are in fact exported to the cytoplasm where they remain as stable circular molecules. These cytoplasmic introns are derived from hundreds of different genes of widely different functions. We find them in cells of human mouse chicken frog and zebrafish. The widespread occurrence of so many stable lariat RNAs in the cytoplasm suggests that they play some as yet unexpected role in cell metabolism.,,,,,zebrafish eggs minusRNaseR,,strain:AB strain|dev stage:Germline|sex:female|tissue:Egg|treatment:n1|rna treatment:rRNA depletion|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of Zebrafish egg minus RNaseR,Zf mR,Zf mR,rRNA depletion ribozero fellowed by TruSeq Stranded Total RNA illumina,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP155604,,,150112_Zebrafish_egg_minusRNaseR_50bp.fastq,fastq,2440809700.0,48816194.0,150112 Zebrafish egg minusRNaseR 50bp.fastq,0:50,A:588729472;C:623954878;G:556893764;T:671166713;N:64873,50,,,,588729472,623954878,556893764,671166713,64873,SRX4479800,SRS3604789,SRA746415,Carnegie Institution for Science|Department of Embryology,Carnegie Institution for Science,1,0.92096,,0.07705,,0.72861,,0.50081,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,ribozero,bulk,unknown,unknown,,United States,2018-07-28,Undetermined,Undetermined,Undetermined,Undetermined
50533,SRR8129704,SRX4950826,SRS3993016,SRP167139,PRJNA499073,Purification of high quality RNA from a small number of fluorescence activated cell sorted zebrafish cells for RNA sequencing purposes,GSE121917,Transcriptome Analysis,We provide a method for high quality RNA purification out of a small number 5000 100 000 of FACS sorted zebrafish cells followed by RNA sequencing Overall design: RNA sequencing data from 6 RNA samples isolated from 20000 sorted fli:GFP zebrafish cells. 2 RNA samples isolated from whole embryo.,,pubmed:30894119,,RNeasy sorted 2,GSM3449965,,tissue:Fli:GFP sorted 3 days RNeasy sample 1|cell type:fli:GFP GFP sorted|age:3 days|rna isolation kit:RNeasy plus micro kit,RNeasy sorted 2,Fastq files were aligned to GRCz10 with STAR v2 4 2a. Gene quantification was done on the fly by STAR on Danio rerio.GRCz10.91.gtf Genome build: GRCz10 Supplementary files format and content: tsv files with raw count data,Fli:GFP sorted 3 days RNeasy sample 1,,polyA RNA cDNA was synthesized according to the SMART seq V4 takara biosystems technology tagmentation and sample barcoding with the Nextera XT kit illumina,,cell type:fli:GFP GFP sorted|age:3 days|rna isolation kit:RNeasy plus micro kit,GSM3449965,GSM3449965: RNeasy sorted 2; Danio rerio; RNA Seq,GSM3449965,,1,polyA RNA cDNA was synthesized according to the SMART seq V4 takara biosystems technology tagmentation and sample barcoding with the Nextera XT kit illumina,GEO Accession:GSM3449965,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP167139,,,Q_1.fastq.gz,fastq,1059463914.0,14029229.0,GSM3449965 r1,0:75.52 1:0,A:284634446;C:242976410;G:245781627;T:286026099;N:45332,75,0,,,284634446,242976410,245781627,286026099,45332,SRX4950826,SRS3993016,SRA800291,GEO,"Center for Medical Genetics, Ghent University",1,0.91903,,0.09754,,0.73537,,0.48738,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Belgium,2018-10-29,Larval,Larval,Undetermined,Undetermined
50534,SRR8129703,SRX4950825,SRS3993017,SRP167139,PRJNA499073,Purification of high quality RNA from a small number of fluorescence activated cell sorted zebrafish cells for RNA sequencing purposes,GSE121917,Transcriptome Analysis,We provide a method for high quality RNA purification out of a small number 5000 100 000 of FACS sorted zebrafish cells followed by RNA sequencing Overall design: RNA sequencing data from 6 RNA samples isolated from 20000 sorted fli:GFP zebrafish cells. 2 RNA samples isolated from whole embryo.,,pubmed:30894119,,RNAqueous sorted 1,GSM3449964,,tissue:Fli:GFP sorted 3 days RNAqueous sample 1|cell type:fli:GFP GFP sorted|age:3 days|rna isolation kit:RNAqueous micro,RNAqueous sorted 1,Fastq files were aligned to GRCz10 with STAR v2 4 2a. Gene quantification was done on the fly by STAR on Danio rerio.GRCz10.91.gtf Genome build: GRCz10 Supplementary files format and content: tsv files with raw count data,Fli:GFP sorted 3 days RNAqueous sample 1,,polyA RNA cDNA was synthesized according to the SMART seq V4 takara biosystems technology tagmentation and sample barcoding with the Nextera XT kit illumina,,cell type:fli:GFP GFP sorted|age:3 days|rna isolation kit:RNAqueous micro,GSM3449964,GSM3449964: RNAqueous sorted 1; Danio rerio; RNA Seq,GSM3449964,,1,polyA RNA cDNA was synthesized according to the SMART seq V4 takara biosystems technology tagmentation and sample barcoding with the Nextera XT kit illumina,GEO Accession:GSM3449964,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP167139,,,A_1.fastq.gz,fastq,1477268521.0,19562904.0,GSM3449964 r1,0:75.51 1:0,A:399601730;C:333778207;G:337372866;T:406448608;N:67110,75,0,,,399601730,333778207,337372866,406448608,67110,SRX4950825,SRS3993017,SRA800291,GEO,"Center for Medical Genetics, Ghent University",1,0.90617,,0.09373,,0.74558,,0.49316,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Belgium,2018-10-29,Larval,Larval,Undetermined,Undetermined
51017,SRR8435109,SRX5242689,SRS4245412,SRP178513,PRJNA514721,Lysosome Rich Enterocytes mediate protein absorption in the vertebrate gut,GSE124970,Transcriptome Analysis,The goal of this RNA seq experiment was to compare gene expression profiles of two different intestinal cell populations Intestinal epithelial cells that mostly reside in the anterior gut and Lysosome rich enterocytes that reside in mid intestine in zebrafish to better understand the characteristics of LREs and uncover the molecular players mediating the function of LREs. Two populations were FACS isolated from 6 dpf dpf TgBACcldn15la GFPpd1034 transgenic fish gavaged with Alexa Fluor 568 Dextran 24 hours prior to FACS. RNA was extracted from the FACS sorted cells and expression profiles were determined using Illumina HiSeq. Comparison of the sample groups allowed for identification of unique candidates. The sequence reads that passed quality filters were analyzed using HISAT2 and gene counts were analyzed using HTSeq. Overall design: mRNA profiles of 6 dpf cldn15la GFP positive intestinal epithelial cells IECs and cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs were generated by RNA sequencing using Illumina HiSeq 2000. Two distinct samples with 3 replicates each.,,pubmed:31474562,,cldn15la GFP+ f Dex+ LREs 3,GSM3560348,,tissue:cldn15la GFP+ f Dex+ LREs|strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs,cldn15la GFP+ f Dex+ LREs 3,HiSeq Control Software used for basecalling Sequenced reads were trimmed for adapter sequences and low quality reads using FASTQ Groomer and FASTQ Quality Trimmer