rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 60,DRR032764,DRX029570,DRS049969,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr shield 2,SAMD00028161,,sample name:Dr shield 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:shield|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028161,DRX029570,Dr shield 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028161,,,,3644397900.0,36443979.0,DRR032764,0:100 1:0,A:986071173;C:842367218;G:837686080;T:978236607;N:36822,100,0,,,986071173,842367218,837686080,978236607,36822,DRX029570,DRS049969,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92419,,0.08269,,0.75558,,0.47863,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 61,DRR032763,DRX029569,DRS049968,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr shield 1,SAMD00028160,,sample name:Dr shield 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:shield|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028160,DRX029569,Dr shield 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028160,,,,3834622000.0,38346220.0,DRR032763,0:100 1:0,A:1043352851;C:880011834;G:876775415;T:1034444253;N:37647,100,0,,,1043352851,880011834,876775415,1034444253,37647,DRX029569,DRS049968,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92305,,0.09126,,0.75481,,0.47587,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 62,DRR032762,DRX029568,DRS049967,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime5 6 3,SAMD00028159,,sample name:Dr prime5 6 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028159,DRX029568,Dr prime5 6 3,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028159,,,,3903332800.0,39033328.0,DRR032762,0:100 1:0,A:1050045822;C:908538410;G:900588661;T:1044116537;N:43370,100,0,,,1050045822,908538410,900588661,1044116537,43370,DRX029568,DRS049967,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92761,,0.07976,,0.69126,,0.46568,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 63,DRR032761,DRX029567,DRS049966,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime5 6 2,SAMD00028158,,sample name:Dr prime5 6 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028158,DRX029567,Dr prime5 6 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028158,,,,3678549700.0,36785497.0,DRR032761,0:100 1:0,A:986526644;C:857762765;G:853417738;T:980801764;N:40789,100,0,,,986526644,857762765,853417738,980801764,40789,DRX029567,DRS049966,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92689,,0.07872,,0.6928,,0.46577,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 64,DRR032760,DRX029566,DRS049965,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime5 6 1,SAMD00028157,,sample name:Dr prime5 6 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime5 6|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028157,DRX029566,Dr prime5 6 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028157,,,,3863129500.0,38631295.0,DRR032760,0:100 1:0,A:1035240477;C:901625010;G:895370149;T:1030851937;N:41927,100,0,,,1035240477,901625010,895370149,1030851937,41927,DRX029566,DRS049965,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92337,,0.07522,,0.69315,,0.46516,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 65,DRR032759,DRX029565,DRS049964,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime25 2,SAMD00028156,,sample name:Dr prime25 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime25|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028156,DRX029565,Dr prime25 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028156,,,,3750136100.0,37501361.0,DRR032759,0:100 1:0,A:1013528040;C:866734984;G:862431819;T:1007403208;N:38049,100,0,,,1013528040,866734984,862431819,1007403208,38049,DRX029565,DRS049964,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92019,,0.09079,,0.68304,,0.47083,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 66,DRR032758,DRX029564,DRS049963,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr prime25 1,SAMD00028155,,sample name:Dr prime25 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:prime25|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028155,DRX029564,Dr prime25 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028155,,,,3544862700.0,35448627.0,DRR032758,0:100 1:0,A:952135895;C:825841753;G:821757889;T:945087927;N:39236,100,0,,,952135895,825841753,821757889,945087927,39236,DRX029564,DRS049963,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92229,,0.08344,,0.68525,,0.466,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 67,DRR032757,DRX029563,DRS049962,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 97 individuals,Dr bud 2,SAMD00028154,,sample name:Dr bud 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:bud|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028154,DRX029563,Dr bud 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028154,,,,4104778200.0,41047782.0,DRR032757,0:100 1:0,A:1116316188;C:944738800;G:936257056;T:1107423486;N:42670,100,0,,,1116316188,944738800,936257056,1107423486,42670,DRX029563,DRS049962,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92945,,0.10493,,0.73407,,0.47824,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 68,DRR032756,DRX029562,DRS049961,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr bud 1,SAMD00028153,,sample name:Dr bud 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:bud|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028153,DRX029562,Dr bud 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028153,,,,4540291000.0,45402910.0,DRR032756,0:100 1:0,A:1237914068;C:1042346110;G:1033172731;T:1226799791;N:58300,100,0,,,1237914068,1042346110,1033172731,1226799791,58300,DRX029562,DRS049961,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92628,,0.10478,,0.7391,,0.46461,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Undetermined,Embryo,Whole Organism,All anatomical structures 69,DRR032755,DRX029561,DRS049960,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 90epiboly 2,SAMD00028152,,sample name:Dr 90epiboly 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:90epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028152,DRX029561,Dr 90epiboly 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028152,,,,3572358600.0,35723586.0,DRR032755,0:100 1:0,A:971653450;C:821326559;G:816855636;T:962477457;N:45498,100,0,,,971653450,821326559,816855636,962477457,45498,DRX029561,DRS049960,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92485,,0.10642,,0.74213,,0.47012,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 70,DRR032754,DRX029560,DRS049959,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 90epiboly 1,SAMD00028151,,sample name:Dr 90epiboly 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:90epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028151,DRX029560,Dr 90epiboly 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028151,,,,3423980500.0,34239805.0,DRR032754,0:100 1:0,A:933088185;C:785251613;G:780911148;T:924686406;N:43148,100,0,,,933088185,785251613,780911148,924686406,43148,DRX029560,DRS049959,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92436,,0.10881,,0.74255,,0.47068,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 71,DRR032753,DRX029559,DRS049958,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 114 individuals,Dr 8cell 2,SAMD00028150,,sample name:Dr 8cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028150,DRX029559,Dr 8cell 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028150,,,,3708921900.0,37089219.0,DRR032753,0:100 1:0,A:985502141;C:874161613;G:869551685;T:979663686;N:42775,100,0,,,985502141,874161613,869551685,979663686,42775,DRX029559,DRS049958,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93329,,0.02366,,0.78896,,0.47447,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 72,DRR032752,DRX029558,DRS049957,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 96 individuals,Dr 8cell 1,SAMD00028149,,sample name:Dr 8cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:8cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028149,DRX029558,Dr 8cell 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028149,,,,3666991200.0,36669912.0,DRR032752,0:100 1:0,A:976118513;C:862559696;G:858017821;T:970254302;N:40868,100,0,,,976118513,862559696,858017821,970254302,40868,DRX029558,DRS049957,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.934,,0.02403,,0.78877,,0.46902,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 73,DRR032751,DRX029557,DRS049956,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 75epiboly 2,SAMD00028148,,sample name:Dr 75epiboly 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:75epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028148,DRX029557,Dr 75epiboly 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028148,,,,3252021500.0,32520215.0,DRR032751,0:100 1:0,A:885527595;C:746750899;G:742907892;T:876794123;N:40991,100,0,,,885527595,746750899,742907892,876794123,40991,DRX029557,DRS049956,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92594,,0.10181,,0.74862,,0.47789,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 74,DRR032750,DRX029556,DRS049955,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 75epiboly 1,SAMD00028147,,sample name:Dr 75epiboly 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:75epiboly|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028147,DRX029556,Dr 75epiboly 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028147,,,,3785053700.0,37850537.0,DRR032750,0:100 1:0,A:1029014798;C:870946157;G:867537069;T:1017508684;N:46992,100,0,,,1029014798,870946157,867537069,1017508684,46992,DRX029556,DRS049955,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92346,,0.10046,,0.74921,,0.47295,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Gastrula,Embryo,Whole