rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 3015,ERR1396841,ERX1468100,ERS1051448,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 C7,SAMEA3864314,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#24,15616955,Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ATTCCT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#24.cram,cram,252742350.0,5054847.0,SC RUN 18732 2#24,0:50,A:72444190;C:64568625;G:62796637;T:52911792;N:21106,50,,,,72444190,64568625,62796637,52911792,21106,ERX1468100,ERS1051448,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.61824,,0.09608,,0.8842,,0.56978,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Embryo Imprecise,All anatomical structures 3039,ERR1396817,ERX1468076,ERS1051448,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 C7,SAMEA3864314,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#24,15616955,Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ATTCCT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#24.cram,cram,258624300.0,5172486.0,SC RUN 18732 1#24,0:50,A:74123846;C:66047722;G:64286422;T:54141623;N:24687,50,,,,74123846,66047722,64286422,54141623,24687,ERX1468076,ERS1051448,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.62009,,0.09612,,0.88434,,0.55718,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Embryo Imprecise,All anatomical structures 15070,ERR12476466,ERX11852287,ERS17743541,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1219 from a cross with a starved father,1219 Starved,1219S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:193 277029,1219S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1219S_S12_L003_R1_001.fastq.gz,fastq,97592891.0,1298822.0,ena RUN TAB 15 01 2024 21:42:36:193 277030,0:75.14,A:34708924;C:19086989;G:21325291;T:22442527;N:29160,75,,,,34708924,19086989,21325291,22442527,29160,ERX11852287,ERS17743541,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15071,ERR12476447,ERX11852268,ERS17743536,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1203 from a cross with a fed father,1203 Fed,1203F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:179 276991,1203F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1203F_S5_L004_R1_001.fastq.gz,fastq,92134036.0,1226106.0,ena RUN TAB 15 01 2024 21:42:36:179 276992,0:75.14,A:33032252;C:17497320;G:19713134;T:21873197;N:18133,75,,,,33032252,17497320,19713134,21873197,18133,ERX11852268,ERS17743536,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15072,ERR12476437,ERX11852258,ERS17743534,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1118 from a cross with a fed father,1118 Fed,1118F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:172 276971,1118F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1118F_S9_L002_R1_001.fastq.gz,fastq,98606332.0,1311676.0,ena RUN TAB 15 01 2024 21:42:36:172 276972,0:75.18,A:35097475;C:19013865;G:21072825;T:23400976;N:21191,75,,,,35097475,19013865,21072825,23400976,21191,ERX11852258,ERS17743534,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15073,ERR12476468,ERX11852289,ERS17743542,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a fed father,1242D Fed,1242FD,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:194 277033,1242FD,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242FD_S13_L001_R1_001.fastq.gz,fastq,89342488.0,1186885.0,ena RUN TAB 15 01 2024 21:42:36:194 277034,0:75.27,A:31174342;C:17129181;G:18704493;T:22323017;N:11455,75,,,,31174342,17129181,18704493,22323017,11455,ERX11852289,ERS17743542,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15074,ERR12476438,ERX11852259,ERS17743534,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1118 from a cross with a fed father,1118 Fed,1118F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:173 276973,1118F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1118F_S9_L003_R1_001.fastq.gz,fastq,98443412.0,1309747.0,ena RUN TAB 15 01 2024 21:42:36:173 276974,0:75.16,A:35171021;C:18991511;G:20974950;T:23280285;N:25645,75,,,,35171021,18991511,20974950,23280285,25645,ERX11852259,ERS17743534,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15075,ERR12476442,ERX11852263,ERS17743535,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1118 from a cross with a starved father,1118 Starved,1118S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:176 276981,1118S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1118S_S10_L003_R1_001.fastq.gz,fastq,98865255.0,1315357.0,ena RUN TAB 15 01 2024 21:42:36:176 276982,0:75.16,A:34981471;C:19126822;G:21304286;T:23427226;N:25450,75,,,,34981471,19126822,21304286,23427226,25450,ERX11852263,ERS17743535,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15076,ERR12476467,ERX11852288,ERS17743541,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1219 from a cross with a starved father,1219 Starved,1219S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:193 277031,1219S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1219S_S12_L004_R1_001.fastq.gz,fastq,88230016.0,1174256.0,ena RUN TAB 15 01 2024 21:42:36:194 277032,0:75.14,A:31409300;C:17203675;G:19284478;T:20309174;N:23389,75,,,,31409300,17203675,19284478,20309174,23389,ERX11852288,ERS17743541,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15077,ERR12476470,ERX11852291,ERS17743542,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a fed father,1242D Fed,1242FD,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:195 277037,1242FD,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242FD_S13_L003_R1_001.fastq.gz,fastq,93375090.0,1240903.0,ena RUN TAB 15 01 2024 21:42:36:196 277038,0:75.25,A:32510114;C:17950920;G:19575617;T:23324862;N:13577,75,,,,32510114,17950920,19575617,23324862,13577,ERX11852291,ERS17743542,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15078,ERR12476436,ERX11852257,ERS17743534,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1118 from a cross with a fed father,1118 Fed,1118F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:171 276969,1118F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1118F_S9_L001_R1_001.fastq.gz,fastq,94258948.0,1253428.0,ena RUN TAB 15 01 2024 21:42:36:171 276970,0:75.20,A:33713614;C:18157124;G:20086205;T:22277451;N:24554,75,,,,33713614,18157124,20086205,22277451,24554,ERX11852257,ERS17743534,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15079,ERR12476452,ERX11852273,ERS17743538,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1210 from a cross with a fed father,1210 Fed,1210F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:183 277001,1210F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1210F_S7_L001_R1_001.fastq.gz,fastq,96414625.0,1283672.0,ena RUN TAB 15 01 2024 21:42:36:183 277002,0:75.11,A:35605799;C:18366729;G:20807908;T:21594044;N:40145,75,,,,35605799,18366729,20807908,21594044,40145,ERX11852273,ERS17743538,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15080,ERR12476475,ERX11852296,ERS17743544,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a fed father,1242E Fed,1242FE,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:199 277047,1242FE,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242FE_S15_L004_R1_001.fastq.gz,fastq,99581325.0,1325945.0,ena RUN TAB 15 01 2024 21:42:36:199 277048,0:75.10,A:36802442;C:18868511;G:20958294;T:22926783;N:25295,75,,,,36802442,18868511,20958294,22926783,25295,ERX11852296,ERS17743544,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15082,ERR12476473,ERX11852294,ERS17743544,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a fed father,1242E Fed,1242FE,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:198 277043,1242FE,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242FE_S15_L002_R1_001.fastq.gz,fastq,111191327.0,1479982.0,ena RUN TAB 15 01 2024 21:42:36:198 277044,0:75.13,A:40873794;C:21118758;G:23508088;T:25663516;N:27171,75,,,,40873794,21118758,23508088,25663516,27171,ERX11852294,ERS17743544,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15083,ERR12476472,ERX11852293,ERS17743544,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a fed father,1242E Fed,1242FE,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:197 277041,1242FE,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242FE_S15_L001_R1_001.fastq.gz,fastq,105936834.0,1409443.0,ena RUN TAB 15 01 2024 21:42:36:197 277042,0:75.16,A:39084749;C:20103850;G:22336806;T:24384711;N:26718,75,,,,39084749,20103850,22336806,24384711,26718,ERX11852293,ERS17743544,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15084,ERR12476455,ERX11852276,ERS17743538,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1210 from a cross with a fed father,1210 Fed,1210F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:185 277007,1210F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1210F_S7_L004_R1_001.fastq.gz,fastq,91003627.0,1212716.0,ena RUN TAB 15 01 2024 21:42:36:185 277008,0:75.04,A:33677348;C:17299066;G:19585548;T:20403064;N:38601,75,,,,33677348,17299066,19585548,20403064,38601,ERX11852276,ERS17743538,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15085,ERR12476450,ERX11852271,ERS17743537,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1203 from a cross with a starved father,1203 Starved,1203S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:181 276997,1203S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1203S_S6_L003_R1_001.fastq.gz,fastq,93998632.0,1251284.0,ena RUN TAB 15 01 2024 21:42:36:182 