followed by alignment to the GRCz10 reference genome using HISAT2. The number of reads counted for each gene was calculated using HTSeq. Genome build: GRCz10 Supplementary files format and content: .tabular files containing HT seq counts for each gene in each sample.,cldn15la GFP+ f Dex+ LREs,Zebrafish larvae were gavaged with 1 2 nl of 2.5 mg/ml Alexa Fluor 568 Dextran at 5 dpf.,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,,strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs,GSM3560348,GSM3560348: cldn15la GFP+ f Dex+ LREs 3; Danio rerio; RNA Seq,GSM3560348,,1,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM3560348,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP178513,,,LRE_3.fastq.gz,fastq,3319359633.0,65085483.0,GSM3560348 r1,0:51 1:0,A:939171958;C:728294535;G:735458210;T:914956028;N:1478902,51,0,,,939171958,728294535,735458210,914956028,1478902,SRX5242689,SRS4245412,SRA833636,GEO,Duke University,1,0.92838,,0.08491,,0.73507,,0.45124,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2019-01-11,Larval,Larval,Undetermined,Undetermined
51018,SRR8435108,SRX5242688,SRS4245413,SRP178513,PRJNA514721,Lysosome Rich Enterocytes mediate protein absorption in the vertebrate gut,GSE124970,Transcriptome Analysis,The goal of this RNA seq experiment was to compare gene expression profiles of two different intestinal cell populations Intestinal epithelial cells that mostly reside in the anterior gut and Lysosome rich enterocytes that reside in mid intestine in zebrafish to better understand the characteristics of LREs and uncover the molecular players mediating the function of LREs. Two populations were FACS isolated from 6 dpf dpf TgBACcldn15la GFPpd1034 transgenic fish gavaged with Alexa Fluor 568 Dextran 24 hours prior to FACS. RNA was extracted from the FACS sorted cells and expression profiles were determined using Illumina HiSeq. Comparison of the sample groups allowed for identification of unique candidates. The sequence reads that passed quality filters were analyzed using HISAT2 and gene counts were analyzed using HTSeq. Overall design: mRNA profiles of 6 dpf cldn15la GFP positive intestinal epithelial cells IECs and cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs were generated by RNA sequencing using Illumina HiSeq 2000. Two distinct samples with 3 replicates each.,,pubmed:31474562,,cldn15la GFP+ f Dex+ LREs 2,GSM3560347,,tissue:cldn15la GFP+ f Dex+ LREs|strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs,cldn15la GFP+ f Dex+ LREs 2,HiSeq Control Software used for basecalling Sequenced reads were trimmed for adapter sequences and low quality reads using FASTQ Groomer and FASTQ Quality Trimmer followed by alignment to the GRCz10 reference genome using HISAT2. The number of reads counted for each gene was calculated using HTSeq. Genome build: GRCz10 Supplementary files format and content: .tabular files containing HT seq counts for each gene in each sample.,cldn15la GFP+ f Dex+ LREs,Zebrafish larvae were gavaged with 1 2 nl of 2.5 mg/ml Alexa Fluor 568 Dextran at 5 dpf.,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,,strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs,GSM3560347,GSM3560347: cldn15la GFP+ f Dex+ LREs 2; Danio rerio; RNA Seq,GSM3560347,,1,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM3560347,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP178513,,,LRE_2.fastq.gz,fastq,3886795782.0,76211682.0,GSM3560347 r1,0:51 1:0,A:1104818772;C:851405074;G:855078243;T:1073758670;N:1735023,51,0,,,1104818772,851405074,855078243,1073758670,1735023,SRX5242688,SRS4245413,SRA833636,GEO,Duke University,1,0.9367,,0.08433,,0.73565,,0.60818,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2019-01-11,Larval,Larval,Undetermined,Undetermined
51019,SRR8435107,SRX5242687,SRS4245410,SRP178513,PRJNA514721,Lysosome Rich Enterocytes mediate protein absorption in the vertebrate gut,GSE124970,Transcriptome Analysis,The goal of this RNA seq experiment was to compare gene expression profiles of two different intestinal cell populations Intestinal epithelial cells that mostly reside in the anterior gut and Lysosome rich enterocytes that reside in mid intestine in zebrafish to better understand the characteristics of LREs and uncover the molecular players mediating the function of LREs. Two populations were FACS isolated from 6 dpf dpf TgBACcldn15la GFPpd1034 transgenic fish gavaged with Alexa Fluor 568 Dextran 24 hours prior to FACS. RNA was extracted from the FACS sorted cells and expression profiles were determined using Illumina HiSeq. Comparison of the sample groups allowed for identification of unique candidates. The sequence reads that passed quality filters were analyzed using HISAT2 and gene counts were analyzed using HTSeq. Overall design: mRNA profiles of 6 dpf cldn15la GFP positive intestinal epithelial cells IECs and cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs were generated by RNA sequencing using Illumina HiSeq 2000. Two distinct samples with 3 replicates each.,,pubmed:31474562,,cldn15la GFP+ f Dex+ LREs 1,GSM3560346,,tissue:cldn15la GFP+ f Dex+ LREs|strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs,cldn15la GFP+ f Dex+ LREs 1,HiSeq Control Software used for basecalling Sequenced reads were trimmed for adapter sequences and low quality reads using FASTQ Groomer and FASTQ Quality Trimmer followed by alignment to the GRCz10 reference genome using HISAT2. The number of reads counted for each gene was calculated using HTSeq. Genome build: GRCz10 Supplementary files format and content: .tabular files containing HT seq counts for each gene in each sample.,cldn15la GFP+ f Dex+ LREs,Zebrafish larvae were gavaged with 1 2 nl of 2.5 mg/ml Alexa Fluor 568 Dextran at 5 dpf.,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,,strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs,GSM3560346,GSM3560346: cldn15la GFP+ f Dex+ LREs 1; Danio rerio; RNA Seq,GSM3560346,,1,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM3560346,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP178513,,,LRE_1.fastq.gz,fastq,3052804104.0,59858904.0,GSM3560346 r1,0:51 1:0,A:886286208;C:657679423;G:656279895;T:852223208;N:335370,51,0,,,886286208,657679423,656279895,852223208,335370,SRX5242687,SRS4245410,SRA833636,GEO,Duke University,1,0.92375,,0.09247,,0.77449,,0.67251,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2019-01-11,Larval,Larval,Undetermined,Undetermined