Organism,All anatomical structures 75,DRR032749,DRX029555,DRS049954,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 72h 2,SAMD00028146,,sample name:Dr 72h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:72h Protruding mouth|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028146,DRX029555,Dr 72h 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028146,,,,3429795800.0,34297958.0,DRR032749,0:100 1:0,A:928062015;C:792470305;G:786930881;T:922296289;N:36310,100,0,,,928062015,792470305,786930881,922296289,36310,DRX029555,DRS049954,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.91821,,0.09774,,0.65437,,0.46443,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Larval,Larval,Whole Organism,All anatomical structures 76,DRR032748,DRX029554,DRS049953,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 72h 1,SAMD00028145,,sample name:Dr 72h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:72h Protruding mouth|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028145,DRX029554,Dr 72h 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028145,,,,3897194500.0,38971945.0,DRR032748,0:100 1:0,A:1050989414;C:903225496;G:895783177;T:1047153493;N:42920,100,0,,,1050989414,903225496,895783177,1047153493,42920,DRX029554,DRS049953,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92211,,0.09393,,0.65486,,0.45971,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Larval,Larval,Whole Organism,All anatomical structures 77,DRR032747,DRX029553,DRS049952,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 6somite 2,SAMD00028144,,sample name:Dr 6somite 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:6somite|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028144,DRX029553,Dr 6somite 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028144,,,,3704431000.0,37044310.0,DRR032747,0:100 1:0,A:1001844161;C:856702913;G:850695568;T:995148798;N:39560,100,0,,,1001844161,856702913,850695568,995148798,39560,DRX029553,DRS049952,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92633,,0.09211,,0.72107,,0.47195,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Segmentation,Embryo,Whole Organism,All anatomical structures 78,DRR032746,DRX029552,DRS049951,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 6somite 1,SAMD00028143,,sample name:Dr 6somite 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:6somite|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028143,DRX029552,Dr 6somite 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028143,,,,3529311900.0,35293119.0,DRR032746,0:100 1:0,A:953957996;C:816824469;G:811403696;T:947089530;N:36209,100,0,,,953957996,816824469,811403696,947089530,36209,DRX029552,DRS049951,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92437,,0.09257,,0.72113,,0.47004,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Segmentation,Embryo,Whole Organism,All anatomical structures 79,DRR032745,DRX029551,DRS049950,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 60h 2,SAMD00028142,,sample name:Dr 60h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:60h Pec fin|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028142,DRX029551,Dr 60h 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028142,,,,3875337000.0,38753370.0,DRR032745,0:100 1:0,A:1042558903;C:899892111;G:896867583;T:1035981420;N:36983,100,0,,,1042558903,899892111,896867583,1035981420,36983,DRX029551,DRS049950,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.91891,,0.09445,,0.66156,,0.45564,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Hatching,Embryo,Whole Organism,All anatomical structures 80,DRR032744,DRX029550,DRS049949,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 60h 1,SAMD00028141,,sample name:Dr 60h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:60h Pec fin|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028141,DRX029550,Dr 60h 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028141,,,,3538468200.0,35384682.0,DRR032744,0:100 1:0,A:960664313;C:812459988;G:809014008;T:956295205;N:34686,100,0,,,960664313,812459988,809014008,956295205,34686,DRX029550,DRS049949,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.91388,,0.10346,,0.66076,,0.45203,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Hatching,Embryo,Whole Organism,All anatomical structures 81,DRR032743,DRX029549,DRS049948,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 5day 3,SAMD00028140,,sample name:Dr 5day 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028140,DRX029549,Dr 5day 3,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028140,,,,3884716000.0,38847160.0,DRR032743,0:100 1:0,A:1040550584;C:905663425;G:904247323;T:1034215019;N:39649,100,0,,,1040550584,905663425,904247323,1034215019,39649,DRX029549,DRS049948,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92219,,0.08287,,0.65863,,0.47377,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Larval,Larval,Whole Organism,All anatomical structures 82,DRR032742,DRX029548,DRS049947,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 5day 2,SAMD00028139,,sample name:Dr 5day 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028139,DRX029548,Dr 5day 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028139,,,,3893708700.0,38937087.0,DRR032742,0:100 1:0,A:1050850168;C:899863467;G:897224776;T:1045729184;N:41105,100,0,,,1050850168,899863467,897224776,1045729184,41105,DRX029548,DRS049947,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.91671,,0.0991,,0.65161,,0.47454,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Larval,Larval,Whole Organism,All anatomical structures 83,DRR032741,DRX029547,DRS049946,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 5day 1,SAMD00028138,,sample name:Dr 5day 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:5day|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028138,DRX029547,Dr 5day 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028138,,,,3807570600.0,38075706.0,DRR032741,0:100 1:0,A:1022590228;C:884655401;G:882546091;T:1017737883;N:40997,100,0,,,1022590228,884655401,882546091,1017737883,40997,DRX029547,DRS049946,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.9182,,0.09442,,0.65525,,0.46661,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Larval,Larval,Whole Organism,All anatomical structures 84,DRR032740,DRX029546,DRS049945,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 48h 2,SAMD00028137,,sample name:Dr 48h 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:48h Long pec|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028137,DRX029546,Dr 48h 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028137,,,,3702804700.0,37028047.0,DRR032740,0:100 1:0,A:993931475;C:862403562;G:857808891;T:988623734;N:37038,100,0,,,993931475,862403562,857808891,988623734,37038,DRX029546,DRS049945,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92508,,0.08526,,0.68349,,0.45769,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Hatching,Embryo,Whole Organism,All anatomical structures 85,DRR032739,DRX029545,DRS049944,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 50 individuals,Dr 48h 1,SAMD00028136,,sample name:Dr 48h 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:48h Long pec|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028136,DRX029545,Dr 48h 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028136,,,,3980240400.0,39802404.0,DRR032739,0:100 1:0,A:1070497788;C:925240883;G:920038728;T:1064422474;N:40527,100,0,,,1070497788,925240883,920038728,1064422474,40527,DRX029545,DRS049944,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92349,,0.08681,,0.67874,,0.46565,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Hatching,Embryo,Whole Organism,All anatomical structures 86,DRR032738,DRX029544,DRS049943,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr 32cell 2,SAMD00028135,,sample name:Dr 32cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028135,DRX029544,Dr 32cell 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028135,,,,3678713000.0,36787130.0,DRR032738,0:100 1:0,A:981005900;C:863203049;G:859660640;T:974807835;N:35576,100,0,,,981005900,863203049,859660640,974807835,35576,DRX029544,DRS049943,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93302,,0.02468,,0.77441,,0.47485,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 87,DRR032737,DRX029543,DRS049942,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 95 individuals,Dr 32cell 1,SAMD00028134,,sample name:Dr 32cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:32cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028134,DRX029543,Dr 32cell 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028134,,,,3870906500.0,38709065.0,DRR032737,0:100 1:0,A:1030407751;C:909948718;G:905608620;T:1024897443;N:43968,100,0,,,1030407751,909948718,905608620,1024897443,43968,DRX029543,DRS049942,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93364,,0.02484,,0.77307,,0.47588,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 88,DRR032736,DRX029542,DRS049941,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr zfs:0000015 2,SAMD00028133,,sample name:Dr zfs:0000015 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:zfs:0000015|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028133,DRX029542,Dr zfs:0000015 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028133,,,,3129028500.0,31290285.0,DRR032736,0:100 1:0,A:849515903;C:721550282;G:717777586;T:840154982;N:29747,100,0,,,849515903,721550282,717777586,840154982,29747,DRX029542,DRS049941,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92724,,0.07971,,0.74657,,0.47796,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Blastula,Embryo,Whole