rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
25162,SRR25655085,SRX21381122,SRS18622091,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 8 AU1038 STRSS4,GSM7712891,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 8 AU1038 STRSS4,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712891,GSM7712891: Sample 8 AU1038 STRSS4; Danio rerio; ncRNA Seq,GSM7712891 r1,GSM7712891,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS04_10932AAD_TGTCCTAC-ACATGAGT_R1_001.fastq.gz,fastq,641236400.0,12824728.0,GSM7712891 r1,0:50,A:183546979;C:159774155;G:156033079;T:141881902;N:285,50,,,,183546979,159774155,156033079,141881902,285,SRX21381122,SRS18622091,SRA1693666,CNAG,CNAG,1,0.4736,,0.03992,,0.96788,,0.87662,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25163,SRR25655086,SRX21381121,SRS18622090,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 7 AU1037 STRSS3,GSM7712890,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 7 AU1037 STRSS3,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712890,GSM7712890: Sample 7 AU1037 STRSS3; Danio rerio; ncRNA Seq,GSM7712890 r1,GSM7712890,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS03_10931AAD_GCACGATT-CGTCTGCA_R1_001.fastq.gz,fastq,434646850.0,8692937.0,GSM7712890 r1,0:50,A:126760670;C:102577685;G:109591447;T:95716876;N:172,50,,,,126760670,102577685,109591447,95716876,172,SRX21381121,SRS18622090,SRA1693666,CNAG,CNAG,1,0.52132,,0.04615,,0.96477,,0.85481,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25164,SRR25655087,SRX21381120,SRS18622089,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 6 AU1036 STRSS2,GSM7712889,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 6 AU1036 STRSS2,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712889,GSM7712889: Sample 6 AU1036 STRSS2; Danio rerio; ncRNA Seq,GSM7712889 r1,GSM7712889,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS02_10930AAD_ATGAAGCG-GCGGACAG_R1_001.fastq.gz,fastq,907610650.0,18152213.0,GSM7712889 r1,0:50,A:271494673;C:215304417;G:220608756;T:200202267;N:537,50,,,,271494673,215304417,220608756,200202267,537,SRX21381120,SRS18622089,SRA1693666,CNAG,CNAG,1,0.44189,,0.03477,,0.97335,,0.88092,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25165,SRR25655088,SRX21381119,SRS18622088,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 5 AU1035 STRSS1,GSM7712888,,source name:larvae|tissue:larvae|genotype:WT|treatment:From parent chronically stressed|geo loc name:missing|collection date:missing,Sample 5 AU1035 STRSS1,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:From parent chronically stressed,GSM7712888,GSM7712888: Sample 5 AU1035 STRSS1; Danio rerio; ncRNA Seq,GSM7712888 r1,GSM7712888,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,STRS01_10929AAD_CACTTCGA-TAGGCTTC_R1_001.fastq.gz,fastq,711276100.0,14225522.0,GSM7712888 r1,0:50,A:207284968;C:173540770;G:172961619;T:157488473;N:270,50,,,,207284968,173540770,172961619,157488473,270,SRX21381119,SRS18622088,SRA1693666,CNAG,CNAG,1,0.47865,,0.03881,,0.97001,,0.87616,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25166,SRR25655089,SRX21381118,SRS18622087,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 4 AU1028 CTRL4,GSM7712887,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 4 AU1028 CTRL4,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712887,GSM7712887: Sample 4 AU1028 CTRL4; Danio rerio; ncRNA Seq,GSM7712887 r1,GSM7712887,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL04_10928AAD_GACTAGGC-GCCTCGAC_R1_001.fastq.gz,fastq,568037350.0,11360747.0,GSM7712887 r1,0:50,A:165826590;C:133109854;G:141956673;T:127143732;N:501,50,,,,165826590,133109854,141956673,127143732,501,SRX21381118,SRS18622087,SRA1693666,CNAG,CNAG,1,0.48051,,0.0347,,0.97268,,0.87465,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25167,SRR25655090,SRX21381117,SRS18622086,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 3 AU1027 CTRL3,GSM7712886,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 3 AU1027 CTRL3,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712886,GSM7712886: Sample 3 AU1027 CTRL3; Danio rerio; ncRNA Seq,GSM7712886 r1,GSM7712886,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL03_10927AAD_AGTATACT-CGAATCGG_R1_001.fastq.gz,fastq,651469300.0,13029386.0,GSM7712886 