51020,SRR8435106,SRX5242686,SRS4245411,SRP178513,PRJNA514721,Lysosome Rich Enterocytes mediate protein absorption in the vertebrate gut,GSE124970,Transcriptome Analysis,The goal of this RNA seq experiment was to compare gene expression profiles of two different intestinal cell populations Intestinal epithelial cells that mostly reside in the anterior gut and Lysosome rich enterocytes that reside in mid intestine in zebrafish to better understand the characteristics of LREs and uncover the molecular players mediating the function of LREs. Two populations were FACS isolated from 6 dpf dpf TgBACcldn15la GFPpd1034 transgenic fish gavaged with Alexa Fluor 568 Dextran 24 hours prior to FACS. RNA was extracted from the FACS sorted cells and expression profiles were determined using Illumina HiSeq. Comparison of the sample groups allowed for identification of unique candidates. The sequence reads that passed quality filters were analyzed using HISAT2 and gene counts were analyzed using HTSeq. Overall design: mRNA profiles of 6 dpf cldn15la GFP positive intestinal epithelial cells IECs and cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs were generated by RNA sequencing using Illumina HiSeq 2000. Two distinct samples with 3 replicates each.,,pubmed:31474562,,cldn15la GFP+ IECs 3,GSM3560345,,tissue:cldn15la GFP+ IECs|strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP positive intestinal epithelial cells IECs,cldn15la GFP+ IECs 3,HiSeq Control Software used for basecalling Sequenced reads were trimmed for adapter sequences and low quality reads using FASTQ Groomer and FASTQ Quality Trimmer followed by alignment to the GRCz10 reference genome using HISAT2. The number of reads counted for each gene was calculated using HTSeq. Genome build: GRCz10 Supplementary files format and content: .tabular files containing HT seq counts for each gene in each sample.,cldn15la GFP+ IECs,Zebrafish larvae were gavaged with 1 2 nl of 2.5 mg/ml Alexa Fluor 568 Dextran at 5 dpf.,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,,strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP positive intestinal epithelial cells IECs,GSM3560345,GSM3560345: cldn15la GFP+ IECs 3; Danio rerio; RNA Seq,GSM3560345,,1,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM3560345,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP178513,,,IEC_3.fastq.gz,fastq,3411376434.0,66889734.0,GSM3560345 r1,0:51 1:0,A:962628477;C:748798542;G:754301765;T:944119253;N:1528397,51,0,,,962628477,748798542,754301765,944119253,1528397,SRX5242686,SRS4245411,SRA833636,GEO,Duke University,1,0.92544,,0.11398,,0.71125,,0.50352,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2019-01-11,Larval,Larval,Undetermined,Undetermined
51021,SRR8435105,SRX5242685,SRS4245408,SRP178513,PRJNA514721,Lysosome Rich Enterocytes mediate protein absorption in the vertebrate gut,GSE124970,Transcriptome Analysis,The goal of this RNA seq experiment was to compare gene expression profiles of two different intestinal cell populations Intestinal epithelial cells that mostly reside in the anterior gut and Lysosome rich enterocytes that reside in mid intestine in zebrafish to better understand the characteristics of LREs and uncover the molecular players mediating the function of LREs. Two populations were FACS isolated from 6 dpf dpf TgBACcldn15la GFPpd1034 transgenic fish gavaged with Alexa Fluor 568 Dextran 24 hours prior to FACS. RNA was extracted from the FACS sorted cells and expression profiles were determined using Illumina HiSeq. Comparison of the sample groups allowed for identification of unique candidates. The sequence reads that passed quality filters were analyzed using HISAT2 and gene counts were analyzed using HTSeq. Overall design: mRNA profiles of 6 dpf cldn15la GFP positive intestinal epithelial cells IECs and cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs were generated by RNA sequencing using Illumina HiSeq 2000. Two distinct samples with 3 replicates each.,,pubmed:31474562,,cldn15la GFP+ IECs 2,GSM3560344,,tissue:cldn15la GFP+ IECs|strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP positive intestinal epithelial cells IECs,cldn15la GFP+ IECs 2,HiSeq Control Software used for basecalling Sequenced reads were trimmed for adapter sequences and low quality reads using FASTQ Groomer and FASTQ Quality Trimmer followed by alignment to the GRCz10 reference genome using HISAT2. The number of reads counted for each gene was calculated using HTSeq. Genome build: GRCz10 Supplementary files format and content: .tabular files containing HT seq counts for each gene in each sample.,cldn15la GFP+ IECs,Zebrafish larvae were gavaged with 1 2 nl of 2.5 mg/ml Alexa Fluor 568 Dextran at 5 dpf.,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,,strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP positive intestinal epithelial cells IECs,GSM3560344,GSM3560344: cldn15la GFP+ IECs 2; Danio rerio; RNA Seq,GSM3560344,,1,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM3560344,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP178513,,,IEC_2.fastq.gz,fastq,4165555866.0,81677566.0,GSM3560344 r1,0:51 1:0,A:1164142809;C:924263682;G:930812689;T:1144479148;N:1857538,51,0,,,1164142809,924263682,930812689,1144479148,1857538,SRX5242685,SRS4245408,SRA833636,GEO,Duke University,1,0.92974,,0.09982,,0.7167,,0.5209,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2019-01-11,Larval,Larval,Undetermined,Undetermined
51022,SRR8435104,SRX5242684,SRS4245409,SRP178513,PRJNA514721,Lysosome Rich Enterocytes mediate protein absorption in the vertebrate gut,GSE124970,Transcriptome Analysis,The goal of this RNA seq experiment was to compare gene expression profiles of two different intestinal cell populations Intestinal epithelial cells that mostly reside in the anterior gut and Lysosome rich enterocytes that reside in mid intestine in zebrafish to better understand the characteristics of LREs and uncover the molecular players mediating the function of LREs. Two populations were FACS isolated from 6 dpf dpf TgBACcldn15la GFPpd1034 transgenic fish gavaged with Alexa Fluor 568 Dextran 24 hours prior to FACS. RNA was extracted from the FACS sorted cells and expression profiles were determined using Illumina HiSeq. Comparison of the sample groups allowed for identification of unique candidates. The sequence reads that passed quality filters were analyzed using HISAT2 and gene counts were analyzed using HTSeq. Overall design: mRNA profiles of 6 dpf cldn15la GFP positive intestinal epithelial cells IECs and cldn15la GFP Alexa Fluor 568 double positive lysosome rich enterocytes LREs were generated by RNA sequencing using Illumina HiSeq 2000. Two distinct samples with 3 replicates each.,,pubmed:31474562,,cldn15la GFP+ IECs 1,GSM3560343,,tissue:cldn15la GFP+ IECs|strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP positive intestinal epithelial cells IECs,cldn15la GFP+ IECs 1,HiSeq Control Software used for basecalling Sequenced reads were trimmed for adapter sequences and low quality reads using FASTQ Groomer and FASTQ Quality Trimmer followed by alignment to the GRCz10 reference genome using