276998,0:75.12,A:33959433;C:18143368;G:20041026;T:21824242;N:30563,75,,,,33959433,18143368,20041026,21824242,30563,ERX11852271,ERS17743537,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15086,ERR12476446,ERX11852267,ERS17743536,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1203 from a cross with a fed father,1203 Fed,1203F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:178 276989,1203F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1203F_S5_L003_R1_001.fastq.gz,fastq,102209965.0,1360067.0,ena RUN TAB 15 01 2024 21:42:36:179 276990,0:75.15,A:36554629;C:19466103;G:21890238;T:24276196;N:22799,75,,,,36554629,19466103,21890238,24276196,22799,ERX11852267,ERS17743536,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15087,ERR12476458,ERX11852279,ERS17743539,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1210 from a cross with a starved father,1210 Starved,1210S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:187 277013,1210S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1210S_S8_L003_R1_001.fastq.gz,fastq,109602092.0,1466517.0,ena RUN TAB 15 01 2024 21:42:36:187 277014,0:74.74,A:42677564;C:20838229;G:24413347;T:21498031;N:174921,74,,,,42677564,20838229,24413347,21498031,174921,ERX11852279,ERS17743539,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15088,ERR12476453,ERX11852274,ERS17743538,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1210 from a cross with a fed father,1210 Fed,1210F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:183 277003,1210F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1210F_S7_L002_R1_001.fastq.gz,fastq,100538748.0,1339248.0,ena RUN TAB 15 01 2024 21:42:36:184 277004,0:75.07,A:36966184;C:19156780;G:21758079;T:22618911;N:38794,75,,,,36966184,19156780,21758079,22618911,38794,ERX11852274,ERS17743538,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15089,ERR12476460,ERX11852281,ERS17743540,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1219 from a cross with a fed father,1219 Fed,1219F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:188 277017,1219F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1219F_S11_L001_R1_001.fastq.gz,fastq,102219114.0,1358650.0,ena RUN TAB 15 01 2024 21:42:36:189 277018,0:75.24,A:35886099;C:19931420;G:22057068;T:24325918;N:18609,75,,,,35886099,19931420,22057068,24325918,18609,ERX11852281,ERS17743540,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15090,ERR12476451,ERX11852272,ERS17743537,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1203 from a cross with a starved father,1203 Starved,1203S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:182 276999,1203S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1203S_S6_L004_R1_001.fastq.gz,fastq,84880221.0,1129985.0,ena RUN TAB 15 01 2024 21:42:36:182 277000,0:75.12,A:30708531;C:16338743;G:18094345;T:19712906;N:25696,75,,,,30708531,16338743,18094345,19712906,25696,ERX11852272,ERS17743537,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15091,ERR12476441,ERX11852262,ERS17743535,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1118 from a cross with a starved father,1118 Starved,1118S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:175 276979,1118S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1118S_S10_L002_R1_001.fastq.gz,fastq,99340604.0,1321436.0,ena RUN TAB 15 01 2024 21:42:36:175 276980,0:75.18,A:34996267;C:19218610;G:21486623;T:23616635;N:22469,75,,,,34996267,19218610,21486623,23616635,22469,ERX11852262,ERS17743535,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15092,ERR12476440,ERX11852261,ERS17743535,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1118 from a cross with a starved father,1118 Starved,1118S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:174 276977,1118S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1118S_S10_L001_R1_001.fastq.gz,fastq,94655454.0,1258724.0,ena RUN TAB 15 01 2024 21:42:36:175 276978,0:75.20,A:33514914;C:18282513;G:20410100;T:22427564;N:20363,75,,,,33514914,18282513,20410100,22427564,20363,ERX11852261,ERS17743535,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15093,ERR12476469,ERX11852290,ERS17743542,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a fed father,1242D Fed,1242FD,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:195 277035,1242FD,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242FD_S13_L002_R1_001.fastq.gz,fastq,93346527.0,1240308.0,ena RUN TAB 15 01 2024 21:42:36:195 277036,0:75.26,A:32401771;C:17929540;G:19597511;T:23408465;N:9240,75,,,,32401771,17929540,19597511,23408465,9240,ERX11852290,ERS17743542,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15094,ERR12476462,ERX11852283,ERS17743540,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1219 from a cross with a fed father,1219 Fed,1219F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:190 277021,1219F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1219F_S11_L003_R1_001.fastq.gz,fastq,106745726.0,1419461.0,ena RUN TAB 15 01 2024 21:42:36:190 277022,0:75.20,A:37396946;C:20851140;G:23075114;T:25400364;N:22162,75,,,,37396946,20851140,23075114,25400364,22162,ERX11852283,ERS17743540,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15095,ERR12476479,ERX11852300,ERS17743543,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a starved father,1242D Starved,1242SD,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:202 277055,1242SD,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242SD_S14_L004_R1_001.fastq.gz,fastq,85586412.0,1137781.0,ena RUN TAB 15 01 2024 21:42:36:202 277056,0:75.22,A:29963542;C:16621745;G:18219345;T:20761941;N:19839,75,,,,29963542,16621745,18219345,20761941,19839,ERX11852300,ERS17743543,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15096,ERR12476444,ERX11852265,ERS17743536,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1203 from a cross with a fed father,1203 Fed,1203F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:177 276985,1203F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1203F_S5_L001_R1_001.fastq.gz,fastq,97624173.0,1298240.0,ena RUN TAB 15 01 2024 21:42:36:177 276986,0:75.20,A:34935070;C:18569640;G:20912883;T:23188491;N:18089,75,,,,34935070,18569640,20912883,23188491,18089,ERX11852265,ERS17743536,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15097,ERR12476471,ERX11852292,ERS17743542,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a fed father,1242D Fed,1242FD,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:196 277039,1242FD,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242FD_S13_L004_R1_001.fastq.gz,fastq,83383881.0,1108207.0,ena RUN TAB 15 01 2024 21:42:36:196 277040,0:75.24,A:29091135;C:15949002;G:17455499;T:20878004;N:10241,75,,,,29091135,15949002,17455499,20878004,10241,ERX11852292,ERS17743542,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15098,ERR12476439,ERX11852260,ERS17743534,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1118 from a cross with a fed father,1118 Fed,1118F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:174 276975,1118F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1118F_S9_L004_R1_001.fastq.gz,fastq,88439160.0,1176751.0,ena RUN TAB 15 01 2024 21:42:36:174 276976,0:75.16,A:31652556;C:16996499;G:18832233;T:20937970;N:19902,75,,,,31652556,16996499,18832233,20937970,19902,ERX11852260,ERS17743534,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15099,ERR12476449,ERX11852270,ERS17743537,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1203 from a cross with a starved father,1203 Starved,1203S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:181 276995,1203S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1203S_S6_L002_R1_001.fastq.gz,fastq,94525103.0,1257985.0,ena RUN TAB 15 01 2024 21:42:36:181 276996,0:75.14,A:34035341;C:18242921;G:20233155;T:21988512;N:25174,75,,,,34035341,18242921,20233155,21988512,25174,ERX11852270,ERS17743537,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15100,ERR12476465,ERX11852286,ERS17743541,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1219 from a cross with a starved father,1219 Starved,1219S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:192 277027,1219S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1219S_S12_L002_R1_001.fastq.gz,fastq,97087536.0,1291846.0,ena RUN TAB 15 01 2024 21:42:36:192 277028,0:75.15,A:34386434;C:18969192;G:21277103;T:22430566;N:24241,75,,,,34386434,18969192,21277103,22430566,24241,ERX11852286,ERS17743541,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15101,ERR12476482,ERX11852303,ERS17743545,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a starved father,1242E Starved,1242SE,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:204 277061,1242SE,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242SE_S16_L003_R1_001.fastq.gz,fastq,119572581.0,1595036.0,ena RUN TAB 15 01 2024 21:42:36:204 277062,0:74.97,A:45069577;C:22967641;G:25483351;T:25959672;N:92340,74,,,,45069577,22967641,25483351,25959672,92340,ERX11852303,ERS17743545,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15102,ERR12476459,ERX11852280,ERS17743539,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1210 from a cross with a starved father,1210 Starved,1210S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:188 277015,1210S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1210S_S8_L004_R1_001.fastq.gz,fastq,100688924.0,1347280.0,ena RUN TAB 15 01 2024 21:42:36:188 277016,0:74.73,A:39242841;C:19105480;G:22424580;T:19763164;N:152859,74,,,,39242841,19105480,22424580,19763164,152859,ERX11852280,ERS17743539,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15103,ERR12476481,ERX11852302,ERS17743545,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a