Organism,All anatomical structures 89,DRR032735,DRX029541,DRS049940,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 100 individuals,Dr zfs:0000015 1,SAMD00028132,,sample name:Dr zfs:0000015 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:zfs:0000015|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028132,DRX029541,Dr zfs:0000015 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028132,,,,4310219700.0,43102197.0,DRR032735,0:100 1:0,A:1169701983;C:993241399;G:986263558;T:1160969083;N:43677,100,0,,,1169701983,993241399,986263558,1160969083,43677,DRX029541,DRS049940,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92609,,0.07773,,0.74349,,0.47849,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Blastula,Embryo,Whole Organism,All anatomical structures 90,DRR032734,DRX029540,DRS049939,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 107 individuals,Dr 2cell 2,SAMD00028131,,sample name:Dr 2cell 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028131,DRX029540,Dr 2cell 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028131,,,,3687517000.0,36875170.0,DRR032734,0:100 1:0,A:975272080;C:873518282;G:869743434;T:968941851;N:41353,100,0,,,975272080,873518282,869743434,968941851,41353,DRX029540,DRS049939,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93204,,0.02088,,0.81639,,0.47553,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 91,DRR032733,DRX029539,DRS049938,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 108 individuals,Dr 2cell 1,SAMD00028130,,sample name:Dr 2cell 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:2cell|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028130,DRX029539,Dr 2cell 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028130,,,,4156651100.0,41566511.0,DRR032733,0:100 1:0,A:1099943617;C:985498415;G:978884426;T:1092278665;N:45977,100,0,,,1099943617,985498415,978884426,1092278665,45977,DRX029539,DRS049938,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.93452,,0.02198,,0.81197,,0.47342,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Cleavage,Embryo,Whole Organism,All anatomical structures 92,DRR032732,DRX029538,DRS049937,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 80 individuals,Dr 14somite 3,SAMD00028129,,sample name:Dr 14somite 3|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:14somite|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028129,DRX029538,Dr 14somite 3,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028129,,,,3734610500.0,37346105.0,DRR032732,0:100 1:0,A:1009418541;C:863710067;G:858061383;T:1003378800;N:41709,100,0,,,1009418541,863710067,858061383,1003378800,41709,DRX029538,DRS049937,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92401,,0.08815,,0.70816,,0.46602,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Segmentation,Embryo,Whole Organism,All anatomical structures 93,DRR032731,DRX029537,DRS049936,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 80 individuals,Dr 14somite 2,SAMD00028128,,sample name:Dr 14somite 2|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:14somite|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028128,DRX029537,Dr 14somite 2,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028128,,,,3715174200.0,37151742.0,DRR032731,0:100 1:0,A:1000703508;C:862290629;G:858173468;T:993968396;N:38199,100,0,,,1000703508,862290629,858173468,993968396,38199,DRX029537,DRS049936,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92491,,0.0819,,0.71068,,0.46957,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Segmentation,Embryo,Whole Organism,All anatomical structures 94,DRR032730,DRX029536,DRS049935,DRP003810,PRJDB3785,EXPANDE project,DRP003810,Other,EXPression AloNg Development and Evolution EXPANDE project aims to identify gene expression profiles expanded during embryogenesis and evolution. In brief taking advantages of Illumina sequencing RNAseq profiles of early to late embryos of 8 chordate species were identified with biological replicates two or more biological replicates.,,,mRNA extracted from pooled embryos of 80 individuals,Dr 14somite 1,SAMD00028127,,sample name:Dr 14somite 1|strain:Riken WT Wild Type|tissue type:whole embryo|dev stage:14somite|genotype:wild type|phenotype:wild type|sex:male female and mixed,,,,,,,,,Illumina HiSeq 2000 sequencing of SAMD00028127,DRX029536,Dr 14somite 1,1,Total RNA QIAGEN RNeasy followed by TruSeq,,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina HiSeq 2000,1000Application ReadForward1,DRP003810,Illumina HiSeq 2000 sequencing of SAMD00028127,,,,3744386000.0,37443860.0,DRR032730,0:100 1:0,A:1014537326;C:864070910;G:859190201;T:1006549502;N:38061,100,0,,,1014537326,864070910,859190201,1006549502,38061,DRX029536,DRS049935,DRA003460,"UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo","UT-BS|Lab for embryology, Department of Biological Sciences, University of Tokyo",1,0.92378,,0.08957,,0.7068,,0.47493,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,other,trueseq,bulk,unknown,unknown,,Japan,2017-09-20,Segmentation,Embryo,Whole Organism,All anatomical structures 3015,ERR1396841,ERX1468100,ERS1051448,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 C7,SAMEA3864314,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#24,15616955,Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ATTCCT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#24.cram,cram,252742350.0,5054847.0,SC RUN 18732 2#24,0:50,A:72444190;C:64568625;G:62796637;T:52911792;N:21106,50,,,,72444190,64568625,62796637,52911792,21106,ERX1468100,ERS1051448,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.61824,,0.09608,,0.8842,,0.56978,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Embryo Imprecise,All anatomical structures 3016,ERR1396840,ERX1468099,ERS1051447,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 B12,SAMEA3864313,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864313|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a7dbab0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a7dbab0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#23,15616943,Illumina sequencing of library 15616943 constructed from sample accession ERS1051447 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ACTGAT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#23.cram,cram,911394150.0,18227883.0,SC RUN 18732 2#23,0:50,A:264591252;C:227216187;G:236072241;T:183438530;N:75940,50,,,,264591252,227216187,236072241,183438530,75940,ERX1468099,ERS1051447,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.58273,,0.09754,,0.87448,,0.55833,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3017,ERR1396839,ERX1468098,ERS1051446,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 B10,SAMEA3864312,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864312|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:34Z|INSDC status:public|Submitter Id:2a70e970 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a70e970 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#22,15616931,Illumina sequencing of library 15616931 constructed from sample accession ERS1051446 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence GAGTGG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#22.cram,cram,242466400.0,4849328.0,SC RUN 18732 2#22,0:50,A:69326734;C:60104801;G:65507097;T:47507301;N:20467,50,,,,69326734,60104801,65507097,47507301,20467,ERX1468098,ERS1051446,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.60819,,0.09544,,0.87864,,0.58472,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3018,ERR1396838,ERX1468097,ERS1051445,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 B3,SAMEA3864311,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864311|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:34Z|INSDC status:public|Submitter Id:2a6aa7e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a6aa7e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#21,15616919,Illumina sequencing of library 15616919 constructed from sample accession ERS1051445 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence CGTACG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#21.cram,cram,630737800.0,12614756.0,SC RUN 18732 2#21,0:50,A:180007611;C:161281943;G:164376347;T:125019243;N:52656,50,,,,180007611,161281943,164376347,125019243,52656,ERX1468097,ERS1051445,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.62407,,0.10189,,0.87825,,0.57526,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3019,ERR1396837,ERX1468096,ERS1051444,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 A4,SAMEA3864310,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864310|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:33Z|INSDC status:public|Submitter Id:2a61a730 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a61a730 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#20,15616907,Illumina sequencing of library 15616907 constructed from sample accession ERS1051444 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence GTTTCG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#20.cram,cram,488336450.0,9766729.0,SC RUN 18732 2#20,0:50,A:137910201;C:123586221;G:128373512;T:98425645;N:40871,50,,,,137910201,123586221,128373512,98425645,40871,ERX1468096,ERS1051444,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.5453,,0.11361,,0.86594,,0.58106,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3020,ERR1396836,ERX1468095,ERS1051443,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 A3,SAMEA3864309,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864309|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:32Z|INSDC status:public|Submitter Id:2a5a0610 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a5a0610 