HISAT2. The number of reads counted for each gene was calculated using HTSeq. Genome build: GRCz10 Supplementary files format and content: .tabular files containing HT seq counts for each gene in each sample.,cldn15la GFP+ IECs,Zebrafish larvae were gavaged with 1 2 nl of 2.5 mg/ml Alexa Fluor 568 Dextran at 5 dpf.,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,,strain:EK|genotype/variation:wild type|age:6 dpf type:cldn15la GFP positive intestinal epithelial cells IECs,GSM3560343,GSM3560343: cldn15la GFP+ IECs 1; Danio rerio; RNA Seq,GSM3560343,,1,At 6 dpf 24 hrs post gavage zebrafish larvae were dissociated using Trypsin/EDTA and collagenase. Then two different intestinal populations were collected using fluorescence activated cell sorting FACS. Total RNA was prepared from each population using RNeasy Micro Plus Kit Qiagen. Quality control was evaluated by Qubit and 2100 Bioanalyzer. Clonetech ultra low input RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM3560343,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP178513,,,IEC_1.fastq.gz,fastq,3258191610.0,63886110.0,GSM3560343 r1,0:51 1:0,A:941514468;C:707367673;G:717548605;T:891005627;N:755237,51,0,,,941514468,707367673,717548605,891005627,755237,SRX5242684,SRS4245409,SRA833636,GEO,Duke University,1,0.91133,,0.12919,,0.76274,,0.60572,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2019-01-11,Larval,Larval,Undetermined,Undetermined
57144,SRR11218074,SRX7830305,SRS6240984,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 8PY,GSM4369117,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 8PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369117,GSM4369117: SS 8PY; Danio rerio; ncRNA Seq,GSM4369117,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369117,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.8_PYR.fq.gz,fastq,957995832.0,18784232.0,GSM4369117 r1,0:51 1:0,A:228507696;C:213417776;G:258943243;T:257032661;N:94456,51,0,,,228507696,213417776,258943243,257032661,94456,SRX7830305,SRS6240984,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.60772,,0.1313,,0.9877,,0.5307,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57145,SRR11218073,SRX7830304,SRS6240983,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 8IN,GSM4369116,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 8IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369116,GSM4369116: SS 8IN; Danio rerio; ncRNA Seq,GSM4369116,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369116,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.8_INH.fq.gz,fastq,469965.0,9215.0,GSM4369116 r1,0:51 1:0,A:115943;C:105774;G:126829;T:121280;N:139,51,0,,,115943,105774,126829,121280,139,SRX7830304,SRS6240983,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.63582,,0.11966,,0.99628,,0.52244,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57146,SRR11218072,SRX7830303,SRS6240982,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 8Co,GSM4369115,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 8Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369115,GSM4369115: SS 8Co; Danio rerio; ncRNA Seq,GSM4369115,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369115,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.8_Control.fq.gz,fastq,1016301786.0,19927486.0,GSM4369115 r1,0:51 1:0,A:234047138;C:231668317;G:283673780;T:266812487;N:100064,51,0,,,234047138,231668317,283673780,266812487,100064,SRX7830303,SRS6240982,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.45617,,0.08006,,0.98756,,0.53318,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57147,SRR11218071,SRX7830302,SRS6240981,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 7PY,GSM4369114,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 7PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369114,GSM4369114: SS 7PY; Danio rerio; ncRNA Seq,GSM4369114,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369114,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.7_PYR.fq.gz,fastq,994662945.0,19503195.0,GSM4369114 r1,0:51 1:0,A:238913864;C:226034038;G:265449938;T:264166944;N:98161,51,0,,,238913864,226034038,265449938,264166944,98161,SRX7830302,SRS6240981,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.72706,,0.14266,,0.98796,,0.45475,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57148,SRR11218070,SRX7830301,SRS6240980,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 7IN,GSM4369113,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 7IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369113,GSM4369113: SS 7IN; Danio rerio; ncRNA Seq,GSM4369113,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369113,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.7_INH.fq.gz,fastq,698866770.0,13703270.0,GSM4369113 r1,0:51 1:0,A:163946545;C:151571623;G:188671555;T:194609709;N:67338,51,0,,,163946545,151571623,188671555,194609709,67338,SRX7830301,SRS6240980,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.5089,,0.12515,,0.98636,,0.5449,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57149,SRR11218069,SRX7830300,SRS6240979,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 7Co,GSM4369112,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 7Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369112,GSM4369112: SS 7Co; Danio rerio; ncRNA Seq,GSM4369112,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369112,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.7_Control.fq.gz,fastq,675141111.0,13238061.0,GSM4369112 r1,0:51 1:0,A:158015253;C:144827125;G:185064213;T:187168263;N:66257,51,0,,,158015253,144827125,185064213,187168263,66257,SRX7830300,SRS6240979,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.40459,,0.10193,,0.98723,,0.50939,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57150,SRR11218068,SRX7830299,SRS6240978,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 6PY,GSM4369111,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 6PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369111,GSM4369111: SS 6PY; Danio rerio; ncRNA Seq,GSM4369111,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369111,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.6_PYR.fq.gz,fastq,750671142.0,14719042.0,GSM4369111 r1,0:51 1:0,A:179604494;C:169819225;G:201679305;T:199493837;N:74281,51,0,,,179604494,169819225,201679305,199493837,74281,SRX7830299,SRS6240978,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.6831,,0.13287,,0.98739,,0.53779,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57151,SRR11218067,SRX7830298,SRS6240977,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 6IN,GSM4369110,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 6IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369110,GSM4369110: SS 6IN; Danio rerio; ncRNA