starved father,1242E Starved,1242SE,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:203 277059,1242SE,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242SE_S16_L002_R1_001.fastq.gz,fastq,119860507.0,1598259.0,ena RUN TAB 15 01 2024 21:42:36:204 277060,0:74.99,A:44981934;C:23018661;G:25670723;T:26114916;N:74273,74,,,,44981934,23018661,25670723,26114916,74273,ERX11852302,ERS17743545,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15104,ERR12476483,ERX11852304,ERS17743545,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a starved father,1242E Starved,1242SE,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:205 277063,1242SE,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242SE_S16_L004_R1_001.fastq.gz,fastq,108782281.0,1451206.0,ena RUN TAB 15 01 2024 21:42:36:205 277064,0:74.96,A:41041986;C:20859560;G:23168159;T:23635345;N:77231,74,,,,41041986,20859560,23168159,23635345,77231,ERX11852304,ERS17743545,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15105,ERR12476448,ERX11852269,ERS17743537,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1203 from a cross with a starved father,1203 Starved,1203S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:180 276993,1203S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1203S_S6_L001_R1_001.fastq.gz,fastq,89917861.0,1196172.0,ena RUN TAB 15 01 2024 21:42:36:180 276994,0:75.17,A:32511634;C:17340472;G:19179480;T:20857531;N:28744,75,,,,32511634,17340472,19179480,20857531,28744,ERX11852269,ERS17743537,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15106,ERR12476457,ERX11852278,ERS17743539,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1210 from a cross with a starved father,1210 Starved,1210S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:186 277011,1210S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1210S_S8_L002_R1_001.fastq.gz,fastq,110304194.0,1474848.0,ena RUN TAB 15 01 2024 21:42:36:187 277012,0:74.79,A:42702966;C:20952577;G:24773042;T:21724801;N:150808,74,,,,42702966,20952577,24773042,21724801,150808,ERX11852278,ERS17743539,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15107,ERR12476456,ERX11852277,ERS17743539,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1210 from a cross with a starved father,1210 Starved,1210S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:185 277009,1210S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1210S_S8_L001_R1_001.fastq.gz,fastq,106074722.0,1417003.0,ena RUN TAB 15 01 2024 21:42:36:186 277010,0:74.86,A:41208838;C:20151614;G:23770531;T:20792595;N:151144,74,,,,41208838,20151614,23770531,20792595,151144,ERX11852277,ERS17743539,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15108,ERR12476461,ERX11852282,ERS17743540,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1219 from a cross with a fed father,1219 Fed,1219F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:189 277019,1219F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1219F_S11_L002_R1_001.fastq.gz,fastq,106799888.0,1420026.0,ena RUN TAB 15 01 2024 21:42:36:189 277020,0:75.21,A:37294667;C:20842952;G:23154298;T:25488653;N:19318,75,,,,37294667,20842952,23154298,25488653,19318,ERX11852282,ERS17743540,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15109,ERR12476480,ERX11852301,ERS17743545,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a starved father,1242E Starved,1242SE,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:203 277057,1242SE,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242SE_S16_L001_R1_001.fastq.gz,fastq,115150299.0,1534621.0,ena RUN TAB 15 01 2024 21:42:36:203 277058,0:75.04,A:43393516;C:22116575;G:24607338;T:24954423;N:78447,75,,,,43393516,22116575,24607338,24954423,78447,ERX11852301,ERS17743545,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15110,ERR12476464,ERX11852285,ERS17743541,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1219 from a cross with a starved father,1219 Starved,1219S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:191 277025,1219S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1219S_S12_L001_R1_001.fastq.gz,fastq,93625807.0,1245248.0,ena RUN TAB 15 01 2024 21:42:36:192 277026,0:75.19,A:33311180;C:18278250;G:20453262;T:21557661;N:25454,75,,,,33311180,18278250,20453262,21557661,25454,ERX11852285,ERS17743541,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15111,ERR12476474,ERX11852295,ERS17743544,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a fed father,1242E Fed,1242FE,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:198 277045,1242FE,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242FE_S15_L003_R1_001.fastq.gz,fastq,110591461.0,1472278.0,ena RUN TAB 15 01 2024 21:42:36:199 277046,0:75.12,A:40767831;C:21026089;G:23298123;T:25470025;N:29393,75,,,,40767831,21026089,23298123,25470025,29393,ERX11852295,ERS17743544,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15112,ERR12476454,ERX11852275,ERS17743538,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1210 from a cross with a fed father,1210 Fed,1210F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:184 277005,1210F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1210F_S7_L003_R1_001.fastq.gz,fastq,100467804.0,1338769.0,ena RUN TAB 15 01 2024 21:42:36:184 277006,0:75.04,A:37096238;C:19156191;G:21628367;T:22539758;N:47250,75,,,,37096238,19156191,21628367,22539758,47250,ERX11852275,ERS17743538,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15113,ERR12476477,ERX11852298,ERS17743543,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a starved father,1242D Starved,1242SD,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:200 277051,1242SD,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242SD_S14_L002_R1_001.fastq.gz,fastq,95483395.0,1269021.0,ena RUN TAB 15 01 2024 21:42:36:201 277052,0:75.24,A:33251808;C:18599068;G:20397415;T:23215065;N:20039,75,,,,33251808,18599068,20397415,23215065,20039,ERX11852298,ERS17743543,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15114,ERR12476443,ERX11852264,ERS17743535,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1118 from a cross with a starved father,1118 Starved,1118S,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:176 276983,1118S,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1118S_S10_L004_R1_001.fastq.gz,fastq,88773312.0,1181250.0,ena RUN TAB 15 01 2024 21:42:36:177 276984,0:75.15,A:31460448;C:17120679;G:19117608;T:21054486;N:20091,75,,,,31460448,17120679,19117608,21054486,20091,ERX11852264,ERS17743535,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15115,ERR12476476,ERX11852297,ERS17743543,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1242 from a cross with a starved father,1242D Starved,1242SD,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:200 277049,1242SD,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1242SD_S14_L001_R1_001.fastq.gz,fastq,91072875.0,1210121.0,ena RUN TAB 15 01 2024 21:42:36:200 277050,0:75.26,A:31859074;C:17724212;G:19393637;T:22075784;N:20168,75,,,,31859074,17724212,19393637,22075784,20168,ERX11852297,ERS17743543,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15116,ERR12476463,ERX11852284,ERS17743540,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1219 from a cross with a fed father,1219 Fed,1219F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:190 277023,1219F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1219F_S11_L004_R1_001.fastq.gz,fastq,96315015.0,1280935.0,ena RUN TAB 15 01 2024 21:42:36:191 277024,0:75.19,A:33841468;C:18744196;G:20803688;T:22906396;N:19267,75,,,,33841468,18744196,20803688,22906396,19267,ERX11852284,ERS17743540,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 15117,ERR12476445,ERX11852266,ERS17743536,ERP156655,PRJEB71869,Effects of paternal starvation in the offspring development of zebrafish,33b9d14c-4211-4249-aede-f0f021d197e6,Other,Dietary restriction in the form of fasting is a putative key to a healthier and longer life but these benefits may come at a trade off with reproductive fitness and may affect the following generations. The potential inter and transgenerational effects of long term fasting and starvation are particularly poorly understood in vertebrates when they originate from the paternal line. We utilised the externally fertilising zebrafish amenable to a split egg clutch design to explore the male specific effects of fasting/starvation on fertility and fitness of offspring independently of maternal contribution. Eighteen days of fasting resulted in reduced fertility in exposed males. While average offspring survival was not affected we detected increased larval growth rate in F1 offspring from starved males and more malformed embryos at 24 hpf in F2 offspring produced by F1 offspring from starved males. Comparing the transcriptomes of F1 embryos sired by starved and fed fathers revealed robust and reproducible increased expression of muscle composition genes but lower expression of lipid metabolism and lysosome genes in embryos from starved fathers. A large proportion of these genes showed enrichment in the yolk syncytial layer suggesting gene regulatory responses associated with metabolism of nutrients through paternal effects on extra embryonic tissues which are loaded with maternal factors. We compared the embryo transcriptomes to published adult transcriptome datasets and found comparable repressive effects of starvation on metabolism associated genes. These similarities suggest a physiologically relevant directed and potentially adaptive response transmitted by the father independently