r1,0:50,A:191788726;C:154951271;G:161329211;T:143399936;N:156,50,,,,191788726,154951271,161329211,143399936,156,SRX21381117,SRS18622086,SRA1693666,CNAG,CNAG,1,0.45412,,0.04073,,0.96934,,0.88507,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25168,SRR25655091,SRX21381116,SRS18622085,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 2 AU1026 CTRL2,GSM7712885,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 2 AU1026 CTRL2,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712885,GSM7712885: Sample 2 AU1026 CTRL2; Danio rerio; ncRNA Seq,GSM7712885 r1,GSM7712885,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL02_10926AAD_CCGCGTAG-TTCTGATT_R1_001.fastq.gz,fastq,754615100.0,15092302.0,GSM7712885 r1,0:50,A:217013981;C:184328493;G:188964773;T:164307508;N:345,50,,,,217013981,184328493,188964773,164307508,345,SRX21381116,SRS18622085,SRA1693666,CNAG,CNAG,1,0.48926,,0.04654,,0.96418,,0.8889,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
25169,SRR25655092,SRX21381115,SRS18622084,SRP455342,PRJNA1005926,miR 29a is downregulated in progenies derived from chronically stressed males,GSE240954,Transcriptome Analysis,To investigate the potential vertical transmission of chronic stress to the unexposed larvae to report novel consequences of paternally inherited chronic stress at molecular level Overall design: We then performed small RNA seq profiling in the stress derived group and the control one.,,pubmed:37762407,,Sample 1 AU1024 CTRL1,GSM7712884,,source name:larvae|tissue:larvae|genotype:WT|treatment:Control|geo loc name:missing|collection date:missing,Sample 1 AU1024 CTRL1,Trimming with trim galore v0.6.6 length 16 stringency 10 Mapping with STAR v2.7.8a against GRCz11 Quantification with RSEM v1.3.0 using ensembl release 104 Assembly: GRCz11 Supplementary files format and content: TSV raw counts,larvae,,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,tissue:larvae|genotype:WT|treatment:Control,GSM7712884,GSM7712884: Sample 1 AU1024 CTRL1; Danio rerio; ncRNA Seq,GSM7712884 r1,GSM7712884,1,RNA was harvested using with Qiazol; a miRNeasy tissue kit Qiagen. Only samples meeting the requirements 3 µg of RNA; RNA integrity number RIN > 8 were used in RNA seq analysis.,,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP455342,,loader:fastq load.py,CTRL01_10925AAD_TTAGCCTA-AATCATCA_R1_001.fastq.gz,fastq,670580700.0,13411614.0,GSM7712884 r1,0:50,A:194653643;C:158916446;G:165941477;T:151068917;N:217,50,,,,194653643,158916446,165941477,151068917,217,SRX21381115,SRS18622084,SRA1693666,CNAG,CNAG,1,0.47093,,0.03457,,0.97187,,0.8867,,50,,B,,usable mapping rate,illumina,novaseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Spain,2023-08-16,Larval,Larval,Undetermined,Undetermined
39627,SRR1931774,SRX970023,SRS885229,SRP056603,PRJNA279522,tRNA sequencing in Danio rerio,PRJNA279522,Other,Small RNA sequencing to look for disruption of CCA nucleotidyltransferase activity post TRNT1 knockdown.,,,,WT Danio rerio,tRNAseq000 WT,,breed:not collected|age:5 day|sex:not collected|tissue:whole|phenotype:normal morphology|BioSampleModel:Model organism or animal,,,,,,,,,tRNA sequencing WT,tRNA sequencing WT,WT,1,,,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,1500Application ReadForward1,SRP056603,,,2-WT_S1_L001_R1_001.fastq.gz,fastq,1588656656.0,10577741.0,tRNA sequencing WT,0:150.19 1:0,A:478698865;C:376122807;G:338649726;T:395185202;N:56,150,0,,,478698865,376122807,338649726,395185202,56,SRX970023,SRS885229,SRA248889,University of Iowa|Stephen A. Wynn Institute for Vision Research,University of Iowa,1,3e-05,,0.0,,0.99989,,0.4,,151,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2015-08-09,Larval,Larval,Undetermined,Undetermined
39628,SRR1931761,SRX970012,SRS885221,SRP056603,PRJNA279522,tRNA sequencing in Danio rerio,PRJNA279522,Other,Small RNA sequencing to look for disruption of CCA nucleotidyltransferase activity post TRNT1 knockdown.,,,,TRNT1 KD,tRNAseq000 MO,,breed:not collected|age:5 day|sex:not collected|tissue:whole|phenotype:normal morphology|BioSampleModel:Model organism or animal,,,,,,,,,tRNA sequencing of TRNT1 KD,tRNA sequencing of TRNT1 KD,1,1,,,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,1500Application ReadForward1,SRP056603,,,3-mutant1-TRNT-M0_S2_L001_R1_001.fastq.gz,fastq,1355519463.0,9025087.0,tRNA sequencing of TRNT1 KD,0:150.19 1:0,A:399052503;C:312898077;G:288848586;T:354720282;N:15,150,0,,,399052503,312898077,288848586,354720282,15,SRX970012,SRS885221,SRA248889,University of Iowa|Stephen A. Wynn Institute for Vision Research,University of Iowa,1,0.00012,,0.0,,0.99965,,0.78947,,151,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2015-08-09,Larval,Larval,Undetermined,Undetermined