Seq,GSM4369110,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369110,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.6_INH.fq.gz,fastq,665736915.0,13053665.0,GSM4369110 r1,0:51 1:0,A:157656775;C:147244006;G:178619094;T:182150634;N:66406,51,0,,,157656775,147244006,178619094,182150634,66406,SRX7830298,SRS6240977,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.5998,,0.13571,,0.9867,,0.50064,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57152,SRR11218066,SRX7830297,SRS6240976,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 6Co,GSM4369109,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 6Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369109,GSM4369109: SS 6Co; Danio rerio; ncRNA Seq,GSM4369109,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369109,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.6_Control.fq.gz,fastq,615356565.0,12065815.0,GSM4369109 r1,0:51 1:0,A:145586024;C:131520739;G:167413237;T:170777582;N:58983,51,0,,,145586024,131520739,167413237,170777582,58983,SRX7830297,SRS6240976,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.43246,,0.11481,,0.98721,,0.51875,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57153,SRR11218065,SRX7830296,SRS6240975,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 5PY,GSM4369108,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 5PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369108,GSM4369108: SS 5PY; Danio rerio; ncRNA Seq,GSM4369108,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369108,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.5_PYR.fq.gz,fastq,765220677.0,15004327.0,GSM4369108 r1,0:51 1:0,A:184664309;C:170899633;G:204508602;T:205072262;N:75871,51,0,,,184664309,170899633,204508602,205072262,75871,SRX7830296,SRS6240975,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.68375,,0.14802,,0.98819,,0.54732,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57154,SRR11218064,SRX7830295,SRS6240974,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 5IN,GSM4369107,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 5IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369107,GSM4369107: SS 5IN; Danio rerio; ncRNA Seq,GSM4369107,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369107,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.5_INH.fq.gz,fastq,814440114.0,15969414.0,GSM4369107 r1,0:51 1:0,A:190771507;C:181466379;G:220318895;T:221802003;N:81330,51,0,,,190771507,181466379,220318895,221802003,81330,SRX7830295,SRS6240974,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.58304,,0.11681,,0.98725,,0.53607,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57155,SRR11218063,SRX7830294,SRS6240973,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 5Co,GSM4369106,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 5Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369106,GSM4369106: SS 5Co; Danio rerio; ncRNA Seq,GSM4369106,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369106,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.5_Control.fq.gz,fastq,677415660.0,13282660.0,GSM4369106 r1,0:51 1:0,A:159925012;C:146760884;G:184475935;T:186186960;N:66869,51,0,,,159925012,146760884,184475935,186186960,66869,SRX7830294,SRS6240973,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.48645,,0.11412,,0.98701,,0.5051,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57156,SRR11218062,SRX7830293,SRS6240972,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 4PY,GSM4369105,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 4PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369105,GSM4369105: SS 4PY; Danio rerio; ncRNA Seq,GSM4369105,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369105,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.4_PYR.fq.gz,fastq,708855120.0,13899120.0,GSM4369105 r1,0:51 1:0,A:166247754;C:166449883;G:193535378;T:182549405;N:72700,51,0,,,166247754,166449883,193535378,182549405,72700,SRX7830293,SRS6240972,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.71998,,0.10284,,0.9865,,0.51364,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57157,SRR11218061,SRX7830292,SRS6240971,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 4IN,GSM4369104,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 4IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369104,GSM4369104: SS 4IN; Danio rerio; ncRNA Seq,GSM4369104,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369104,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.4_INH.fq.gz,fastq,1113750597.0,21838247.0,GSM4369104 r1,0:51 1:0,A:258675243;C:241304435;G:306760462;T:306899964;N:110493,51,0,,,258675243,241304435,306760462,306899964,110493,SRX7830292,SRS6240971,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.38867,,0.10253,,0.98739,,0.54594,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57158,SRR11218060,SRX7830291,SRS6240970,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 4Co,GSM4369103,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 4Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369103,GSM4369103: SS 4Co; Danio rerio; ncRNA Seq,GSM4369103,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369103,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.4_Control.fq.gz,fastq,837457944.0,16420744.0,GSM4369103 r1,0:51 1:0,A:194913060;C:201962625;G:234236177;T:206260303;N:85779,51,0,,,194913060,201962625,234236177,206260303,85779,SRX7830291,SRS6240970,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.78427,,0.07281,,0.98938,,0.51853,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57159,SRR11218059,SRX7830290,SRS6240969,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 3PY,GSM4369102,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 3PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369102,GSM4369102: SS 3PY; Danio rerio; ncRNA Seq,GSM4369102,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369102,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.3_PYR.fq.gz,fastq,760961157.0,14920807.0,GSM4369102 r1,0:51 1:0,A:180329733;C:162762377;G:203401780;T:214391898;N:75369,51,0,,,180329733,162762377,203401780,214391898,75369,SRX7830290,SRS6240969,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.52001,,0.13578,,0.98721,,0.54044,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57160,SRR11218058,SRX7830289,SRS6240968,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 3IN,GSM4369101,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 3IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369101,GSM4369101: SS 3IN; Danio rerio; ncRNA Seq,GSM4369101,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369101,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.3_INH.fq.gz,fastq,1018682364.0,19974164.0,GSM4369101 r1,0:51 