from the offspring's nutritional state which was defined by the mother.,ENA FIRST PUBLIC:2024 01 15|ENA LAST UPDATE:2024 01 15,,24 hpf embryo collected at 1203 from a cross with a fed father,1203 Fed,1203F,,organism:Danio rerio|collection date:2018 02 02|scientific name:Danio rerio|common name:zebrafish|geographic location country and/or sea:Sweden,,,,,,,,,NextSeq 500 sequencing,ena EXPERIMENT TAB 15 01 2024 21:42:36:178 276987,1203F,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,ERP156655,NextSeq 500 sequencing,ENA FIRST PUBLIC:2024 01 22|ENA LAST UPDATE:2024 01 22,1203F_S5_L002_R1_001.fastq.gz,fastq,102458617.0,1363028.0,ena RUN TAB 15 01 2024 21:42:36:178 276988,0:75.17,A:36510957;C:19511996;G:22025384;T:24392965;N:17315,75,,,,36510957,19511996,22025384,24392965,17315,ERX11852266,ERS17743536,ERA27788968,University of Birmingham|European Nucleotide Archive,University of Birmingham,,,,,,,,,,,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2024-01-15,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures 28690,SRR26535341,SRX22238472,SRS19292733,SRP468564,PRJNA1032461,A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo,GSE246295,Transcriptome Analysis,To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 alongside three control brains from injected siblings who did not develop tumors CTRL 1 3 were dissected for each condition for bulk RNA sequencing. We also performed fluorescent activated cell sorting on pooled dissociated brains from the EPS condition resulting in enrichment for mScarlet postive tumor cells CS Pos and mScarlet negative cells CS Neg for comparative analysis.,,pubmed:39052000,,Pooled EPS brains mScarlet ve Sorted Cells,GSM7866396,,source name:Sorted Cells|strain:CG1 p53null|tissue:Sorted Cells|geo loc name:missing|collection date:missing,Pooled EPS brains mScarlet ve Sorted Cells,Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions.,Sorted Cells,Fertilized embryos injected with either EPS or KPG construct mix,Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations,Zebrafish were housed and reared following approved animal use protocol,strain:CG1 p53null|tissue:Sorted Cells,GSM7866396,GSM7866396: Pooled EPS brains mScarlet ve Sorted Cells; Danio rerio; RNA Seq,GSM7866396 r1,GSM7866396,1,Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP468564,,loader:fastq load.py,CS_Neg.fastq.gz,fastq,6384313020.0,63211020.0,GSM7866396 r1,0:101,A:1646899028;C:1504048934;G:1428638008;T:1804712211;N:14839,101,,,,1646899028,1504048934,1428638008,1804712211,14839,SRX22238472,SRS19292733,SRA1740017,"Hayes Lab, DSCB, Sickkids Research","Hayes Lab, DSCB, Sickkids Research",1,0.94094,,0.14273,,0.67416,,0.48471,,101,,B,,usable mapping rate,illumina,novaseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,Canada,2023-10-26,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 28691,SRR26535342,SRX22238471,SRS19292732,SRP468564,PRJNA1032461,A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo,GSE246295,Transcriptome Analysis,To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 alongside three control brains from injected siblings who did not develop tumors CTRL 1 3 were dissected for each condition for bulk RNA sequencing. We also performed fluorescent activated cell sorting on pooled dissociated brains from the EPS condition resulting in enrichment for mScarlet postive tumor cells CS Pos and mScarlet negative cells CS Neg for comparative analysis.,,pubmed:39052000,,Pooled EPS brains mScarlet+ve Sorted Cells,GSM7866395,,source name:Sorted Cells|strain:CG1 p53null|tissue:Sorted Cells|geo loc name:missing|collection date:missing,Pooled EPS brains mScarlet+ve Sorted Cells,Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions.,Sorted Cells,Fertilized embryos injected with either EPS or KPG construct mix,Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations,Zebrafish were housed and reared following approved animal use protocol,strain:CG1 p53null|tissue:Sorted Cells,GSM7866395,GSM7866395: Pooled EPS brains mScarlet+ve Sorted Cells; Danio rerio; RNA Seq,GSM7866395 r1,GSM7866395,1,Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP468564,,loader:fastq load.py,CS_Pos.fastq.gz,fastq,6221936027.0,61603327.0,GSM7866395 r1,0:101,A:1586867899;C:1467436044;G:1398048259;T:1769569401;N:14424,101,,,,1586867899,1467436044,1398048259,1769569401,14424,SRX22238471,SRS19292732,SRA1740017,"Hayes Lab, DSCB, Sickkids Research","Hayes Lab, DSCB, Sickkids Research",1,0.88463,,0.14567,,0.69126,,0.48428,,101,,B,,usable mapping rate,illumina,novaseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,Canada,2023-10-26,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 28906,SRR26845640,SRX22541146,SRS19550731,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r6,GSM7903226,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r6,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903226,GSM7903226: zebrafish shield 20µM lnamir430 50mM s4u r6; Danio rerio; RNA Seq,GSM7903226 r1,GSM7903226,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_6.fastq.gz,fastq,7432626966.0,73590366.0,GSM7903226 r1,0:101,A:2650382519;C:1367541457;G:1415587402;T:1999115588;N:0,101,,,,2650382519,1367541457,1415587402,1999115588,0,SRX22541146,SRS19550731,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.66888,,0.17305,,0.83465,,0.69037,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28907,SRR26845641,SRX22541145,SRS19550730,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r5,GSM7903225,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r5,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903225,GSM7903225: zebrafish shield 20µM lnamir430 50mM s4u r5; Danio rerio; RNA Seq,GSM7903225 r1,GSM7903225,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_5.fastq.gz,fastq,5517442847.0,54628147.0,GSM7903225 r1,0:101,A:1830971596;C:1020448830;G:1068982055;T:1597040366;N:0,101,,,,1830971596,1020448830,1068982055,1597040366,0,SRX22541145,SRS19550730,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7123,,0.14169,,0.81785,,0.61343,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28908,SRR26845642,SRX22541144,SRS19550729,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r4,GSM7903224,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r4,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903224,GSM7903224: zebrafish shield 20µM lnamir430 50mM s4u r4; Danio rerio; RNA Seq,GSM7903224 r1,GSM7903224,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_4.fastq.gz,fastq,7633894514.0,75583114.0,GSM7903224 r1,0:101,A:2522715535;C:1462363691;G:1540381861;T:2108433427;N:0,101,,,,2522715535,1462363691,1540381861,2108433427,0,SRX22541144,SRS19550729,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71858,,0.20656,,0.83522,,0.6748,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28909,SRR26845643,SRX22541143,SRS19550728,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r3,GSM7903223,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903223,GSM7903223: zebrafish shield 20µM lnamir430 50mM s4u r3; Danio rerio; RNA Seq,GSM7903223 r1,GSM7903223,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_3.fastq.gz,fastq,6740922911.0,66741811.0,GSM7903223 r1,0:101,A:2320670868;C:1251436299;G:1316606507;T:1852209237;N:0,101,,,,2320670868,1251436299,1316606507,1852209237,0,SRX22541143,SRS19550728,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.69597,,0.18028,,0.8341,,0.68324,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28910,SRR26845644,SRX22541142,SRS19550727,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r2,GSM7903222,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903222,GSM7903222: zebrafish shield 20µM lnamir430 50mM s4u r2; Danio rerio; RNA Seq,GSM7903222 r1,GSM7903222,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_2.fastq.gz,fastq,4965369272.0,49162072.0,GSM7903222 r1,0:101,A:1663212628;C:946084438;G:1026397565;T:1326957174;N:2717467,101,,,,1663212628,946084438,1026397565,1326957174,2717467,SRX22541142,SRS19550727,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.67731,,0.17959,,0.84758,,0.35494,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28911,SRR26845645,SRX22541141,SRS19550724,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnamir430 50mM s4u r1,GSM7903221,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnamir430 50mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lna against miR 430 seed and 50mM s4UTP injection,GSM7903221,GSM7903221: zebrafish shield 20µM lnamir430 50mM s4u r1; Danio rerio; RNA Seq,GSM7903221 r1,GSM7903221,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA430_1.fastq.gz,fastq,4180419189.0,41390289.0,GSM7903221 r1,0:101,A:1388136145;C:781877911;G:841117776;T:1166988154;N:2299203,101,,,,1388136145,781877911,841117776,1166988154,2299203,SRX22541141,SRS19550724,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7194,,0.16361,,0.8326,,0.36766,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28912,SRR26845646,SRX22541140,SRS19550726,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r6,GSM7903220,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r6,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903220,GSM7903220: zebrafish shield 20µM lnacontrol 50mM s4u r6; Danio rerio; RNA Seq,GSM7903220 r1,GSM7903220,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_6.fastq.gz,fastq,3528723355.0,34937855.0,GSM7903220 