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#19,15616895,Illumina sequencing of library 15616895 constructed from sample accession ERS1051443 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence GTGGCC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#19.cram,cram,502748050.0,10054961.0,SC RUN 18732 2#19,0:50,A:140684190;C:129525504;G:133998850;T:98497819;N:41687,50,,,,140684190,129525504,133998850,98497819,41687,ERX1468095,ERS1051443,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.55085,,0.11739,,0.87077,,0.6012,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3021,ERR1396835,ERX1468094,ERS1051442,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 A2,SAMEA3864308,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864308|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:32Z|INSDC status:public|Submitter Id:2a537660 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a537660 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#18,15616883,Illumina sequencing of library 15616883 constructed from sample accession ERS1051442 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence GTGAAA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#18.cram,cram,512343000.0,10246860.0,SC RUN 18732 2#18,0:50,A:149660992;C:130013834;G:134888430;T:97736324;N:43420,50,,,,149660992,130013834,134888430,97736324,43420,ERX1468094,ERS1051442,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.54809,,0.11505,,0.88254,,0.5985,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3022,ERR1396834,ERX1468093,ERS1051441,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 A1,SAMEA3864307,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864307|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:31Z|INSDC status:public|Submitter Id:2a4c4a70 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a4c4a70 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#17,15616871,Illumina sequencing of library 15616871 constructed from sample accession ERS1051441 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence GTCCGC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#17.cram,cram,296362850.0,5927257.0,SC RUN 18732 2#17,0:50,A:84251830;C:79653531;G:76748992;T:55683722;N:24775,50,,,,84251830,79653531,76748992,55683722,24775,ERX1468093,ERS1051441,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.50115,,0.10395,,0.90185,,0.6019,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3023,ERR1396833,ERX1468092,ERS1051440,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer C3,SAMEA3864306,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864306|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:31Z|INSDC status:public|Submitter Id:2a3ba8a0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a3ba8a0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#16,15616954,Illumina sequencing of library 15616954 constructed from sample accession ERS1051440 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence CCGTCC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#16.cram,cram,247427250.0,4948545.0,SC RUN 18732 2#16,0:50,A:69477894;C:64165990;G:64753499;T:49009156;N:20711,50,,,,69477894,64165990,64753499,49009156,20711,ERX1468092,ERS1051440,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.66601,,0.10439,,0.88156,,0.5519,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3024,ERR1396832,ERX1468091,ERS1051439,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer B4,SAMEA3864305,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864305|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:30Z|INSDC status:public|Submitter Id:2a319680 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a319680 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#15,15616942,Illumina sequencing of library 15616942 constructed from sample accession ERS1051439 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ATGTCA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#15.cram,cram,268495550.0,5369911.0,SC RUN 18732 2#15,0:50,A:78316008;C:67311837;G:69086954;T:53758238;N:22513,50,,,,78316008,67311837,69086954,53758238,22513,ERX1468091,ERS1051439,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.61927,,0.0935,,0.89745,,0.55698,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3025,ERR1396831,ERX1468090,ERS1051438,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer A7,SAMEA3864304,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864304|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:29Z|INSDC status:public|Submitter Id:2a2a6a90 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a2a6a90 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#14,15616930,Illumina sequencing of library 15616930 constructed from sample accession ERS1051438 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence AGTTCC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#14.cram,cram,457637200.0,9152744.0,SC RUN 18732 2#14,0:50,A:131304805;C:115755054;G:118778813;T:91760838;N:37690,50,,,,131304805,115755054,118778813,91760838,37690,ERX1468090,ERS1051438,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.64717,,0.09607,,0.89832,,0.56732,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3026,ERR1396830,ERX1468089,ERS1051437,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer A1,SAMEA3864303,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864303|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:29Z|INSDC status:public|Submitter Id:2a238cc0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a238cc0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#13,15616918,Illumina sequencing of library 15616918 constructed from sample accession ERS1051437 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence AGTCAA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#13.cram,cram,156613950.0,3132279.0,SC RUN 18732 2#13,0:50,A:45659102;C:39445557;G:40495414;T:31000827;N:13050,50,,,,45659102,39445557,40495414,31000827,13050,ERX1468089,ERS1051437,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.65923,,0.09289,,0.90096,,0.52171,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3027,ERR1396829,ERX1468088,ERS1051436,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer C1,SAMEA3864302,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864302|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:28Z|INSDC status:public|Submitter Id:2a1b9d80 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a1b9d80 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#12,15616906,Illumina sequencing of library 15616906 constructed from sample accession ERS1051436 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence CTTGTA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#12.cram,cram,370496150.0,7409923.0,SC RUN 18732 2#12,0:50,A:104657486;C:92274677;G:97465315;T:76068240;N:30432,50,,,,104657486,92274677,97465315,76068240,30432,ERX1468088,ERS1051436,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.64244,,0.11811,,0.86578,,0.55798,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3028,ERR1396828,ERX1468087,ERS1051435,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer B3,SAMEA3864301,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864301|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:55Z|INSDC last update:2016 02 03T09:48:28Z|INSDC status:public|Submitter Id:2a0d93c0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a0d93c0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#11,15616894,Illumina sequencing of library 15616894 constructed from sample accession ERS1051435 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence GGCTAC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#11.cram,cram,136326100.0,2726522.0,SC RUN 18732 2#11,0:50,A:38914874;C:34737645;G:36229387;T:26432631;N:11563,50,,,,38914874,34737645,36229387,26432631,11563,ERX1468087,ERS1051435,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.60295,,0.10315,,0.89092,,0.58169,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3029,ERR1396827,ERX1468086,ERS1051434,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer A12,SAMEA3864300,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864300|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:27Z|INSDC status:public|Submitter Id:2a075230 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a075230 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#10,15616882,Illumina sequencing of library 15616882 constructed from sample accession ERS1051434 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence TAGCTT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#10.cram,cram,257740250.0,5154805.0,SC RUN 18732 2#10,0:50,A:73736881;C:64681440;G:67096497;T:52203988;N:21444,50,,,,73736881,64681440,67096497,52203988,21444,ERX1468086,ERS1051434,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.62041,,0.10196,,0.89706,,0.55474,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3030,ERR1396826,ERX1468085,ERS1051433,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer A10,SAMEA3864299,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864299|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:26Z|INSDC status:public|Submitter Id:29ffff30 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29ffff30 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#9,15616870,Illumina sequencing of library 15616870 constructed from sample accession ERS1051433 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence GATCAG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#9.cram,cram,7356000.0,147120.0,SC RUN 18732 