1:0,A:234817384;C:219512001;G:281378236;T:282876741;N:98002,51,0,,,234817384,219512001,281378236,282876741,98002,SRX7830289,SRS6240968,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.35713,,0.09659,,0.98642,,0.48819,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57161,SRR11218057,SRX7830288,SRS6240967,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 3Co,GSM4369100,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 3Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369100,GSM4369100: SS 3Co; Danio rerio; ncRNA Seq,GSM4369100,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369100,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.3_Control.fq.gz,fastq,801765339.0,15720889.0,GSM4369100 r1,0:51 1:0,A:188213764;C:176265401;G:220274116;T:216937235;N:74823,51,0,,,188213764,176265401,220274116,216937235,74823,SRX7830288,SRS6240967,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.49039,,0.09948,,0.98794,,0.53195,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57162,SRR11218056,SRX7830287,SRS6240966,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 2PY,GSM4369099,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 2PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369099,GSM4369099: SS 2PY; Danio rerio; ncRNA Seq,GSM4369099,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369099,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.2_PYR.fq.gz,fastq,574313805.0,11261055.0,GSM4369099 r1,0:51 1:0,A:135292244;C:131200630;G:155228609;T:152535200;N:57122,51,0,,,135292244,131200630,155228609,152535200,57122,SRX7830287,SRS6240966,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.66365,,0.11507,,0.98687,,0.51107,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57163,SRR11218055,SRX7830286,SRS6240965,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 2IN,GSM4369098,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 2IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369098,GSM4369098: SS 2IN; Danio rerio; ncRNA Seq,GSM4369098,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369098,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.2_INH.fq.gz,fastq,807418230.0,15831730.0,GSM4369098 r1,0:51 1:0,A:190588465;C:176108754;G:219052662;T:221586329;N:82020,51,0,,,190588465,176108754,219052662,221586329,82020,SRX7830286,SRS6240965,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.47844,,0.10981,,0.98723,,0.54721,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57164,SRR11218054,SRX7830285,SRS6240964,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 2Co,GSM4369097,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 2Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369097,GSM4369097: SS 2Co; Danio rerio; ncRNA Seq,GSM4369097,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369097,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.2_Control.fq.gz,fastq,932774037.0,18289687.0,GSM4369097 r1,0:51 1:0,A:218099260;C:200897948;G:257769791;T:255915444;N:91594,51,0,,,218099260,200897948,257769791,255915444,91594,SRX7830285,SRS6240964,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.42164,,0.09363,,0.98746,,0.53483,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57165,SRR11218053,SRX7830284,SRS6240963,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 1PY,GSM4369096,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 1PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369096,GSM4369096: SS 1PY; Danio rerio; ncRNA Seq,GSM4369096,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369096,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.1_PYR.fq.gz,fastq,616504422.0,12088322.0,GSM4369096 r1,0:51 1:0,A:145443705;C:140693898;G:166974890;T:163330321;N:61608,51,0,,,145443705,140693898,166974890,163330321,61608,SRX7830284,SRS6240963,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.65536,,0.11483,,0.9867,,0.53016,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57166,SRR11218052,SRX7830283,SRS6240962,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 1IN,GSM4369095,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 1IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369095,GSM4369095: SS 1IN; Danio rerio; ncRNA Seq,GSM4369095,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369095,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.1_INH.fq.gz,fastq,837218142.0,16416042.0,GSM4369095 r1,0:51 1:0,A:194291608;C:181525851;G:230886112;T:230433107;N:81464,51,0,,,194291608,181525851,230886112,230433107,81464,SRX7830283,SRS6240962,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.41653,,0.09487,,0.9877,,0.54467,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57167,SRR11218051,SRX7830282,SRS6240961,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 1Co,GSM4369094,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 1Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369094,GSM4369094: SS 1Co; Danio rerio; ncRNA Seq,GSM4369094,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369094,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.1_Control.fq.gz,fastq,346638432.0,6796832.0,GSM4369094 r1,0:51 1:0,A:80463778;C:81241478;G:96669917;T:88228518;N:34741,51,0,,,80463778,81241478,96669917,88228518,34741,SRX7830282,SRS6240961,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.66922,,0.07698,,0.98829,,0.52033,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
60827,SRR12536650,SRX9026395,SRS7277845,SRP279118,PRJNA659812,Defects in the zonule in loxl1 knock out zebrafish,PRJNA659812,Other,Purposes: To investigate the roles of lysyl oxidase like 1 loxl1 in zebrafish eye development and the potency of loxl1 knock out in mimicking the ocular manifestations of Exfoliation Syndrome.Methods: CRISPR/Cas9 technology was used to generate a frameshift deletion shifting code deletion in zebrafish loxl1. Expression profiles and ocular manifestations of wildtype WT heterozygous mutant loxl1+/ and homozygous mutant loxl1 / zebrafish were analyzed in a range of developmental stages from whole zebrafish larvae to dissected adult zebrafish eyes using western blot immunofluorescence real time RT PCR and transcriptome resequencing analysis RNA seq. Scanning electron microscopy SEM was used to study the zonular structure and corneal fiber organization of adult zebrafish eyes.Results: The loxl1 mutation caused zonular bundling disorders in juvenile zebrafish and accumulation of pearl like particles adhering to the adult zebrafish zonule. SEM revealed more numerous particles but of smaller size in loxl1 / zebrafish compared with those in loxl1+/ although light microscopy showed that the overall staining of the zonule in loxl1+/ was darker than that in loxl1 / . Expression of transforming growth factor b tgfb pathway related proteins changed at the protein level but not the mRNA level. The phosphorylated Smad3 pSmad3 level was locally activated in the iris side trabecular meshwork