r1,0:101,A:1169270874;C:664348337;G:701284585;T:993819559;N:0,101,,,,1169270874,664348337,701284585,993819559,0,SRX22541140,SRS19550726,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.73609,,0.18234,,0.82789,,0.67273,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28913,SRR26845647,SRX22541139,SRS19550725,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r5,GSM7903219,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r5,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903219,GSM7903219: zebrafish shield 20µM lnacontrol 50mM s4u r5; Danio rerio; RNA Seq,GSM7903219 r1,GSM7903219,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_5.fastq.gz,fastq,6194543716.0,61332116.0,GSM7903219 r1,0:101,A:2097813326;C:1118975109;G:1172439642;T:1805315639;N:0,101,,,,2097813326,1118975109,1172439642,1805315639,0,SRX22541139,SRS19550725,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68662,,0.14858,,0.81931,,0.58494,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28914,SRR26845648,SRX22541138,SRS19550721,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r4,GSM7903218,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r4,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903218,GSM7903218: zebrafish shield 20µM lnacontrol 50mM s4u r4; Danio rerio; RNA Seq,GSM7903218 r1,GSM7903218,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_4.fastq.gz,fastq,7267022619.0,71950719.0,GSM7903218 r1,0:101,A:2506840526;C:1345281143;G:1405742068;T:2009158882;N:0,101,,,,2506840526,1345281143,1405742068,2009158882,0,SRX22541138,SRS19550721,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.66968,,0.17594,,0.83151,,0.65157,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28915,SRR26845649,SRX22541137,SRS19550722,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r3,GSM7903217,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903217,GSM7903217: zebrafish shield 20µM lnacontrol 50mM s4u r3; Danio rerio; RNA Seq,GSM7903217 r1,GSM7903217,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_3.fastq.gz,fastq,5967073536.0,59079936.0,GSM7903217 r1,0:101,A:2104721652;C:1097559356;G:1127515791;T:1637276737;N:0,101,,,,2104721652,1097559356,1127515791,1637276737,0,SRX22541137,SRS19550722,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63706,,0.16097,,0.83461,,0.66484,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28916,SRR26845650,SRX22541136,SRS19550723,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r2,GSM7903216,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903216,GSM7903216: zebrafish shield 20µM lnacontrol 50mM s4u r2; Danio rerio; RNA Seq,GSM7903216 r1,GSM7903216,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_2.fastq.gz,fastq,3643975465.0,36078965.0,GSM7903216 r1,0:101,A:1169767894;C:685310134;G:753541931;T:1033295416;N:2060090,101,,,,1169767894,685310134,753541931,1033295416,2060090,SRX22541136,SRS19550723,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7292,,0.18508,,0.83424,,0.62718,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28917,SRR26845651,SRX22541135,SRS19550720,SRP472251,PRJNA1040920,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [lna data],GSE247930,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 50mM s4 UTP plus 20µM of locked nucleic acid against either miR 430 or mismatched sequence. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish shield 20µM lnacontrol 50mM s4u r1,GSM7903215,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection|geo loc name:missing|collection date:missing,zebrafish shield 20µM lnacontrol 50mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were injected with 1000pL of 50mM s4 UTP plus 20µM of either locked nucleic acid against miR 430 seed or a mismatch oligo.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:1000pL of 20µM lnacontrol and 50mM s4UTP injection,GSM7903215,GSM7903215: zebrafish shield 20µM lnacontrol 50mM s4u r1; Danio rerio; RNA Seq,GSM7903215 r1,GSM7903215,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472251,,loader:fastq load.py,shield_LNA_Mis_1.fastq.gz,fastq,4881473117.0,48331417.0,GSM7903215 r1,0:101,A:1562562452;C:901372607;G:981986460;T:1432839789;N:2711809,101,,,,1562562452,901372607,981986460,1432839789,2711809,SRX22541135,SRS19550720,SRA1751929,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72355,,0.15423,,0.82262,,0.58105,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28918,SRR26845652,SRX22541168,SRS19550753,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 8hour wt 75mM s4u r3,GSM7903274,,tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 8hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 8 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF],GSM7903274,GSM7903274: zebrafish 8hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903274 r1,GSM7903274,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s8h_4.fastq.gz,fastq,5796273345.0,57388845.0,GSM7903274 r1,0:101,A:1987532805;C:1079193337;G:1164388405;T:1561938100;N:3220698,101,,,,1987532805,1079193337,1164388405,1561938100,3220698,SRX22541168,SRS19550753,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.64204,,0.18985,,0.84348,,0.60294,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28919,SRR26845653,SRX22541167,SRS19550752,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 8hour wt 75mM s4u r2,GSM7903273,,tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 8hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 8 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF],GSM7903273,GSM7903273: zebrafish 8hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903273 r1,GSM7903273,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s8h_2.fastq.gz,fastq,4897372941.0,48488841.0,GSM7903273 r1,0:101,A:1699755610;C:929418233;G:1005848571;T:1259595469;N:2755058,101,,,,1699755610,929418233,1005848571,1259595469,2755058,SRX22541167,SRS19550752,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.62249,,0.23058,,0.85782,,0.62172,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28920,SRR26845654,SRX22541166,SRS19550750,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 8hour wt 75mM s4u r1,GSM7903272,,tissue:Embryos at 8 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 8hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 8 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:8 hpf of [AB TU]x[TL TLF],GSM7903272,GSM7903272: zebrafish 8hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903272 r1,GSM7903272,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s8h_1.fastq.gz,fastq,4081964490.0,40415490.0,GSM7903272 r1,0:101,A:1381746632;C:779891737;G:836779689;T:1081260235;N:2286197,101,,,,1381746632,779891737,836779689,1081260235,2286197,SRX22541166,SRS19550750,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63669,,0.23628,,0.8578,,0.61689,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28921,SRR26845655,SRX22541165,SRS19550751,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 7hour wt 75mM s4u r3,GSM7903271,,tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 7hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 7 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF],GSM7903271,GSM7903271: zebrafish 7hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903271 r1,GSM7903271,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s7h_4.fastq.gz,fastq,4851172511.0,48031411.0,GSM7903271 r1,0:101,A:1617620537;C:932157064;G:983796569;T:1314884644;N:2713697,101,,,,1617620537,932157064,983796569,1314884644,2713697,SRX22541165,SRS19550751,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63288,,0.17507,,0.84122,,0.6377,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28922,SRR26845656,SRX22541164,SRS19550748,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 7hour wt 75mM s4u r2,GSM7903270,,tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 7hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 7 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF],GSM7903270,GSM7903270: zebrafish 7hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903270 r1,GSM7903270,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s7h_2.fastq.gz,fastq,4762466029.0,47153129.0,GSM7903270 r1,0:101,A:1617990526;C:900885384;G:944898805;T:1296064007;N:2627307,101,,,,1617990526,900885384,944898805,1296064007,2627307,SRX22541164,SRS19550748,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.64254,,0.23162,,0.84504,,0.62634,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28923,SRR26845657,SRX22541163,SRS19550749,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 7hour wt 75mM s4u r1,GSM7903269,,tissue:Embryos at 7 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 7hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 7 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:7 hpf of [AB TU]x[TL TLF],GSM7903269,GSM7903269: zebrafish 7hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903269 r1,GSM7903269,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s7h_1.fastq.gz,fastq,5021159147.0,49714447.0,GSM7903269 r1,0:101,A:1658742605;C:951972011;G:1025355321;T:1382277303;N:2811907,101,,,,1658742605,951972011,1025355321,1382277303,2811907,SRX22541163,SRS19550749,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71548,,0.24849,,0.82704,,0.65095,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28924,SRR26845658,SRX22541162,SRS19550747,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 6hour wt 75mM s4u r3,GSM7903268,,tissue:Embryos at 6 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 6hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 6 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:6 hpf of [AB TU]x[TL TLF],GSM7903268,GSM7903268: zebrafish 6hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903268 r1,GSM7903268,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s6h_3.fastq.gz,fastq,4548634990.0,45035990.0,GSM7903268 r1,0:101,A:1519559786;C:870914391;G:937154183;T:1218472088;N:2534542,101,,,,1519559786,870914391,937154183,1218472088,2534542,SRX22541162,SRS19550747,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.6699,,0.26195,,0.84756,,0.61557,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28925,SRR26845659,SRX22541161,SRS19550746,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 6hour wt 75mM s4u r2,GSM7903267,,tissue:Embryos at 6 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 6hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 6 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:6 hpf of [AB TU]x[TL TLF],GSM7903267,GSM7903267: zebrafish 6hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903267 r1,GSM7903267,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s6h_2.fastq.gz,fastq,5673879525.0,56177025.0,GSM7903267 r1,0:101,A:1889309422;C:1079098000;G:1157406188;T:1544899367;N:3166548,101,,,,1889309422,1079098000,1157406188,1544899367,3166548,SRX22541161,SRS19550746,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.6803,,0.2063,,0.83078,,0.64225,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28926,SRR26845660,SRX22541160,SRS19550743,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 5hour wt 75mM s4u r3,GSM7903266,,tissue:Embryos at 5 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 5hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 5 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:5 hpf of [AB TU]x[TL TLF],GSM7903266,GSM7903266: zebrafish 5hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903266 r1,GSM7903266,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s5h_4.fastq.gz,fastq,3876675223.0,38382923.0,GSM7903266 r1,0:101,A:1271025001;C:726585936;G:783833897;T:1093102254;N:2128135,101,,,,1271025001,726585936,783833897,1093102254,2128135,SRX22541160,SRS19550743,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71995,,0.15648,,0.80602,,0.63112,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28927,SRR26845661,SRX22541159,SRS19550745,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 5hour wt 75mM s4u r2,GSM7903265,,tissue:Embryos at 5 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 5hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 5 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:5 hpf of [AB TU]x[TL TLF],GSM7903265,GSM7903265: zebrafish 5hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903265 r1,GSM7903265,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s5h_3.fastq.gz,fastq,3838231795.0,38002295.0,GSM7903265 r1,0:101,A:1278788159;C:716521940;G:779898774;T:1060882131;N:2140791,101,,,,1278788159,716521940,779898774,1060882131,2140791,SRX22541159,SRS19550745,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72109,,0.21985,,0.80807,,0.6147,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28928,SRR26845662,SRX22541158,SRS19550744,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 5hour wt 75mM s4u r1,GSM7903264,,tissue:Embryos at 5 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 5hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 5 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:5 hpf of [AB TU]x[TL TLF],GSM7903264,GSM7903264: zebrafish 5hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903264 r1,GSM7903264,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s5h_1.fastq.gz,fastq,3890509395.0,38519895.0,GSM7903264 r1,0:101,A:1318641089;C:721557782;G:786950925;T:1061229739;N:2129860,101,,,,1318641089,721557782,786950925,1061229739,2129860,SRX22541158,SRS19550744,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68576,,0.20717,,0.81935,,0.62842,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28929,SRR26845663,SRX22541157,SRS19550742,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 4hour wt 75mM s4u r3,GSM7903263,,tissue:Embryos at 4 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 4hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 4 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:4 hpf of [AB TU]x[TL TLF],GSM7903263,GSM7903263: zebrafish 4hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903263 r1,GSM7903263,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s4h_3.fastq.gz,fastq,3922621133.0,38837833.0,GSM7903263 r1,0:101,A:1326034870;C:729550784;G:798297898;T:1066568859;N:2168722,101,,,,1326034870,729550784,798297898,1066568859,2168722,SRX22541157,SRS19550742,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68783,,0.16779,,0.81621,,0.62761,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28930,SRR26845664,SRX22541156,SRS19550741,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 4hour wt 75mM s4u r2,GSM7903262,,tissue:Embryos at 4 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 4hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 4 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:4 hpf of [AB TU]x[TL TLF],GSM7903262,GSM7903262: zebrafish 4hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903262 r1,GSM7903262,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s4h_2.fastq.gz,fastq,3885845316.0,38473716.0,GSM7903262 r1,0:101,A:1305297185;C:711282734;G:795936400;T:1071155283;N:2173714,101,,,,1305297185,711282734,795936400,1071155283,2173714,SRX22541156,SRS19550741,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7205,,0.20229,,0.81556,,0.63986,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28931,SRR26845665,SRX22541155,SRS19550740,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 4hour wt 75mM s4u r1,GSM7903261,,tissue:Embryos at 4 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 4hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 4 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:4 hpf of [AB TU]x[TL TLF],GSM7903261,GSM7903261: zebrafish 4hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903261 r1,GSM7903261,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s4h_1.fastq.gz,fastq,4087186695.0,40467195.0,GSM7903261 r1,0:101,A:1367436080;C:761579394;G:848347911;T:1107470497;N:2352813,101,,,,1367436080,761579394,848347911,1107470497,2352813,SRX22541155,SRS19550740,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.7191,,0.20848,,0.81688,,0.63923,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28932,SRR26845666,SRX22541154,SRS19550739,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 3hour wt 75mM s4u r3,GSM7903260,,tissue:Embryos at 3 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 3hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 3 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:3 hpf of [AB TU]x[TL TLF],GSM7903260,GSM7903260: zebrafish 3hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903260 r1,GSM7903260,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s3h_3.fastq.gz,fastq,4736832532.0,46899332.0,GSM7903260 r1,0:101,A:1624181445;C:861735952;G:963083636;T:1285203347;N:2628152,101,,,,1624181445,861735952,963083636,1285203347,2628152,SRX22541154,SRS19550739,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71216,,0.21983,,0.81793,,0.63217,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28933,SRR26845667,SRX22541153,SRS19550738,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 3hour wt 75mM s4u r2,GSM7903259,,tissue:Embryos at 3 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 3hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 3 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:3 hpf of [AB TU]x[TL TLF],GSM7903259,GSM7903259: zebrafish 3hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903259 r1,GSM7903259,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s3h_2.fastq.gz,fastq,5318262969.0,52656069.0,GSM7903259 r1,0:101,A:1802889178;C:966732133;G:1084801674;T:1460906618;N:2933366,101,,,,1802889178,966732133,1084801674,1460906618,2933366,SRX22541153,SRS19550738,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.70675,,0.15939,,0.81126,,0.61384,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28934,SRR26845668,SRX22541152,SRS19550736,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 3hour wt 75mM s4u r1,GSM7903258,,tissue:Embryos at 3 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 3hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 3 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:3 hpf of [AB TU]x[TL TLF],GSM7903258,GSM7903258: zebrafish 3hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903258 r1,GSM7903258,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s3h_1.fastq.gz,fastq,4206425679.0,41647779.0,GSM7903258 r1,0:101,A:1441873469;C:764690995;G:869706025;T:1127812036;N:2343154,101,,,,1441873469,764690995,869706025,1127812036,2343154,SRX22541152,SRS19550736,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.67591,,0.16274,,0.82175,,0.62057,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Blastula,Embryo,Embryo Imprecise,All anatomical structures 28935,SRR26845669,SRX22541151,SRS19550737,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 2hour wt 75mM s4u r2,GSM7903257,,tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 2hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 2 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF],GSM7903257,GSM7903257: zebrafish 2hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903257 r1,GSM7903257,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s2h_2.fastq.gz,fastq,4440596805.0,43966305.0,GSM7903257 