57144,SRR11218074,SRX7830305,SRS6240984,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 8PY,GSM4369117,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 8PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369117,GSM4369117: SS 8PY; Danio rerio; ncRNA Seq,GSM4369117,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369117,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.8_PYR.fq.gz,fastq,957995832.0,18784232.0,GSM4369117 r1,0:51 1:0,A:228507696;C:213417776;G:258943243;T:257032661;N:94456,51,0,,,228507696,213417776,258943243,257032661,94456,SRX7830305,SRS6240984,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.60772,,0.1313,,0.9877,,0.5307,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57145,SRR11218073,SRX7830304,SRS6240983,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 8IN,GSM4369116,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 8IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369116,GSM4369116: SS 8IN; Danio rerio; ncRNA Seq,GSM4369116,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369116,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.8_INH.fq.gz,fastq,469965.0,9215.0,GSM4369116 r1,0:51 1:0,A:115943;C:105774;G:126829;T:121280;N:139,51,0,,,115943,105774,126829,121280,139,SRX7830304,SRS6240983,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.63582,,0.11966,,0.99628,,0.52244,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57146,SRR11218072,SRX7830303,SRS6240982,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 8Co,GSM4369115,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 8Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369115,GSM4369115: SS 8Co; Danio rerio; ncRNA Seq,GSM4369115,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369115,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.8_Control.fq.gz,fastq,1016301786.0,19927486.0,GSM4369115 r1,0:51 1:0,A:234047138;C:231668317;G:283673780;T:266812487;N:100064,51,0,,,234047138,231668317,283673780,266812487,100064,SRX7830303,SRS6240982,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.45617,,0.08006,,0.98756,,0.53318,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57147,SRR11218071,SRX7830302,SRS6240981,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 7PY,GSM4369114,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 7PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369114,GSM4369114: SS 7PY; Danio rerio; ncRNA Seq,GSM4369114,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369114,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.7_PYR.fq.gz,fastq,994662945.0,19503195.0,GSM4369114 r1,0:51 1:0,A:238913864;C:226034038;G:265449938;T:264166944;N:98161,51,0,,,238913864,226034038,265449938,264166944,98161,SRX7830302,SRS6240981,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.72706,,0.14266,,0.98796,,0.45475,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57148,SRR11218070,SRX7830301,SRS6240980,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 7IN,GSM4369113,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 7IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369113,GSM4369113: SS 7IN; Danio rerio; ncRNA Seq,GSM4369113,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369113,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.7_INH.fq.gz,fastq,698866770.0,13703270.0,GSM4369113 r1,0:51 1:0,A:163946545;C:151571623;G:188671555;T:194609709;N:67338,51,0,,,163946545,151571623,188671555,194609709,67338,SRX7830301,SRS6240980,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.5089,,0.12515,,0.98636,,0.5449,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57149,SRR11218069,SRX7830300,SRS6240979,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 7Co,GSM4369112,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 7Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369112,GSM4369112: SS 7Co; Danio rerio; ncRNA