and ciliary body of loxl1 / adults.Conclusions: Defects in the zonular bundling found in loxl1 knock out zebrafish indicate dysplasia. Compared with adult loxl1+/ zebrafish more numerous but smaller pearl like particles adhered to the zonule in adult loxl1 / zebrafish. loxl1 / zebrafish is a promising animal model of XFS zonular pathology.,,,,,3 larvae loxl1 / ,,strain:AB|dev stage:7 dpf|sex:male|tissue:larvae|source material id:3|BioSampleModel:Model organism or animal,,,,,,,,,7dpf ko,loxl1 zebrafish3,loxl1 zebrafish3,materials and methods,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP279118,,,larvae_ko_20190920NA_ATAGCGAC_S101_L001_R1_001.fastq.gz larvae_ko_20190920NA_ATAGCGAC_S101_L001_R2_001.fastq.gz,fastq fastq,8570236936.0,28378268.0,larvae ko 20190920NA ATAGCGAC S101 L001 R1 001.fastq.gz,0:151 1:151,A:2291363400;C:1985315062;G:2023225375;T:2269717794;N:615305,151,151,,,2291363400,1985315062,2023225375,2269717794,615305,SRX9026395,SRS7277845,SRA1118248,Eye and ENT Hospital of Fudan University|Ophthalmology and Vision Science,Eye and ENT Hospital of Fudan University,2,0.95641,0.95018,0.09997,0.0968,0.68436,0.68627,0.45419,0.45754,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-08-27,Larval,Larval,Undetermined,Undetermined
60828,SRR12536651,SRX9026394,SRS7277844,SRP279118,PRJNA659812,Defects in the zonule in loxl1 knock out zebrafish,PRJNA659812,Other,Purposes: To investigate the roles of lysyl oxidase like 1 loxl1 in zebrafish eye development and the potency of loxl1 knock out in mimicking the ocular manifestations of Exfoliation Syndrome.Methods: CRISPR/Cas9 technology was used to generate a frameshift deletion shifting code deletion in zebrafish loxl1. Expression profiles and ocular manifestations of wildtype WT heterozygous mutant loxl1+/ and homozygous mutant loxl1 / zebrafish were analyzed in a range of developmental stages from whole zebrafish larvae to dissected adult zebrafish eyes using western blot immunofluorescence real time RT PCR and transcriptome resequencing analysis RNA seq. Scanning electron microscopy SEM was used to study the zonular structure and corneal fiber organization of adult zebrafish eyes.Results: The loxl1 mutation caused zonular bundling disorders in juvenile zebrafish and accumulation of pearl like particles adhering to the adult zebrafish zonule. SEM revealed more numerous particles but of smaller size in loxl1 / zebrafish compared with those in loxl1+/ although light microscopy showed that the overall staining of the zonule in loxl1+/ was darker than that in loxl1 / . Expression of transforming growth factor b tgfb pathway related proteins changed at the protein level but not the mRNA level. The phosphorylated Smad3 pSmad3 level was locally activated in the iris side trabecular meshwork and ciliary body of loxl1 / adults.Conclusions: Defects in the zonular bundling found in loxl1 knock out zebrafish indicate dysplasia. Compared with adult loxl1+/ zebrafish more numerous but smaller pearl like particles adhered to the zonule in adult loxl1 / zebrafish. loxl1 / zebrafish is a promising animal model of XFS zonular pathology.,,,,,2 larvae loxl1+/ ,,strain:AB|dev stage:7 dpf|sex:male|tissue:larvae|source material id:2|BioSampleModel:Model organism or animal,,,,,,,,,7dpf het,loxl1 zebrafish2,loxl1 zebrafish2,materials and methods,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP279118,,,larvae_het_20190930N_CGGATTGC_S300_L003_R1_001.fastq.gz larvae_het_20190930N_CGGATTGC_S300_L003_R2_001.fastq.gz,fastq fastq,5856779318.0,19393309.0,larvae het 20190930N CGGATTGC S300 L003 R1 001.fastq.gz,0:151 1:151,A:1552921599;C:1369101147;G:1376867518;T:1557750473;N:138581,151,151,,,1552921599,1369101147,1376867518,1557750473,138581,SRX9026394,SRS7277844,SRA1118248,Eye and ENT Hospital of Fudan University|Ophthalmology and Vision Science,Eye and ENT Hospital of Fudan University,2,0.95845,0.95108,0.0757,0.07156,0.6551,0.65644,0.47472,0.47519,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-08-27,Larval,Larval,Undetermined,Undetermined
60829,SRR12536652,SRX9026393,SRS7277843,SRP279118,PRJNA659812,Defects in the zonule in loxl1 knock out zebrafish,PRJNA659812,Other,Purposes: To investigate the roles of lysyl oxidase like 1 loxl1 in zebrafish eye development and the potency of loxl1 knock out in mimicking the ocular manifestations of Exfoliation Syndrome.Methods: CRISPR/Cas9 technology was used to generate a frameshift deletion shifting code deletion in zebrafish loxl1. Expression profiles and ocular manifestations of wildtype WT heterozygous mutant loxl1+/ and homozygous mutant loxl1 / zebrafish were analyzed in a range of developmental stages from whole zebrafish larvae to dissected adult zebrafish eyes using western blot immunofluorescence real time RT PCR and transcriptome resequencing analysis RNA seq. Scanning electron microscopy SEM was used to study the zonular structure and corneal fiber organization of adult zebrafish eyes.Results: The loxl1 mutation caused zonular bundling disorders in juvenile zebrafish and accumulation of pearl like particles adhering to the adult zebrafish zonule. SEM revealed more numerous particles but of smaller size in loxl1 / zebrafish compared with those in loxl1+/ although light microscopy showed that the overall staining of the zonule in loxl1+/ was darker than that in loxl1 / . Expression of transforming growth factor b tgfb pathway related proteins changed at the protein level but not the mRNA level. The phosphorylated Smad3 pSmad3 level was locally activated in the iris side trabecular meshwork and ciliary body of loxl1 / adults.Conclusions: Defects in the zonular bundling found in loxl1 knock out zebrafish indicate dysplasia. Compared with adult loxl1+/ zebrafish more numerous but smaller pearl like particles adhered to the zonule in adult loxl1 / zebrafish. loxl1 / zebrafish is a promising animal model of XFS zonular pathology.,,,,,1 larvae wildtype,,strain:AB|dev stage:7 dpf|sex:male|tissue:larvae|source material id:1|BioSampleModel:Model organism or animal,,,,,,,,,7dpf wt,loxl1 zebrafish1,loxl1 zebrafish1,materials and methods,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP279118,,,larvae_AB_20190930N_CGACACAC_S299_L003_R1_001.fastq.gz larvae_AB_20190930N_CGACACAC_S299_L003_R2_001.fastq.gz,fastq fastq,6190673236.0,20498918.0,larvae AB 20190930N CGACACAC S299 L003 R1 001.fastq.gz,0:151 1:151,A:1650586924;C:1439612857;G:1445758759;T:1654565514;N:149182,151,151,,,1650586924,1439612857,1445758759,1654565514,149182,SRX9026393,SRS7277843,SRA1118248,Eye and ENT Hospital of Fudan University|Ophthalmology and Vision Science,Eye and ENT Hospital of Fudan University,2,0.95643,0.95006,0.08333,0.07911,0.64747,0.649,0.47878,0.4805,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-08-27,Larval,Larval,Undetermined,Undetermined