2#9,0:50,A:2152284;C:1844982;G:1920243;T:1437897;N:594,50,,,,2152284,1844982,1920243,1437897,594,ERX1468085,ERS1051433,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.60239,,0.10502,,0.91084,,0.55869,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3031,ERR1396825,ERX1468084,ERS1051432,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha C1,SAMEA3864298,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864298|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:26Z|INSDC status:public|Submitter Id:29f306e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29f306e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#8,15616953,Illumina sequencing of library 15616953 constructed from sample accession ERS1051432 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ACTTGA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#8.cram,cram,454519900.0,9090398.0,SC RUN 18732 2#8,0:50,A:133717355;C:117574792;G:114940340;T:88249706;N:37707,50,,,,133717355,117574792,114940340,88249706,37707,ERX1468084,ERS1051432,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.51063,,0.10053,,0.88572,,0.60434,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3032,ERR1396824,ERX1468083,ERS1051431,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha A9,SAMEA3864297,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864297|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:25Z|INSDC status:public|Submitter Id:29e942e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29e942e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#7,15616941,Illumina sequencing of library 15616941 constructed from sample accession ERS1051431 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence CAGATC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#7.cram,cram,288165650.0,5763313.0,SC RUN 18732 2#7,0:50,A:83874531;C:74578491;G:74739497;T:54949008;N:24123,50,,,,83874531,74578491,74739497,54949008,24123,ERX1468083,ERS1051431,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.56561,,0.10234,,0.88278,,0.59066,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3033,ERR1396823,ERX1468082,ERS1051430,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha A6,SAMEA3864296,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864296|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:25Z|INSDC status:public|Submitter Id:29e06940 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29e06940 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#6,15616929,Illumina sequencing of library 15616929 constructed from sample accession ERS1051430 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence GCCAAT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#6.cram,cram,234507600.0,4690152.0,SC RUN 18732 2#6,0:50,A:67284766;C:59565829;G:61407599;T:46229970;N:19436,50,,,,67284766,59565829,61407599,46229970,19436,ERX1468082,ERS1051430,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.64334,,0.10252,,0.88905,,0.5695,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3034,ERR1396822,ERX1468081,ERS1051429,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha A1,SAMEA3864295,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864295|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:24Z|INSDC status:public|Submitter Id:29d74180 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29d74180 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#5,15616917,Illumina sequencing of library 15616917 constructed from sample accession ERS1051429 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ACAGTG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#5.cram,cram,161797350.0,3235947.0,SC RUN 18732 2#5,0:50,A:46711991;C:40739475;G:42456048;T:31876390;N:13446,50,,,,46711991,40739475,42456048,31876390,13446,ERX1468081,ERS1051429,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.64666,,0.09851,,0.90508,,0.56607,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3035,ERR1396821,ERX1468080,ERS1051428,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha B12,SAMEA3864294,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864294|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:23Z|INSDC status:public|Submitter Id:29cf7950 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29cf7950 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#4,15616905,Illumina sequencing of library 15616905 constructed from sample accession ERS1051428 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence TGACCA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#4.cram,cram,393377600.0,7867552.0,SC RUN 18732 2#4,0:50,A:115292812;C:103803007;G:98535312;T:75713409;N:33060,50,,,,115292812,103803007,98535312,75713409,33060,ERX1468080,ERS1051428,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.51888,,0.1037,,0.89948,,0.59445,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3036,ERR1396820,ERX1468079,ERS1051427,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha B10,SAMEA3864293,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864293|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:22Z|INSDC status:public|Submitter Id:29c84d60 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29c84d60 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#3,15616893,Illumina sequencing of library 15616893 constructed from sample accession ERS1051427 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence TTAGGC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#3.cram,cram,211138300.0,4222766.0,SC RUN 18732 2#3,0:50,A:60487130;C:53019786;G:55472125;T:42141858;N:17401,50,,,,60487130,53019786,55472125,42141858,17401,ERX1468079,ERS1051427,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.57434,,0.11571,,0.88633,,0.6058,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3037,ERR1396819,ERX1468078,ERS1051426,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha B7,SAMEA3864292,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864292|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:22Z|INSDC status:public|Submitter Id:29b1df30 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29b1df30 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#2,15616881,Illumina sequencing of library 15616881 constructed from sample accession ERS1051426 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence CGATGT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#2.cram,cram,318903600.0,6378072.0,SC RUN 18732 2#2,0:50,A:91235181;C:80984947;G:84861359;T:61795663;N:26450,50,,,,91235181,80984947,84861359,61795663,26450,ERX1468078,ERS1051426,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.57408,,0.11398,,0.87629,,0.60954,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3038,ERR1396818,ERX1468077,ERS1051425,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha B1,SAMEA3864291,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864291|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:55Z|INSDC last update:2016 02 03T09:48:20Z|INSDC status:public|Submitter Id:29904d70 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29904d70 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#1,15616869,Illumina sequencing of library 15616869 constructed from sample accession ERS1051425 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ATCACG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#1.cram,cram,411180300.0,8223606.0,SC RUN 18732 2#1,0:50,A:118946374;C:103897659;G:107565667;T:80736319;N:34281,50,,,,118946374,103897659,107565667,80736319,34281,ERX1468077,ERS1051425,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.60674,,0.11483,,0.90258,,0.54833,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3039,ERR1396817,ERX1468076,ERS1051448,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 C7,SAMEA3864314,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#24,15616955,Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ATTCCT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#24.cram,cram,258624300.0,5172486.0,SC RUN 18732 1#24,0:50,A:74123846;C:66047722;G:64286422;T:54141623;N:24687,50,,,,74123846,66047722,64286422,54141623,24687,ERX1468076,ERS1051448,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.62009,,0.09612,,0.88434,,0.55718,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Embryo Imprecise,All anatomical structures 3040,ERR1396816,ERX1468075,ERS1051447,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 B12,SAMEA3864313,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864313|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a7dbab0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a7dbab0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#23,15616943,Illumina sequencing of library 15616943 constructed from sample accession ERS1051447 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ACTGAT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#23.cram,cram,932669450.0,18653389.0,SC RUN 18732 1#23,0:50,A:270743929;C:232449590;G:241669732;T:187716399;N:89800,50,,,,270743929,232449590,241669732,187716399,89800,ERX1468075,ERS1051447,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.58314,,0.09813,,0.87373,,0.55534,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3041,ERR1396815,ERX1468074,ERS1051446,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 B10,SAMEA3864312,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864312|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:34Z|INSDC status:public|Submitter Id:2a70e970 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a70e970 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#22,15616931,Illumina sequencing of library 15616931 constructed from sample accession ERS1051446 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence GAGTGG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#22.cram,cram,247740600.0,4954812.0,SC RUN 18732 