Seq,GSM4369112,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369112,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.7_Control.fq.gz,fastq,675141111.0,13238061.0,GSM4369112 r1,0:51 1:0,A:158015253;C:144827125;G:185064213;T:187168263;N:66257,51,0,,,158015253,144827125,185064213,187168263,66257,SRX7830300,SRS6240979,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.40459,,0.10193,,0.98723,,0.50939,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57150,SRR11218068,SRX7830299,SRS6240978,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 6PY,GSM4369111,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 6PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369111,GSM4369111: SS 6PY; Danio rerio; ncRNA Seq,GSM4369111,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369111,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.6_PYR.fq.gz,fastq,750671142.0,14719042.0,GSM4369111 r1,0:51 1:0,A:179604494;C:169819225;G:201679305;T:199493837;N:74281,51,0,,,179604494,169819225,201679305,199493837,74281,SRX7830299,SRS6240978,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.6831,,0.13287,,0.98739,,0.53779,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57151,SRR11218067,SRX7830298,SRS6240977,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 6IN,GSM4369110,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 6IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369110,GSM4369110: SS 6IN; Danio rerio; ncRNA Seq,GSM4369110,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369110,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.6_INH.fq.gz,fastq,665736915.0,13053665.0,GSM4369110 r1,0:51 1:0,A:157656775;C:147244006;G:178619094;T:182150634;N:66406,51,0,,,157656775,147244006,178619094,182150634,66406,SRX7830298,SRS6240977,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.5998,,0.13571,,0.9867,,0.50064,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57152,SRR11218066,SRX7830297,SRS6240976,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 6Co,GSM4369109,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 6Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369109,GSM4369109: SS 6Co; Danio rerio; ncRNA Seq,GSM4369109,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369109,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.6_Control.fq.gz,fastq,615356565.0,12065815.0,GSM4369109 r1,0:51 1:0,A:145586024;C:131520739;G:167413237;T:170777582;N:58983,51,0,,,145586024,131520739,167413237,170777582,58983,SRX7830297,SRS6240976,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.43246,,0.11481,,0.98721,,0.51875,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57153,SRR11218065,SRX7830296,SRS6240975,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 5PY,GSM4369108,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 5PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369108,GSM4369108: SS 5PY; Danio rerio; ncRNA Seq,GSM4369108,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369108,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.5_PYR.fq.gz,fastq,765220677.0,15004327.0,GSM4369108 r1,0:51 1:0,A:184664309;C:170899633;G:204508602;T:205072262;N:75871,51,0,,,184664309,170899633,204508602,205072262,75871,SRX7830296,SRS6240975,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.68375,,0.14802,,0.98819,,0.54732,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57154,SRR11218064,SRX7830295,SRS6240974,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 5IN,GSM4369107,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 5IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369107,GSM4369107: SS 5IN; Danio rerio; ncRNA Seq,GSM4369107,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369107,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.5_INH.fq.gz,fastq,814440114.0,15969414.0,GSM4369107 r1,0:51 1:0,A:190771507;C:181466379;G:220318895;T:221802003;N:81330,51,0,,,190771507,181466379,220318895,221802003,81330,SRX7830295,SRS6240974,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.58304,,0.11681,,0.98725,,0.53607,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57155,SRR11218063,SRX7830294,SRS6240973,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 5Co,GSM4369106,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 5Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369106,GSM4369106: SS 5Co; Danio