r1,0:101,A:1543708731;C:806593065;G:905733733;T:1182095254;N:2466022,101,,,,1543708731,806593065,905733733,1182095254,2466022,SRX22541151,SRS19550737,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.63778,,0.15677,,0.82676,,0.61166,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28936,SRR26845670,SRX22541150,SRS19550735,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 2hour wt 75mM s4u r1,GSM7903256,,tissue:Embryos at 2 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 2hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 2 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:2 hpf of [AB TU]x[TL TLF],GSM7903256,GSM7903256: zebrafish 2hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903256 r1,GSM7903256,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s2h_1.fastq.gz,fastq,4689849655.0,46434155.0,GSM7903256 r1,0:101,A:1611038201;C:846984275;G:953714532;T:1275424861;N:2687786,101,,,,1611038201,846984275,953714532,1275424861,2687786,SRX22541150,SRS19550735,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.67301,,0.15612,,0.82171,,0.63462,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28937,SRR26845671,SRX22541149,SRS19550733,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r3,GSM7903255,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r3,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903255,GSM7903255: zebrafish 1hour wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903255 r1,GSM7903255,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_3.fastq.gz,fastq,5540992108.0,54861308.0,GSM7903255 r1,0:101,A:1856189531;C:1011042624;G:1124613529;T:1546055477;N:3090947,101,,,,1856189531,1011042624,1124613529,1546055477,3090947,SRX22541149,SRS19550733,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72187,,0.16436,,0.82416,,0.64431,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28938,SRR26845672,SRX22541148,SRS19550734,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r2,GSM7903254,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r2,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903254,GSM7903254: zebrafish 1hour wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903254 r1,GSM7903254,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_2.fastq.gz,fastq,4572239397.0,45269697.0,GSM7903254 r1,0:101,A:1530268631;C:831534079;G:915378596;T:1292534173;N:2523918,101,,,,1530268631,831534079,915378596,1292534173,2523918,SRX22541148,SRS19550734,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.72394,,0.15187,,0.81753,,0.63236,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28939,SRR26845673,SRX22541147,SRS19550732,SRP472252,PRJNA1040929,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse data],GSE247933,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and injected at single cell stage with 1000pL of 75mM s4 UTP. Embryos were kept in the dark until collection time. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,,,zebrafish 1hour wt 75mM s4u r1,GSM7903253,,tissue:Embryos at 1 hpf of [AB TU]x[TL TLF]|geo loc name:missing|collection date:missing,zebrafish 1hour wt 75mM s4u r1,Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at 1 hpf,Embryos were injected with 1000pL of 75mM s4 UTP.,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:1 hpf of [AB TU]x[TL TLF],GSM7903253,GSM7903253: zebrafish 1hour wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903253 r1,GSM7903253,1,Trizol™ QuantSeq 3′ mRNA Seq Library Prep Kit for Illumina UDI Bundle FWD Lexogen GmbH cat. no. 144.96,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP472252,,loader:fastq load.py,s1h_1.fastq.gz,fastq,4271986597.0,42296897.0,GSM7903253 r1,0:101,A:1447221671;C:787487923;G:887526673;T:1147409594;N:2340736,101,,,,1447221671,787487923,887526673,1147409594,2340736,SRX22541147,SRS19550732,SRA1751928,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.68805,,0.18469,,0.83175,,0.62945,,101,,B,,usable mapping rate,illumina,nextseq_v2,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Cleavage,Embryo,Embryo Imprecise,All anatomical structures 28940,SRR26846105,SRX22541614,SRS19551199,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours aamanitin 75mM s4u r3,GSM7903289,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours aamanitin 75mM s4u r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u,GSM7903289,GSM7903289: zebrafish 7hours aamanitin 75mM s4u r3; Danio rerio; RNA Seq,GSM7903289 r1,GSM7903289,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_Alpha_AM_3_7.2hpf.fastq,fastq,2324253052.0,30582277.0,GSM7903289 r1,0:76,A:730230137;C:445929142;G:497720807;T:650150631;N:222335,76,,,,730230137,445929142,497720807,650150631,222335,SRX22541614,SRS19551199,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.91664,,0.09242,,0.85141,,0.83766,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28941,SRR26846106,SRX22541613,SRS19551197,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours aamanitin 75mM s4u r2,GSM7903288,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours aamanitin 75mM s4u r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u,GSM7903288,GSM7903288: zebrafish 7hours aamanitin 75mM s4u r2; Danio rerio; RNA Seq,GSM7903288 r1,GSM7903288,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_Alpha_AM_2_7.2hpf.fastq,fastq,2258390388.0,29715663.0,GSM7903288 r1,0:76,A:730303334;C:433847002;G:477372738;T:616648008;N:219306,76,,,,730303334,433847002,477372738,616648008,219306,SRX22541613,SRS19551197,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.90032,,0.09917,,0.85456,,0.82527,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28942,SRR26846107,SRX22541612,SRS19551198,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours aamanitin 75mM s4u r1,GSM7903287,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours aamanitin 75mM s4u r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:aamanitin 75mM s4u,GSM7903287,GSM7903287: zebrafish 7hours aamanitin 75mM s4u r1; Danio rerio; RNA Seq,GSM7903287 r1,GSM7903287,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_Alpha_AM_1_7.2hpf.fastq,fastq,2448732008.0,32220158.0,GSM7903287 r1,0:76,A:762363800;C:470381296;G:528015897;T:687735325;N:235690,76,,,,762363800,470381296,528015897,687735325,235690,SRX22541612,SRS19551198,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.92405,,0.09134,,0.85086,,0.83762,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28943,SRR26846108,SRX22541611,SRS19551195,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 75mM s4u r3,GSM7903286,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 75mM s4u r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u,GSM7903286,GSM7903286: zebrafish 7hours wt 75mM s4u r3; Danio rerio; RNA Seq,GSM7903286 r1,GSM7903286,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_3_shield.fastq,fastq,1972068596.0,25948271.0,GSM7903286 r1,0:76,A:624727984;C:405741582;G:403474252;T:537931982;N:192796,76,,,,624727984,405741582,403474252,537931982,192796,SRX22541611,SRS19551195,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.69551,,0.10734,,0.85922,,0.81475,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28944,SRR26846109,SRX22541610,SRS19551196,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 75mM s4u r2,GSM7903285,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 75mM s4u r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u,GSM7903285,GSM7903285: zebrafish 7hours wt 75mM s4u r2; Danio rerio; RNA Seq,GSM7903285 r1,GSM7903285,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_2_shield.fastq,fastq,2516506300.0,33111925.0,GSM7903285 r1,0:76,A:831930759;C:501602051;G:506951200;T:675776222;N:246068,76,,,,831930759,501602051,506951200,675776222,246068,SRX22541610,SRS19551196,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.71823,,0.11734,,0.85626,,0.82109,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28945,SRR26846110,SRX22541609,SRS19551194,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 75mM s4u r1,GSM7903284,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 75mM s4u r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 75mM s4u,GSM7903284,GSM7903284: zebrafish 7hours wt 75mM s4u r1; Danio rerio; RNA Seq,GSM7903284 r1,GSM7903284,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s75mM_s4U_1_shield.fastq,fastq,2549071616.0,33540416.0,GSM7903284 r1,0:76,A:818805455;C:519667619;G:516651535;T:693699280;N:247727,76,,,,818805455,519667619,516651535,693699280,247727,SRX22541609,SRS19551194,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.6955,,0.10765,,0.86076,,0.8198,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28946,SRR26846111,SRX22541608,SRS19551193,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 50mM s4u r3,GSM7903283,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 50mM s4u r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u,GSM7903283,GSM7903283: zebrafish 7hours wt 50mM s4u r3; Danio rerio; RNA Seq,GSM7903283 r1,GSM7903283,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s50mM_s4U_3_shield.fastq,fastq,2618751456.0,34457256.0,GSM7903283 r1,0:76,A:825375324;C:516006422;G:537742430;T:739370895;N:256385,76,,,,825375324,516006422,537742430,739370895,256385,SRX22541608,SRS19551193,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.79157,,0.12783,,0.83591,,0.7815,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28947,SRR26846112,SRX22541607,SRS19551192,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 50mM s4u r2,GSM7903282,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 50mM s4u