66086,SRR15900240,SRX12190888,SRS10168725,SRP337081,PRJNA763243,m6A RNA methylation regulated by AHR contributes to the cardiac developmental toxicity of PM2.5 in zebrafish embryos,PRJNA763243,Other,This study aims to investigate the roles of m6A RNA methylation regulated by AHR in the heart developmental toxicity of PM2.5 in zebrafish embryos.EOM downregulates the expression levels of methyltransferase METTL14 which can be restored by AHR inhibitor CH or AHR knockdown. In addition EOM increased ROS levels and cell apoptosis in the heart region of zebrafish embryos and these can be attenuated by enforced METTL14 overexpression. In conclusion AHR activated by PM2.5 significantly inhibits METTL14 expression which in turn disrupts heart development via oxidative stress and apoptosis resulting in heart defects in zebrafish embryos.,,,,,EOM+CH 2,,strain:AB|isolate:CH2|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:72 hpf organism or animal,,,,,,,,,RNA m6A methylation of zebrafish,tchenlab CH2,tchenlab CH2,M6A RNA immunoprecipitation was performed using GenSeqTM m6A RNA IP kit GenSeq.NEBNextUltra II Directional RNA Library Prep kit was used to construct RNA sequencing libraries for Input RNA samples without xxx and IP RNA samples post immunoprecipitation.Library inspection is performed using the BioAnalyzer 2100 analyzer Agilent.High throughput sequencing was performed using a 150 bp dual terminal mode on Illumina NovaSeq 6000 sequencer.,,,RIP-Seq,TRANSCRIPTOMIC,PCR,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP337081,,loader:fastq load.py,EOM_CH_5.8.IP_R1.fastq.gz EOM_CH_5.8.IP_R2.fastq.gz EOM_CH_5.8.Input_R1.fastq.gz EOM_CH_5.8.Input_R2.fastq.gz,fastq fastq fastq fastq,13391108400.0,44637028.0,EOM CH 5.8.IP R1.fastq.gz,0:150 1:150,A:2721241817;C:3886076819;G:4096587749;T:2611313908;N:75888107,150,150,,,2721241817,3886076819,4096587749,2611313908,75888107,SRX12190888,SRS10168725,SRA1294636,"Soochow University|Department of Toxicology, School of Public Health",Soochow University,2,0.8442,0.59467,0.17491,0.14724,0.86147,0.89112,0.7593,0.63363,150,150,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,unknown,random_priming,nebnext,bulk,unknown,unknown,,Unknown,2021-09-15,Larval,Larval,Undetermined,Undetermined
66087,SRR15900241,SRX12190887,SRS10168724,SRP337081,PRJNA763243,m6A RNA methylation regulated by AHR contributes to the cardiac developmental toxicity of PM2.5 in zebrafish embryos,PRJNA763243,Other,This study aims to investigate the roles of m6A RNA methylation regulated by AHR in the heart developmental toxicity of PM2.5 in zebrafish embryos.EOM downregulates the expression levels of methyltransferase METTL14 which can be restored by AHR inhibitor CH or AHR knockdown. In addition EOM increased ROS levels and cell apoptosis in the heart region of zebrafish embryos and these can be attenuated by enforced METTL14 overexpression. In conclusion AHR activated by PM2.5 significantly inhibits METTL14 expression which in turn disrupts heart development via oxidative stress and apoptosis resulting in heart defects in zebrafish embryos.,,,,,EOM+CH 1,,strain:AB|isolate:CH1|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:72 hpf organism or animal,,,,,,,,,RNA m6A methylation of zebrafish,tchenlab CH1,tchenlab CH1,M6A RNA immunoprecipitation was performed using GenSeqTM m6A RNA IP kit GenSeq.NEBNextUltra II Directional RNA Library Prep kit was used to construct RNA sequencing libraries for Input RNA samples without xxx and IP RNA samples post immunoprecipitation.Library inspection is performed using the BioAnalyzer 2100 analyzer Agilent.High throughput sequencing was performed using a 150 bp dual terminal mode on Illumina NovaSeq 6000 sequencer.,,,RIP-Seq,TRANSCRIPTOMIC,PCR,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP337081,,loader:fastq load.py,EOM_CH_4.16.IP_R1.fastq.gz EOM_CH_4.16.IP_R2.fastq.gz EOM_CH_4.16.Input_R1.fastq.gz EOM_CH_4.16.Input_R2.fastq.gz,fastq fastq fastq fastq,12428976000.0,41429920.0,EOM CH 4.16.IP R1.fastq.gz,0:150 1:150,A:2486344612;C:3648199763;G:3865825828;T:2365039093;N:63566704,150,150,,,2486344612,3648199763,3865825828,2365039093,63566704,SRX12190887,SRS10168724,SRA1294636,"Soochow University|Department of Toxicology, School of Public Health",Soochow University,2,0.91763,0.6223,0.18817,0.15102,0.84891,0.87957,0.74757,0.64429,150,150,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,unknown,random_priming,nebnext,bulk,unknown,unknown,,Unknown,2021-09-15,Larval,Larval,Undetermined,Undetermined
66088,SRR15900242,SRX12190886,SRS10168723,SRP337081,PRJNA763243,m6A RNA methylation regulated by AHR contributes to the cardiac developmental toxicity of PM2.5 in zebrafish embryos,PRJNA763243,Other,This study aims to investigate the roles of m6A RNA methylation regulated by AHR in the heart developmental toxicity of PM2.5 in zebrafish embryos.EOM downregulates the expression levels of methyltransferase METTL14 which can be restored by AHR inhibitor CH or AHR knockdown. In addition EOM increased ROS levels and cell apoptosis in the heart region of zebrafish embryos and these can be attenuated by enforced METTL14 overexpression. In conclusion AHR activated by PM2.5 significantly inhibits METTL14 expression which in turn disrupts heart development via oxidative stress and apoptosis resulting in heart defects in zebrafish embryos.,,,,,EOM 3,,strain:AB|isolate:T3|breed:missing|cultivar:missing|ecotype:missing|age:missing|dev stage:72 hpf organism or animal,,,,,,,,,RNA m6A methylation of zebrafish,tchenlab T3,tchenlab T3,M6A RNA immunoprecipitation was performed using GenSeqTM m6A RNA IP kit GenSeq.NEBNextUltra II Directional RNA Library Prep kit was used to construct RNA sequencing libraries for Input RNA samples without xxx and IP RNA samples post immunoprecipitation.Library inspection is performed using the BioAnalyzer 2100 analyzer Agilent.High throughput sequencing was performed using a 150 bp dual terminal mode on Illumina NovaSeq 6000 sequencer.,,,RIP-Seq,TRANSCRIPTOMIC,PCR,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP337081,,loader:fastq load.py,EOM_5.9.IP_R1.fastq.gz EOM_5.9.IP_R2.fastq.gz EOM_5.9.Input_R1.fastq.gz EOM_5.9.Input_R2.fastq.gz,fastq fastq fastq fastq,12301780200.0,41005934.0,EOM 5.9.IP R1.fastq.gz,0:150 1:150,A:2415542475;C:3651603114;G:3847935468;T:2318868176;N:67830967,150,150,,,2415542475,3651603114,3847935468,2318868176,67830967,SRX12190886,SRS10168723,SRA1294636,"Soochow University|Department of Toxicology, School of Public Health",Soochow University,2,0.87516,0.65874,0.18282,0.16547,0.85561,0.87657,0.72193,0.61862,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,random_priming,nebnext,bulk,unknown,unknown,,Unknown,2021-09-15,Larval,Larval,Undetermined,Undetermined