1#22,0:50,A:70832472;C:61402287;G:66930146;T:48552217;N:23478,50,,,,70832472,61402287,66930146,48552217,23478,ERX1468074,ERS1051446,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.60866,,0.09645,,0.87842,,0.56581,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3042,ERR1396814,ERX1468073,ERS1051445,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 B3,SAMEA3864311,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864311|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:34Z|INSDC status:public|Submitter Id:2a6aa7e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a6aa7e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#21,15616919,Illumina sequencing of library 15616919 constructed from sample accession ERS1051445 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence CGTACG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#21.cram,cram,644730800.0,12894616.0,SC RUN 18732 1#21,0:50,A:183986486;C:164794735;G:168072875;T:127815308;N:61396,50,,,,183986486,164794735,168072875,127815308,61396,ERX1468073,ERS1051445,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.62529,,0.10255,,0.87673,,0.58496,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3043,ERR1396813,ERX1468072,ERS1051444,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 A4,SAMEA3864310,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864310|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:33Z|INSDC status:public|Submitter Id:2a61a730 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a61a730 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#20,15616907,Illumina sequencing of library 15616907 constructed from sample accession ERS1051444 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence GTTTCG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#20.cram,cram,498997400.0,9979948.0,SC RUN 18732 1#20,0:50,A:140918075;C:126256924;G:131206962;T:100567098;N:48341,50,,,,140918075,126256924,131206962,100567098,48341,ERX1468072,ERS1051444,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.54672,,0.11372,,0.8659,,0.58386,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3044,ERR1396812,ERX1468071,ERS1051443,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 A3,SAMEA3864309,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864309|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:32Z|INSDC status:public|Submitter Id:2a5a0610 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a5a0610 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#19,15616895,Illumina sequencing of library 15616895 constructed from sample accession ERS1051443 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence GTGGCC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#19.cram,cram,513060400.0,10261208.0,SC RUN 18732 1#19,0:50,A:143572990;C:132143361;G:136785883;T:100508957;N:49209,50,,,,143572990,132143361,136785883,100508957,49209,ERX1468071,ERS1051443,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.55168,,0.11683,,0.86868,,0.59303,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3045,ERR1396811,ERX1468070,ERS1051442,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 A2,SAMEA3864308,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864308|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:32Z|INSDC status:public|Submitter Id:2a537660 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a537660 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#18,15616883,Illumina sequencing of library 15616883 constructed from sample accession ERS1051442 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence GTGAAA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#18.cram,cram,522864750.0,10457295.0,SC RUN 18732 1#18,0:50,A:152695334;C:132665110;G:137681171;T:99772629;N:50506,50,,,,152695334,132665110,137681171,99772629,50506,ERX1468070,ERS1051442,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.54885,,0.11528,,0.88176,,0.60373,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3046,ERR1396810,ERX1468069,ERS1051441,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 A1,SAMEA3864307,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864307|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:31Z|INSDC status:public|Submitter Id:2a4c4a70 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a4c4a70 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#17,15616871,Illumina sequencing of library 15616871 constructed from sample accession ERS1051441 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence GTCCGC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#17.cram,cram,302165250.0,6043305.0,SC RUN 18732 1#17,0:50,A:85905345;C:81184773;G:78275206;T:56770744;N:29182,50,,,,85905345,81184773,78275206,56770744,29182,ERX1468069,ERS1051441,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.50199,,0.10346,,0.90118,,0.59572,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3047,ERR1396809,ERX1468068,ERS1051440,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer C3,SAMEA3864306,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864306|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:31Z|INSDC status:public|Submitter Id:2a3ba8a0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a3ba8a0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#16,15616954,Illumina sequencing of library 15616954 constructed from sample accession ERS1051440 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence CCGTCC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#16.cram,cram,252866050.0,5057321.0,SC RUN 18732 1#16,0:50,A:71001103;C:65550329;G:66199420;T:50091388;N:23810,50,,,,71001103,65550329,66199420,50091388,23810,ERX1468068,ERS1051440,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.66563,,0.10454,,0.88239,,0.53964,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3048,ERR1396808,ERX1468067,ERS1051439,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer B4,SAMEA3864305,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864305|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:30Z|INSDC status:public|Submitter Id:2a319680 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a319680 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#15,15616942,Illumina sequencing of library 15616942 constructed from sample accession ERS1051439 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ATGTCA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#15.cram,cram,274471250.0,5489425.0,SC RUN 18732 1#15,0:50,A:80060226;C:68799356;G:70635515;T:54950129;N:26024,50,,,,80060226,68799356,70635515,54950129,26024,ERX1468067,ERS1051439,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.61964,,0.09406,,0.89402,,0.55473,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3049,ERR1396807,ERX1468066,ERS1051438,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer A7,SAMEA3864304,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864304|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:29Z|INSDC status:public|Submitter Id:2a2a6a90 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a2a6a90 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#14,15616930,Illumina sequencing of library 15616930 constructed from sample accession ERS1051438 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence AGTTCC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#14.cram,cram,467847600.0,9356952.0,SC RUN 18732 1#14,0:50,A:134225837;C:118320475;G:121443773;T:93812243;N:45272,50,,,,134225837,118320475,121443773,93812243,45272,ERX1468066,ERS1051438,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.64705,,0.096,,0.8983,,0.56022,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3050,ERR1396806,ERX1468065,ERS1051437,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer A1,SAMEA3864303,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864303|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:29Z|INSDC status:public|Submitter Id:2a238cc0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a238cc0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#13,15616918,Illumina sequencing of library 15616918 constructed from sample accession ERS1051437 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence AGTCAA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#13.cram,cram,160243100.0,3204862.0,SC RUN 18732 1#13,0:50,A:46708835;C:40347424;G:41434539;T:31737029;N:15273,50,,,,46708835,40347424,41434539,31737029,15273,ERX1468065,ERS1051437,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.65975,,0.09405,,0.90065,,0.54178,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3051,ERR1396805,ERX1468064,ERS1051436,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer C1,SAMEA3864302,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864302|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:28Z|INSDC status:public|Submitter Id:2a1b9d80 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a1b9d80 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#12,15616906,Illumina sequencing of library 15616906 constructed from sample accession ERS1051436 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence CTTGTA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#12.cram,cram,378715650.0,7574313.0,SC RUN 18732 1#12,0:50,A:106991982;C:94292878;G:99663404;T:77730801;N:36585,50,,,,106991982,94292878,99663404,77730801,36585,ERX1468064,ERS1051436,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.64513,,0.11804,,0.86525,,0.55346,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3052,ERR1396804,ERX1468063,ERS1051435,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer B3,SAMEA3864301,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864301|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:55Z|INSDC last update:2016 02 03T09:48:28Z|INSDC status:public|Submitter