r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u,GSM7903282,GSM7903282: zebrafish 7hours wt 50mM s4u r2; Danio rerio; RNA Seq,GSM7903282 r1,GSM7903282,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s50mM_s4U_2_shield.fastq,fastq,2728810932.0,35905407.0,GSM7903282 r1,0:76,A:862839647;C:533956089;G:555216318;T:776529555;N:269323,76,,,,862839647,533956089,555216318,776529555,269323,SRX22541607,SRS19551192,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.78249,,0.13163,,0.83558,,0.7725,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28948,SRR26846113,SRX22541606,SRS19551191,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 50mM s4u r1,GSM7903281,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 50mM s4u r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 50mM s4u,GSM7903281,GSM7903281: zebrafish 7hours wt 50mM s4u r1; Danio rerio; RNA Seq,GSM7903281 r1,GSM7903281,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s50mM_s4U_1_shield.fastq,fastq,2799942904.0,36841354.0,GSM7903281 r1,0:76,A:896568389;C:543434921;G:571731242;T:787934334;N:274018,76,,,,896568389,543434921,571731242,787934334,274018,SRX22541606,SRS19551191,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.77902,,0.1234,,0.83976,,0.77809,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28949,SRR26846114,SRX22541605,SRS19551190,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 25mM s4u r3,GSM7903280,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 25mM s4u r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u,GSM7903280,GSM7903280: zebrafish 7hours wt 25mM s4u r3; Danio rerio; RNA Seq,GSM7903280 r1,GSM7903280,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s25mM_s4U_3_shield.fastq,fastq,2472530952.0,32533302.0,GSM7903280 r1,0:76,A:792442838;C:471795434;G:509242670;T:698813712;N:236298,76,,,,792442838,471795434,509242670,698813712,236298,SRX22541605,SRS19551190,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.84425,,0.13847,,0.83569,,0.77265,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28950,SRR26846115,SRX22541604,SRS19551188,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 25mM s4u r2,GSM7903279,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 25mM s4u r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u,GSM7903279,GSM7903279: zebrafish 7hours wt 25mM s4u r2; Danio rerio; RNA Seq,GSM7903279 r1,GSM7903279,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s25mM_s4U_2_shield.fastq,fastq,2558649668.0,33666443.0,GSM7903279 r1,0:76,A:828026391;C:485923982;G:520165153;T:724284266;N:249876,76,,,,828026391,485923982,520165153,724284266,249876,SRX22541604,SRS19551188,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.83816,,0.14018,,0.83465,,0.77309,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28951,SRR26846116,SRX22541603,SRS19551189,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt 25mM s4u r1,GSM7903278,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u|geo loc name:missing|collection date:missing,zebrafish 7hours wt 25mM s4u r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt 25mM s4u,GSM7903278,GSM7903278: zebrafish 7hours wt 25mM s4u r1; Danio rerio; RNA Seq,GSM7903278 r1,GSM7903278,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,s25mM_s4U_1_shield.fastq,fastq,2520179304.0,33160254.0,GSM7903278 r1,0:76,A:799475887;C:482189329;G:519797461;T:718469119;N:247508,76,,,,799475887,482189329,519797461,718469119,247508,SRX22541603,SRS19551189,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.83929,,0.13684,,0.83057,,0.75892,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28952,SRR26846117,SRX22541602,SRS19551186,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt non injected r3,GSM7903277,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected|geo loc name:missing|collection date:missing,zebrafish 7hours wt non injected r3,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected,GSM7903277,GSM7903277: zebrafish 7hours wt non injected r3; Danio rerio; RNA Seq,GSM7903277 r1,GSM7903277,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,sNon_Inj_3_shield.fastq,fastq,2705811204.0,35602779.0,GSM7903277 r1,0:76,A:868795189;C:502830022;G:561015387;T:772908180;N:262426,76,,,,868795189,502830022,561015387,772908180,262426,SRX22541602,SRS19551186,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.88878,,0.13872,,0.82964,,0.75597,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28953,SRR26846118,SRX22541601,SRS19551187,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt non injected r2,GSM7903276,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected|geo loc name:missing|collection date:missing,zebrafish 7hours wt non injected r2,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected,GSM7903276,GSM7903276: zebrafish 7hours wt non injected r2; Danio rerio; RNA Seq,GSM7903276 r1,GSM7903276,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,sNon_Inj_2_shield.fastq,fastq,2231433112.0,29360962.0,GSM7903276 r1,0:76,A:730923613;C:410649775;G:458415817;T:631227720;N:216187,76,,,,730923613,410649775,458415817,631227720,216187,SRX22541601,SRS19551187,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.87436,,0.13872,,0.83362,,0.75999,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures 28954,SRR26846119,SRX22541600,SRS19551185,SRP472260,PRJNA1040930,Slam seq reveals that miR 430 regulates zygotic mRNA during zebrafish embryogenesis [titration data],GSE247934,Other,Background: Early embryonic developmental programs are guided by the coordinated interplay between maternally inherited and zygotically manufactured RNAs and proteins. Although these processes happen concomitantly and affecting gene function during this period is bound to affect both pools of mRNAs it has been challenging to study their expression dynamics separately. Results: By employing Slam seq a nascent mRNA labeling transcriptomic approach in a developmental time series we observe that over half of the early zebrafish embryo transcriptome consists of maternal zygotic genes emphasizing their pivotal role in early embryogenesis. We provide an hourly resolution of de novo transcriptional waves and follow nascent mRNA trajectories finding that most de novo transcriptional events are stable throughout this period. Additionally by blocking microRNA430 function a key post transcriptional regulator during zebrafish embryogenesis we directly show that it destabilizes hundreds of de novo transcribed mRNAs from pure zygotic as well as maternal zygotic genes. This unveils a novel miR 430 function during embryogenesis fine tuning zygotic gene expression which highlights that Slam seq can be used to disentangle transcriptional and post transcriptional regulation of mRNA levels. Conclusion: Such valuable insights into zebrafish early embryo transcriptome dynamics emphasize the significance of post transcriptional regulators in zygotic genome activation. These findings pave the way for future investigations into the coordinated interplay between transcriptional and post transcriptional landscapes required for the establishment of animal cell identities and functions. Overall design: Zebrafish embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200µg/µl Alpha Amanitin. Embryos were kept in the dark until collection time shield stage 6 hours post injection. Total RNA was extracted and kept away from direct light alkylated used for library preparation with QuantSeq three prime mRNA Seq Library Prep Kit for Illumina FWD.,parent bioproject:PRJNA1040928,pubmed:38504288,,zebrafish 7hours wt non injected r1,GSM7903275,,source name:Embryos at shield stage|tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected|geo loc name:missing|collection date:missing,zebrafish 7hours wt non injected r1,Slamdunk 0.4.3. Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma separated values <.csv>; Total raw read and labeled read counts for all experiments and samples including spike ins. Rows represent different three primeUTR isoforms for coding genes or full length transcript non coding genes. Columns represent: Ensembl gene IDs by itself non coding transcripts + three primeUTR isoforms coding transcripts or ERCC IDs spike ins; Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;,Embryos at shield stage,Embryos were dechorionated and either non injected or injected at single cell stage with 1000pL of 25/50/75mM s4 UTP by itself or the highest dose with 200mg/mL Alpha Amanitin,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,Zebrafish embryos were collected from natural breeding with random mating parents embryos were kept at 28.5 C in 0.5x Embryo Media.,tissue:Embryos|Stage:shield stage|genotype:Offspring of [AB TU]x[TL TLF]|treatment:wt non injected,GSM7903275,GSM7903275: zebrafish 7hours wt non injected r1; Danio rerio; RNA Seq,GSM7903275 r1,GSM7903275,1,Trizol™ QuantSeq 3′ mRNA‐Seq Library Prep Kit for Illumina FWD with 24 reactions Lexogen GmbH cat. no. 015.24 Lexogen i7 6 nt Index Set.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP472260,,,sNon_Inj_1_shield.fastq,fastq,2484687228.0,32693253.0,GSM7903275 r1,0:76,A:768617118;C:464380698;G:526374755;T:725072055;N:242602,76,,,,768617118,464380698,526374755,725072055,242602,SRX22541600,SRS19551185,SRA1751942,"Bazzini Lab, Stowers Institute for Medical Research","Bazzini Lab, Stowers Institute for Medical Research",1,0.90371,,0.15268,,0.82538,,0.73889,,76,,B,,usable mapping rate,illumina,nextseq,3prime,small_rna,lexogen,bulk,unknown,unknown,,United States,2023-11-15,Gastrula,Embryo,Embryo Imprecise,All anatomical structures