rerio; ncRNA Seq,GSM4369106,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369106,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.5_Control.fq.gz,fastq,677415660.0,13282660.0,GSM4369106 r1,0:51 1:0,A:159925012;C:146760884;G:184475935;T:186186960;N:66869,51,0,,,159925012,146760884,184475935,186186960,66869,SRX7830294,SRS6240973,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.48645,,0.11412,,0.98701,,0.5051,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57156,SRR11218062,SRX7830293,SRS6240972,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 4PY,GSM4369105,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 4PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369105,GSM4369105: SS 4PY; Danio rerio; ncRNA Seq,GSM4369105,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369105,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.4_PYR.fq.gz,fastq,708855120.0,13899120.0,GSM4369105 r1,0:51 1:0,A:166247754;C:166449883;G:193535378;T:182549405;N:72700,51,0,,,166247754,166449883,193535378,182549405,72700,SRX7830293,SRS6240972,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.71998,,0.10284,,0.9865,,0.51364,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57157,SRR11218061,SRX7830292,SRS6240971,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 4IN,GSM4369104,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 4IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369104,GSM4369104: SS 4IN; Danio rerio; ncRNA Seq,GSM4369104,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369104,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.4_INH.fq.gz,fastq,1113750597.0,21838247.0,GSM4369104 r1,0:51 1:0,A:258675243;C:241304435;G:306760462;T:306899964;N:110493,51,0,,,258675243,241304435,306760462,306899964,110493,SRX7830292,SRS6240971,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.38867,,0.10253,,0.98739,,0.54594,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57158,SRR11218060,SRX7830291,SRS6240970,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 4Co,GSM4369103,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 4Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369103,GSM4369103: SS 4Co; Danio rerio; ncRNA Seq,GSM4369103,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369103,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.4_Control.fq.gz,fastq,837457944.0,16420744.0,GSM4369103 r1,0:51 1:0,A:194913060;C:201962625;G:234236177;T:206260303;N:85779,51,0,,,194913060,201962625,234236177,206260303,85779,SRX7830291,SRS6240970,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.78427,,0.07281,,0.98938,,0.51853,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57159,SRR11218059,SRX7830290,SRS6240969,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 3PY,GSM4369102,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 3PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369102,GSM4369102: SS 3PY; Danio rerio; ncRNA Seq,GSM4369102,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369102,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.3_PYR.fq.gz,fastq,760961157.0,14920807.0,GSM4369102 r1,0:51 1:0,A:180329733;C:162762377;G:203401780;T:214391898;N:75369,51,0,,,180329733,162762377,203401780,214391898,75369,SRX7830290,SRS6240969,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.52001,,0.13578,,0.98721,,0.54044,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57160,SRR11218058,SRX7830289,SRS6240968,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 3IN,GSM4369101,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 3IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369101,GSM4369101: SS 3IN; Danio rerio; ncRNA Seq,GSM4369101,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369101,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.3_INH.fq.gz,fastq,1018682364.0,19974164.0,GSM4369101 r1,0:51 1:0,A:234817384;C:219512001;G:281378236;T:282876741;N:98002,51,0,,,234817384,219512001,281378236,282876741,98002,SRX7830289,SRS6240968,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.35713,,0.09659,,0.98642,,0.48819,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57161,SRR11218057,SRX7830288,SRS6240967,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 3Co,GSM4369100,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 3Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369100,GSM4369100: SS 3Co; Danio rerio; ncRNA Seq,GSM4369100,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369100,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.3_Control.fq.gz,fastq,801765339.0,15720889.0,GSM4369100 r1,0:51 1:0,A:188213764;C:176265401;G:220274116;T:216937235;N:74823,51,0,,,188213764,176265401,220274116,216937235,74823,SRX7830288,SRS6240967,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.49039,,0.09948,,0.98794,,0.53195,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57162,SRR11218056,SRX7830287,SRS6240966,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 2PY,GSM4369099,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 2PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369099,GSM4369099: SS 2PY; Danio rerio; ncRNA Seq,GSM4369099,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369099,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.2_PYR.fq.gz,fastq,574313805.0,11261055.0,GSM4369099 r1,0:51 1:0,A:135292244;C:131200630;G:155228609;T:152535200;N:57122,51,0,,,135292244,131200630,155228609,152535200,57122,SRX7830287,SRS6240966,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.66365,,0.11507,,0.98687,,0.51107,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57163,SRR11218055,SRX7830286,SRS6240965,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 2IN,GSM4369098,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 2IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369098,GSM4369098: SS 2IN; Danio rerio; ncRNA Seq,GSM4369098,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369098,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.2_INH.fq.gz,fastq,807418230.0,15831730.0,GSM4369098 r1,0:51 1:0,A:190588465;C:176108754;G:219052662;T:221586329;N:82020,51,0,,,190588465,176108754,219052662,221586329,82020,SRX7830286,SRS6240965,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.47844,,0.10981,,0.98723,,0.54721,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57164,SRR11218054,SRX7830285,SRS6240964,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 2Co,GSM4369097,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 2Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369097,GSM4369097: SS 2Co; Danio rerio; ncRNA Seq,GSM4369097,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369097,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.2_Control.fq.gz,fastq,932774037.0,18289687.0,GSM4369097 r1,0:51 1:0,A:218099260;C:200897948;G:257769791;T:255915444;N:91594,51,0,,,218099260,200897948,257769791,255915444,91594,SRX7830285,SRS6240964,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.42164,,0.09363,,0.98746,,0.53483,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57165,SRR11218053,SRX7830284,SRS6240963,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 1PY,GSM4369096,,tissue:PYR 5dpf larvae|developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,SS 1PY,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",PYR 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:PYR|molecule subtype:small RNA,GSM4369096,GSM4369096: SS 1PY; Danio rerio; ncRNA Seq,GSM4369096,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369096,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.1_PYR.fq.gz,fastq,616504422.0,12088322.0,GSM4369096 r1,0:51 1:0,A:145443705;C:140693898;G:166974890;T:163330321;N:61608,51,0,,,145443705,140693898,166974890,163330321,61608,SRX7830284,SRS6240963,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.65536,,0.11483,,0.9867,,0.53016,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57166,SRR11218052,SRX7830283,SRS6240962,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 1IN,GSM4369095,,tissue:INH 5dpf larvae|developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,SS 1IN,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",INH 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:INH|molecule subtype:small RNA,GSM4369095,GSM4369095: SS 1IN; Danio rerio; ncRNA Seq,GSM4369095,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369095,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.1_INH.fq.gz,fastq,837218142.0,16416042.0,GSM4369095 r1,0:51 1:0,A:194291608;C:181525851;G:230886112;T:230433107;N:81464,51,0,,,194291608,181525851,230886112,230433107,81464,SRX7830283,SRS6240962,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.41653,,0.09487,,0.9877,,0.54467,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined
57167,SRR11218051,SRX7830282,SRS6240961,SRP251357,PRJNA609915,Small RNAs in anti tuberculosis drug induced liver injury,GSE146260,Transcriptome Analysis,The antimicrobials isoniazid and pyrazinamide used for the treatment of tuberculosis are known to cause drug induced liver injury in humans. This limits the effectiveness of tuberculosis treatment resulting in incomplete cure relapse and the development of antimicrobial resistance. MicroRNAs are known to be good biomarkers of disease with the microRNA miR 122 being diagnostic for liver injury. In this study zebrafish larvae were exposed to the anti tuberculosis drugs isoniazid and pyrazinamide at concentrations which demonstrated liver injury by microscopy and histology. The aim of this study is to understand small RNA changes occurring in anti tuberculosis drug induced liver injury and to attempt to identify novel microRNA biomarkers of liver injury. Overall design: Zebrafish larvae were exposed to 6 mM pyrazinamide or 10 mM isoniazid for xxx hours from xxx ttwo xxx dpf Control zebrafish larvae were maintained in system water. post drug exposure larvae were anaesthetised and RNA collected for small RNA sequencing. A total of 24 samples were analysed 8 in each treatment group. A total of 30 zebrafish larvae were pooled for each sample.,,,,SS 1Co,GSM4369094,,tissue:Control 5dpf larvae|developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,SS 1Co,"The raw sequences were quality assessed using fastQC Primer sequences were removed using cutadapt v1.9 and parameters b ""GTTCAGAGTTCTACAGTCCGACGATC"" b ""TGGAATTCTCGGGTGCCAAGG"" b ""GATCGTCGGACTGTAGAACTCTGAAC"" b ""CCTTGGCACCCGAGAATTCCA"" O 6 m 17 –format=fastq followed by removal of the terminal 4 bases from each end. Trimmed sequences were “collapsed” to generate a non redundant set of sequences in a fasta format suitable for mirdeep2 analysis Alignments to the reference miRNA transcript set from mirBase v22 were performed using the mirdeep2.pl software with parameters o 20 l 17 r 100 c Raw ""tag counts"" were processed for differential gene expression analysis using the DESeq2 Bioconductor package. Pairwise comparisons of the two sample groups e.g. cases relative to controls were performed on the normalised tag counts using linear modeling Bioconductor limma package. Genome build: GRCz11; mirBase v22 Supplementary files format and content: Fasta file of trimmed collapsed small RNAs which gives quantitaive information as to the sequence levels of each sequence in each sample",Control 5dpf larvae,Control: Zebrafish larvae were maintained in system water INH: Zebrafish larvae were exposed to 10 mM isoniazid for xxx hours from xxx 5 dpf 30 larvae per sample; PYR: Zebrafish larvae were exposed to 6 mM pyrazinamide for xxx hours from xxx 5 dpf 30 larvae per sample;,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,Zebrafish Danio rerio were maintained at 28.5 °C,developmental stage:5dpf larvae|treatment:Control|molecule subtype:small RNA,GSM4369094,GSM4369094: SS 1Co; Danio rerio; ncRNA Seq,GSM4369094,,1,Total RNA was extracted from pooled zebrafish larvae 30 larvae per sample for qPCR and RNA sequencing. Larvae were fixed in Qiazol post which they were disrupted using a tissue disruptor. Subsequently total RNA was extracted using the miRNeasy mini kit Qiagen Venlo The Netherlands eluted in 30 µl RNAse free water. Libraries were prepared from total RNA samples using the NEXTFLEX small RNA seq Kit v3. Libraries were checked for size purity and concentration with a high sensitivity DNA chip on the Agilent Technologies 2100 Bioanalyzer.,GEO Accession:GSM4369094,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 550,,SRP251357,,,SS.1_Control.fq.gz,fastq,346638432.0,6796832.0,GSM4369094 r1,0:51 1:0,A:80463778;C:81241478;G:96669917;T:88228518;N:34741,51,0,,,80463778,81241478,96669917,88228518,34741,SRX7830282,SRS6240961,SRA1050374,GEO,"Centre for Immunity, Infection and Evolution",1,0.66922,,0.07698,,0.98829,,0.52033,,51,,B,,usable mapping rate,illumina,nextseq,unknown,size_fractionation,unknown,bulk,unknown,unknown,,United States,2020-03-03,Larval,Larval,Undetermined,Undetermined