Id:2a0d93c0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a0d93c0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#11,15616894,Illumina sequencing of library 15616894 constructed from sample accession ERS1051435 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence GGCTAC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#11.cram,cram,139094000.0,2781880.0,SC RUN 18732 1#11,0:50,A:39702275;C:35436377;G:36969525;T:26972594;N:13229,50,,,,39702275,35436377,36969525,26972594,13229,ERX1468063,ERS1051435,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.60357,,0.10386,,0.88872,,0.5774,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3053,ERR1396803,ERX1468062,ERS1051434,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer A12,SAMEA3864300,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864300|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:27Z|INSDC status:public|Submitter Id:2a075230 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a075230 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#10,15616882,Illumina sequencing of library 15616882 constructed from sample accession ERS1051434 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence TAGCTT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#10.cram,cram,263295150.0,5265903.0,SC RUN 18732 1#10,0:50,A:75332297;C:66059671;G:68562462;T:53315439;N:25281,50,,,,75332297,66059671,68562462,53315439,25281,ERX1468062,ERS1051434,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.61939,,0.10112,,0.89613,,0.55542,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3054,ERR1396802,ERX1468061,ERS1051433,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph229 dicer A10,SAMEA3864299,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864299|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:26Z|INSDC status:public|Submitter Id:29ffff30 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for dicer allele sa9205. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29ffff30 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#9,15616870,Illumina sequencing of library 15616870 constructed from sample accession ERS1051433 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence GATCAG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#9.cram,cram,7506900.0,150138.0,SC RUN 18732 1#9,0:50,A:2194276;C:1883363;G:1959471;T:1468994;N:796,50,,,,2194276,1883363,1959471,1468994,796,ERX1468061,ERS1051433,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.60026,,0.10518,,0.91106,,0.55508,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3055,ERR1396801,ERX1468060,ERS1051432,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha C1,SAMEA3864298,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864298|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:26Z|INSDC status:public|Submitter Id:29f306e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29f306e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#8,15616953,Illumina sequencing of library 15616953 constructed from sample accession ERS1051432 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ACTTGA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#8.cram,cram,464447300.0,9288946.0,SC RUN 18732 1#8,0:50,A:136629424;C:120103988;G:117495447;T:90173901;N:44540,50,,,,136629424,120103988,117495447,90173901,44540,ERX1468060,ERS1051432,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.51298,,0.10188,,0.88434,,0.6034,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3056,ERR1396800,ERX1468059,ERS1051431,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha A9,SAMEA3864297,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864297|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:25Z|INSDC status:public|Submitter Id:29e942e0 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29e942e0 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#7,15616941,Illumina sequencing of library 15616941 constructed from sample accession ERS1051431 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence CAGATC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#7.cram,cram,294666500.0,5893330.0,SC RUN 18732 1#7,0:50,A:85765921;C:76239559;G:76452231;T:56180868;N:27921,50,,,,85765921,76239559,76452231,56180868,27921,ERX1468059,ERS1051431,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.56455,,0.10217,,0.88286,,0.60374,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3057,ERR1396799,ERX1468058,ERS1051430,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha A6,SAMEA3864296,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864296|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:25Z|INSDC status:public|Submitter Id:29e06940 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29e06940 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#6,15616929,Illumina sequencing of library 15616929 constructed from sample accession ERS1051430 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence GCCAAT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#6.cram,cram,239549350.0,4790987.0,SC RUN 18732 1#6,0:50,A:68726161;C:60828350;G:62739441;T:47232484;N:22914,50,,,,68726161,60828350,62739441,47232484,22914,ERX1468058,ERS1051430,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.64469,,0.1021,,0.88878,,0.58044,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3058,ERR1396798,ERX1468057,ERS1051429,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha A1,SAMEA3864295,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864295|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:24Z|INSDC status:public|Submitter Id:29d74180 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29d74180 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#5,15616917,Illumina sequencing of library 15616917 constructed from sample accession ERS1051429 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ACAGTG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#5.cram,cram,165341300.0,3306826.0,SC RUN 18732 1#5,0:50,A:47735538;C:41622088;G:43392205;T:32575765;N:15704,50,,,,47735538,41622088,43392205,32575765,15704,ERX1468057,ERS1051429,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.64704,,0.09836,,0.90534,,0.56172,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3059,ERR1396797,ERX1468056,ERS1051428,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha B12,SAMEA3864294,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864294|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:23Z|INSDC status:public|Submitter Id:29cf7950 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29cf7950 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#4,15616905,Illumina sequencing of library 15616905 constructed from sample accession ERS1051428 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence TGACCA.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#4.cram,cram,401336200.0,8026724.0,SC RUN 18732 1#4,0:50,A:117609087;C:105872656;G:100576681;T:77238881;N:38895,50,,,,117609087,105872656,100576681,77238881,38895,ERX1468056,ERS1051428,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.51741,,0.10352,,0.89749,,0.58497,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3060,ERR1396796,ERX1468055,ERS1051427,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha B10,SAMEA3864293,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864293|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:22Z|INSDC status:public|Submitter Id:29c84d60 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29c84d60 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#3,15616893,Illumina sequencing of library 15616893 constructed from sample accession ERS1051427 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence TTAGGC.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#3.cram,cram,214767600.0,4295352.0,SC RUN 18732 1#3,0:50,A:61527319;C:53911904;G:56445139;T:42862938;N:20300,50,,,,61527319,53911904,56445139,42862938,20300,ERX1468055,ERS1051427,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.57363,,0.11614,,0.88487,,0.61011,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3061,ERR1396795,ERX1468054,ERS1051426,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha B7,SAMEA3864292,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864292|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:22Z|INSDC status:public|Submitter Id:29b1df30 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29b1df30 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#2,15616881,Illumina sequencing of library 15616881 constructed from sample accession ERS1051426 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence CGATGT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#2.cram,cram,326025150.0,6520503.0,SC RUN 18732 1#2,0:50,A:93261648;C:82767834;G:86798075;T:63166259;N:31334,50,,,,93261648,82767834,86798075,63166259,31334,ERX1468054,ERS1051426,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.57333,,0.11365,,0.87422,,0.60838,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 3062,ERR1396794,ERX1468053,ERS1051425,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph228 drosha B1,SAMEA3864291,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress OrganismPart:Whole embryo|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864291|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:55Z|INSDC last update:2016 02 03T09:48:20Z|INSDC status:public|Submitter Id:29904d70 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample homozygous for drosha allele sa191. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:29904d70 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#1,15616869,Illumina sequencing of library 15616869 constructed from sample accession ERS1051425 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ATCACG.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#1.cram,cram,419669000.0,8393380.0,SC RUN 18732 1#1,0:50,A:121378853;C:106010609;G:109826454;T:82412717;N:40367,50,,,,121378853,106010609,109826454,82412717,40367,ERX1468053,ERS1051425,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.60815,,0.11567,,0.90289,,0.5657,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Whole Organism,All anatomical structures 9361,ERR3011947,ERX3014407,ERS2994081,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Flutamide 2,SAMEA5186582,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186582|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 2|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Flutamide 2 s,Flutamide 2 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:flutamide|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Flutamide_2_R1.fastq.gz,fastq,1754963940.0,23552243.0,E MTAB 7283:Flutamide 2,0:74.51 1:0,A:455444321;C:410713896;G:385640226;T:503155736;N:9761,74,0,,,455444321,410713896,385640226,503155736,9761,ERX3014407,ERS2994081,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94351,,0.11595,,0.67483,,0.48762,,73,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9362,ERR3011946,ERX3014406,ERS2994080,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Flutamide 1,SAMEA5186581,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186581|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 1|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Flutamide 1 s,Flutamide 1 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:flutamide|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Flutamide_1_R1.fastq.gz,fastq,1631102863.0,21898245.0,E MTAB 7283:Flutamide 1,0:74.49 1:0,A:424378341;C:380806325;G:358128992;T:467779945;N:9260,74,0,,,424378341,380806325,358128992,467779945,9260,ERX3014406,ERS2994080,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94332,,0.11797,,0.67596,,0.48847,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9363,ERR3011945,ERX3014405,ERS2994079,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,DMSO 2,SAMEA5186580,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186580|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 2|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:DMSO 2 s,DMSO 2 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_DMSO_2_R1.fastq.gz,fastq,1811573293.0,24316929.0,E MTAB 7283:DMSO 2,0:74.50 1:0,A:470888315;C:423635861;G:396796840;T:520242179;N:10098,74,0,,,470888315,423635861,396796840,520242179,10098,ERX3014405,ERS2994079,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94219,,0.12305,,0.67184,,0.47704,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9364,ERR3011944,ERX3014404,ERS2994078,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,DMSO 1,SAMEA5186579,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186579|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 1|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:DMSO 1 s,DMSO 1 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_DMSO_1_R1.fastq.gz,fastq,1609807409.0,21611475.0,E MTAB 7283:DMSO 1,0:74.49 1:0,A:420253680;C:374436301;G:352526427;T:462581933;N:9068,74,0,,,420253680,374436301,352526427,462581933,9068,ERX3014404,ERS2994078,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94094,,0.12292,,0.67006,,0.48442,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9365,ERR3011943,ERX3014403,ERS2994077,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Cyproter1 2,SAMEA5186578,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186578|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 2|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Cyproterone 2 s,Cyproterone 2 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:cyproter1|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Cyproterone_2_R1.fastq.gz,fastq,1823142918.0,24468337.0,E MTAB 7283:Cyproterone 2,0:74.51 1:0,A:469387174;C:428783310;G:403791044;T:521171021;N:10369,74,0,,,469387174,428783310,403791044,521171021,10369,ERX3014403,ERS2994077,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.9432,,0.11718,,0.67389,,0.4768,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9366,ERR3011942,ERX3014402,ERS2994076,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Cyproter1 1,SAMEA5186577,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186577|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 1|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Cyproterone 1 s,Cyproterone 1 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:cyproter1|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Cyproterone_1_R1.fastq.gz,fastq,1901027130.0,25512731.0,E MTAB 7283:Cyproterone 1,0:74.51 1:0,A:487302419;C:449208827;G:422183780;T:542321577;N:10527,74,0,,,487302419,449208827,422183780,542321577,10527,ERX3014402,ERS2994076,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94427,,0.11318,,0.67294,,0.47183,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9651,ERR3266392,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L001_R1_001.fastq.gz,fastq,603238067.0,8014716.0,E MTAB 7846:sponge tdr gfp positive rep2 lane1,0:75.27 1:0,A:164797697;C:136552121;G:141138007;T:160737152;N:13090,75,0,,,164797697,136552121,141138007,160737152,13090,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95083,,0.06432,,0.71532,,0.50098,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9652,ERR3266393,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L002_R1_001.fastq.gz,fastq,603749720.0,8021069.0,E MTAB 7846:sponge tdr gfp positive rep2 lane2,0:75.27 1:0,A:164972969;C:136661417;G:141205792;T:160896264;N:13278,75,0,,,164972969,136661417,141205792,160896264,13278,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.951,,0.06542,,0.71768,,0.50051,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9653,ERR3266394,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L003_R1_001.fastq.gz,fastq,608154053.0,8079704.0,E MTAB 7846:sponge tdr gfp positive rep2 lane3,0:75.27 1:0,A:166117918;C:137731172;G:142320339;T:161970092;N:14532,75,0,,,166117918,137731172,142320339,161970092,14532,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95155,,0.0657,,0.71634,,0.49493,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9654,ERR3266395,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L004_R1_001.fastq.gz,fastq,599143392.0,7959897.0,E MTAB 7846:sponge tdr gfp positive rep2 lane4,0:75.27 1:0,A:163706904;C:135622453;G:140192351;T:159605249;N:16435,75,0,,,163706904,135622453,140192351,159605249,16435,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95061,,0.06431,,0.71764,,0.50166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9655,ERR3266388,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L001_R1_001.fastq.gz,fastq,616761505.0,8202480.0,E MTAB 7846:sponge tdr gfp positive rep1 lane1,0:75.19 1:0,A:168679238;C:139548565;G:143969797;T:164545362;N:18543,75,0,,,168679238,139548565,143969797,164545362,18543,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95019,,0.06806,,0.7097,,0.50337,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9656,ERR3266389,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L002_R1_001.fastq.gz,fastq,617529482.0,8212485.0,E MTAB 7846:sponge tdr gfp positive rep1 lane2,0:75.19 1:0,A:168925757;C:139655387;G:144096837;T:164831236;N:20265,75,0,,,168925757,139655387,144096837,164831236,20265,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9492,,0.06753,,0.712,,0.49881,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9657,ERR3266390,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L003_R1_001.fastq.gz,fastq,624156883.0,8300861.0,E MTAB 7846:sponge tdr gfp positive rep1 lane3,0:75.19 1:0,A:170696950;C:141302376;G:145759286;T:166377781;N:20490,75,0,,,170696950,141302376,145759286,166377781,20490,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94917,,0.06724,,0.71291,,0.50783,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9658,ERR3266391,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L004_R1_001.fastq.gz,fastq,615013615.0,8179180.0,E MTAB 7846:sponge tdr gfp positive rep1 lane4,0:75.19 1:0,A:168237742;C:139106952;G:143535658;T:164110735;N:22528,75,0,,,168237742,139106952,143535658,164110735,22528,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94892,,0.06723,,0.71206,,0.50775,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9659,ERR3266384,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L001_R1_001.fastq.gz,fastq,659562366.0,8762947.0,E MTAB 7846:sponge tdr gfp negative rep2 lane1,0:75.27 1:0,A:178744772;C:150091912;G:155092318;T:175619332;N:14032,75,0,,,178744772,150091912,155092318,175619332,14032,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9517,,0.06908,,0.70822,,0.48025,,73,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9660,ERR3266385,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L002_R1_001.fastq.gz,fastq,658688825.0,8751176.0,E MTAB 7846:sponge tdr gfp negative rep2 lane2,0:75.27 1:0,A:178540155;C:149844100;G:154850294;T:175438757;N:15519,75,0,,,178540155,149844100,154850294,175438757,15519,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95059,,0.06748,,0.70806,,0.48177,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9661,ERR3266386,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L003_R1_001.fastq.gz,fastq,665901310.0,8846927.0,E MTAB 7846:sponge tdr gfp negative rep2 lane3,0:75.27 1:0,A:180412445;C:151589489;G:156677030;T:177206192;N:16154,75,0,,,180412445,151589489,156677030,177206192,16154,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95095,,0.06855,,0.7082,,0.4787,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures