rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 24927,SRR25557778,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L001_R1_001.fastq.gz,fastq,420092501.0,5668059.0,GSM7688794 r1,0:74.12,A:113006440;C:96725832;G:99320773;T:110915967;N:123489,74,,,,113006440,96725832,99320773,110915967,123489,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94757,,0.06229,,0.72364,,0.46676,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24928,SRR25557779,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L002_R1_001.fastq.gz,fastq,421869780.0,5690053.0,GSM7688794 r2,0:74.14,A:113530489;C:97144227;G:99697959;T:111388539;N:108566,74,,,,113530489,97144227,99697959,111388539,108566,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94921,,0.06226,,0.72462,,0.4738,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24929,SRR25557780,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L003_R1_001.fastq.gz,fastq,425064659.0,5734041.0,GSM7688794 r3,0:74.13,A:114342253;C:97873100;G:100532599;T:112196433;N:120274,74,,,,114342253,97873100,100532599,112196433,120274,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94886,,0.06112,,0.72425,,0.47055,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24930,SRR25557781,SRX21286665,SRS18536778,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant XI,GSM7688794,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688794,GSM7688794: Morphant XI; Danio rerio; RNA Seq,GSM7688794 r1,GSM7688794,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-XI_S7_L004_R1_001.fastq.gz,fastq,416990548.0,5624902.0,GSM7688794 r4,0:74.13,A:112153356;C:96009158;G:98613145;T:110097476;N:117413,74,,,,112153356,96009158,98613145,110097476,117413,SRX21286665,SRS18536778,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94869,,0.06229,,0.72506,,0.47222,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24931,SRR25557782,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L001_R1_001.fastq.gz,fastq,434485284.0,5881416.0,GSM7688793 r1,0:73.87,A:116640351;C:100176557;G:102659919;T:114799536;N:208921,73,,,,116640351,100176557,102659919,114799536,208921,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94533,,0.07176,,0.72464,,0.47632,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24932,SRR25557783,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L002_R1_001.fastq.gz,fastq,435203869.0,5886556.0,GSM7688793 r2,0:73.93,A:116869356;C:100363580;G:102830644;T:114973504;N:166785,73,,,,116869356,100363580,102830644,114973504,166785,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94542,,0.07203,,0.72421,,0.47733,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24933,SRR25557784,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L003_R1_001.fastq.gz,fastq,439897269.0,5951878.0,GSM7688793 r3,0:73.91,A:118101648;C:101426657;G:103990006;T:116184480;N:194478,73,,,,118101648,101426657,103990006,116184480,194478,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94486,,0.07224,,0.72448,,0.47915,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24934,SRR25557785,SRX21286664,SRS18536777,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant X,GSM7688793,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688793,GSM7688793: Morphant X; Danio rerio; RNA Seq,GSM7688793 r1,GSM7688793,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-X_S6_L004_R1_001.fastq.gz,fastq,431385256.0,5836029.0,GSM7688793 r4,0:73.92,A:115804970;C:99459059;G:101962932;T:113975935;N:182360,73,,,,115804970,99459059,101962932,113975935,182360,SRX21286664,SRS18536777,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94432,,0.07229,,0.7261,,0.47463,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24935,SRR25557786,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L001_R1_001.fastq.gz,fastq,513309395.0,6929648.0,GSM7688792 r1,0:74.07,A:137428462;C:118688804;G:122019962;T:134991729;N:180438,74,,,,137428462,118688804,122019962,134991729,180438,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94188,,0.07029,,0.73772,,0.47692,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24936,SRR25557787,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L002_R1_001.fastq.gz,fastq,517356735.0,6982196.0,GSM7688792 r2,0:74.10,A:138524037;C:119650852;G:122965491;T:136056171;N:160184,74,,,,138524037,119650852,122965491,136056171,160184,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94281,,0.06967,,0.73963,,0.48142,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24937,SRR25557788,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L003_R1_001.fastq.gz,fastq,519422328.0,7010631.0,GSM7688792 r3,0:74.09,A:139040684;C:120128748;G:123529198;T:136551898;N:171800,74,,,,139040684,120128748,123529198,136551898,171800,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94297,,0.06942,,0.73726,,0.47499,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24938,SRR25557789,SRX21286663,SRS18536776,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant IX,GSM7688792,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688792,GSM7688792: Morphant IX; Danio rerio; RNA Seq,GSM7688792 r1,GSM7688792,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-IX_S16_L004_R1_001.fastq.gz,fastq,511640294.0,6905748.0,GSM7688792 r4,0:74.09,A:136914638;C:118302866;G:121704665;T:134543505;N:174620,74,,,,136914638,118302866,121704665,134543505,174620,SRX21286663,SRS18536776,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94176,,0.07029,,0.73868,,0.47987,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24939,SRR25557790,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L001_R1_001.fastq.gz,fastq,429446821.0,5803178.0,GSM7688791 r1,0:74.00,A:114793535;C:99506379;G:102226914;T:112748761;N:171232,74,,,,114793535,99506379,102226914,112748761,171232,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94175,,0.06669,,0.73673,,0.48179,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24940,SRR25557791,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L002_R1_001.fastq.gz,fastq,434629893.0,5870828.0,GSM7688791 r2,0:74.03,A:116216940;C:100703527;G:103463365;T:114092681;N:153380,74,,,,116216940,100703527,103463365,114092681,153380,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94143,,0.0676,,0.73791,,0.48091,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24941,SRR25557792,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L003_R1_001.fastq.gz,fastq,435879881.0,5888685.0,GSM7688791 r3,0:74.02,A:116548094;C:100971153;G:103794902;T:114400770;N:164962,74,,,,116548094,100971153,103794902,114400770,164962,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94195,,0.06686,,0.73785,,0.48044,,73,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24942,SRR25557793,SRX21286662,SRS18536775,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VIII,GSM7688791,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688791,GSM7688791: Morphant VIII; Danio rerio; RNA Seq,GSM7688791 r1,GSM7688791,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VIII_S14_L004_R1_001.fastq.gz,fastq,429478475.0,5801978.0,GSM7688791 r4,0:74.02,A:114799280;C:99474677;G:102302775;T:112737475;N:164268,74,,,,114799280,99474677,102302775,112737475,164268,SRX21286662,SRS18536775,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94118,,0.06706,,0.73892,,0.47732,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24943,SRR25557794,SRX21286661,SRS18536774,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VII,GSM7688790,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688790,GSM7688790: Morphant VII; Danio rerio; RNA Seq,GSM7688790 r1,GSM7688790,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VII_S15_L001_R1_001.fastq.gz,fastq,459545188.0,6215897.0,GSM7688790 r1,0:73.93,A:121926568;C:107379723;G:110263606;T:119766429;N:208862,73,,,,121926568,107379723,110263606,119766429,208862,SRX21286661,SRS18536774,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94273,,0.06072,,0.74582,,0.47499,,73,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24944,SRR25557795,SRX21286661,SRS18536774,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VII,GSM7688790,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688790,GSM7688790: Morphant VII; Danio rerio; RNA Seq,GSM7688790 r1,GSM7688790,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VII_S15_L002_R1_001.fastq.gz,fastq,463143624.0,6261406.0,GSM7688790 r2,0:73.97,A:122917997;C:108229793;G:111099867;T:120713978;N:181989,73,,,,122917997,108229793,111099867,120713978,181989,SRX21286661,SRS18536774,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94387,,0.06093,,0.74341,,0.47351,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24945,SRR25557796,SRX21286661,SRS18536774,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VII,GSM7688790,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688790,GSM7688790: Morphant VII; Danio rerio; RNA Seq,GSM7688790 r1,GSM7688790,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VII_S15_L003_R1_001.fastq.gz,fastq,465959664.0,6300929.0,GSM7688790 r3,0:73.95,A:123689364;C:108847593;G:111847868;T:121377463;N:197376,73,,,,123689364,108847593,111847868,121377463,197376,SRX21286661,SRS18536774,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94322,,0.06219,,0.74357,,0.47977,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24946,SRR25557797,SRX21286661,SRS18536774,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Morphant VII,GSM7688790,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant|geo loc name:missing|collection date:missing,Morphant VII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:hmx2;hmx3a double knockdowm morphant|treatment:hmx2;hmx3a double knockdowm morphant,GSM7688790,GSM7688790: Morphant VII; Danio rerio; RNA Seq,GSM7688790 r1,GSM7688790,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Morphant-VII_S15_L004_R1_001.fastq.gz,fastq,459075430.0,6207363.0,GSM7688790 r4,0:73.96,A:121797426;C:107221116;G:110209684;T:119657308;N:189896,73,,,,121797426,107221116,110209684,119657308,189896,SRX21286661,SRS18536774,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94313,,0.06211,,0.74343,,0.47801,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24947,SRR25557798,SRX21286660,SRS18536773,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control XI,GSM7688787,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688787,GSM7688787: Control XI; Danio rerio; RNA Seq,GSM7688787 r1,GSM7688787,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-XI_S2_L001_R1_001.fastq.gz,fastq,439719566.0,5947052.0,GSM7688787 r1,0:73.94,A:117482073;C:102083665;G:104685444;T:115272860;N:195524,73,,,,117482073,102083665,104685444,115272860,195524,SRX21286660,SRS18536773,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94829,,0.06278,,0.72525,,0.46494,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24948,SRR25557799,SRX21286660,SRS18536773,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control XI,GSM7688787,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688787,GSM7688787: Control XI; Danio rerio; RNA Seq,GSM7688787 r1,GSM7688787,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-XI_S2_L002_R1_001.fastq.gz,fastq,438533503.0,5927990.0,GSM7688787 r2,0:73.98,A:117199594;C:101810881;G:104402169;T:114946611;N:174248,73,,,,117199594,101810881,104402169,114946611,174248,SRX21286660,SRS18536773,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94887,,0.06387,,0.72827,,0.46616,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24949,SRR25557800,SRX21286660,SRS18536773,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control XI,GSM7688787,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688787,GSM7688787: Control XI; Danio rerio; RNA Seq,GSM7688787 r1,GSM7688787,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-XI_S2_L003_R1_001.fastq.gz,fastq,443995554.0,6003540.0,GSM7688787 r3,0:73.96,A:118663936;C:103031716;G:105723574;T:116387834;N:188494,73,,,,118663936,103031716,105723574,116387834,188494,SRX21286660,SRS18536773,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94788,,0.06232,,0.72693,,0.46653,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24950,SRR25557801,SRX21286660,SRS18536773,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control XI,GSM7688787,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control XI,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688787,GSM7688787: Control XI; Danio rerio; RNA Seq,GSM7688787 r1,GSM7688787,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-XI_S2_L004_R1_001.fastq.gz,fastq,435088869.0,5882642.0,GSM7688787 r4,0:73.96,A:116261447;C:100986653;G:103615584;T:114042354;N:182831,73,,,,116261447,100986653,103615584,114042354,182831,SRX21286660,SRS18536773,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94914,,0.06241,,0.72829,,0.4546,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24951,SRR25557802,SRX21286659,SRS18536772,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control X,GSM7688785,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688785,GSM7688785: Control X; Danio rerio; RNA Seq,GSM7688785 r1,GSM7688785,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-X_S1_L001_R1_001.fastq.gz,fastq,395130702.0,5338263.0,GSM7688785 r1,0:74.02,A:107005793;C:90183031;G:92316770;T:105476481;N:148627,74,,,,107005793,90183031,92316770,105476481,148627,SRX21286659,SRS18536772,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94534,,0.07625,,0.73888,,0.48135,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24952,SRR25557803,SRX21286659,SRS18536772,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control X,GSM7688785,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688785,GSM7688785: Control X; Danio rerio; RNA Seq,GSM7688785 r1,GSM7688785,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-X_S1_L002_R1_001.fastq.gz,fastq,396764458.0,5358448.0,GSM7688785 r2,0:74.04,A:107513717;C:90540282;G:92658504;T:105917444;N:134511,74,,,,107513717,90540282,92658504,105917444,134511,SRX21286659,SRS18536772,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94374,,0.07709,,0.73878,,0.47615,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24953,SRR25557804,SRX21286659,SRS18536772,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control X,GSM7688785,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688785,GSM7688785: Control X; Danio rerio; RNA Seq,GSM7688785 r1,GSM7688785,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-X_S1_L003_R1_001.fastq.gz,fastq,399623551.0,5397520.0,GSM7688785 r3,0:74.04,A:108230540;C:91192011;G:93388052;T:106665106;N:147842,74,,,,108230540,91192011,93388052,106665106,147842,SRX21286659,SRS18536772,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94399,,0.07657,,0.73797,,0.4794,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24954,SRR25557805,SRX21286659,SRS18536772,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control X,GSM7688785,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control X,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688785,GSM7688785: Control X; Danio rerio; RNA Seq,GSM7688785 r1,GSM7688785,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-X_S1_L004_R1_001.fastq.gz,fastq,393298978.0,5312101.0,GSM7688785 r4,0:74.04,A:106518845;C:89734564;G:91901232;T:105004490;N:139847,74,,,,106518845,89734564,91901232,105004490,139847,SRX21286659,SRS18536772,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94423,,0.07599,,0.73884,,0.47905,,71,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24955,SRR25557806,SRX21286658,SRS18536771,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control IX,GSM7688783,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688783,GSM7688783: Control IX; Danio rerio; RNA Seq,GSM7688783 r1,GSM7688783,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-IX_S22_L001_R1_001.fastq.gz,fastq,366045799.0,4944832.0,GSM7688783 r1,0:74.03,A:98000119;C:84654222;G:86951226;T:96295351;N:144881,74,,,,98000119,84654222,86951226,96295351,144881,SRX21286658,SRS18536771,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94303,,0.07499,,0.73085,,0.47881,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24956,SRR25557807,SRX21286658,SRS18536771,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control IX,GSM7688783,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688783,GSM7688783: Control IX; Danio rerio; RNA Seq,GSM7688783 r1,GSM7688783,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-IX_S22_L002_R1_001.fastq.gz,fastq,369429068.0,4988719.0,GSM7688783 r2,0:74.05,A:98907882;C:85446993;G:87729593;T:97216477;N:128123,74,,,,98907882,85446993,87729593,97216477,128123,SRX21286658,SRS18536771,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94261,,0.07335,,0.72969,,0.47867,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24957,SRR25557808,SRX21286658,SRS18536771,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control IX,GSM7688783,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688783,GSM7688783: Control IX; Danio rerio; RNA Seq,GSM7688783 r1,GSM7688783,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-IX_S22_L003_R1_001.fastq.gz,fastq,369967330.0,4996710.0,GSM7688783 r3,0:74.04,A:99035743;C:85549878;G:87926587;T:97310812;N:144310,74,,,,99035743,85549878,87926587,97310812,144310,SRX21286658,SRS18536771,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94328,,0.0743,,0.73034,,0.47133,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24958,SRR25557809,SRX21286658,SRS18536771,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control IX,GSM7688783,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control IX,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688783,GSM7688783: Control IX; Danio rerio; RNA Seq,GSM7688783 r1,GSM7688783,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-IX_S22_L004_R1_001.fastq.gz,fastq,365499176.0,4936305.0,GSM7688783 r4,0:74.04,A:97825658;C:84517732;G:86863655;T:96157429;N:134702,74,,,,97825658,84517732,86863655,96157429,134702,SRX21286658,SRS18536771,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94286,,0.07288,,0.72999,,0.4783,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24959,SRR25557810,SRX21286657,SRS18536770,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control VIII,GSM7688782,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688782,GSM7688782: Control VIII; Danio rerio; RNA Seq,GSM7688782 r1,GSM7688782,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-VIII_S20_L001_R1_001.fastq.gz,fastq,488585907.0,6585668.0,GSM7688782 r1,0:74.19,A:131727468;C:112349971;G:115189425;T:129203159;N:115884,74,,,,131727468,112349971,115189425,129203159,115884,SRX21286657,SRS18536770,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.93794,,0.07381,,0.7315,,0.47355,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24960,SRR25557811,SRX21286657,SRS18536770,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control VIII,GSM7688782,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688782,GSM7688782: Control VIII; Danio rerio; RNA Seq,GSM7688782 r1,GSM7688782,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-VIII_S20_L002_R1_001.fastq.gz,fastq,493766544.0,6653820.0,GSM7688782 r2,0:74.21,A:133135166;C:113551418;G:116398455;T:130575771;N:105734,74,,,,133135166,113551418,116398455,130575771,105734,SRX21286657,SRS18536770,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.93729,,0.07312,,0.7307,,0.47966,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24961,SRR25557812,SRX21286657,SRS18536770,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control VIII,GSM7688782,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688782,GSM7688782: Control VIII; Danio rerio; RNA Seq,GSM7688782 r1,GSM7688782,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-VIII_S20_L003_R1_001.fastq.gz,fastq,494935071.0,6670024.0,GSM7688782 r3,0:74.20,A:133406912;C:113769494;G:116771560;T:130871612;N:115493,74,,,,133406912,113769494,116771560,130871612,115493,SRX21286657,SRS18536770,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.93847,,0.07383,,0.73194,,0.47646,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24962,SRR25557813,SRX21286657,SRS18536770,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control VIII,GSM7688782,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control VIII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688782,GSM7688782: Control VIII; Danio rerio; RNA Seq,GSM7688782 r1,GSM7688782,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-VIII_S20_L004_R1_001.fastq.gz,fastq,487644286.0,6572100.0,GSM7688782 r4,0:74.20,A:131423055;C:112092623;G:115067911;T:128945959;N:114738,74,,,,131423055,112092623,115067911,128945959,114738,SRX21286657,SRS18536770,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.93708,,0.0732,,0.73186,,0.4781,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24963,SRR25557814,SRX21286656,SRS18536769,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control VII,GSM7688781,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control VII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688781,GSM7688781: Control VII; Danio rerio; RNA Seq,GSM7688781 r1,GSM7688781,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-VII_S21_L001_R1_001.fastq.gz,fastq,419048369.0,5664168.0,GSM7688781 r1,0:73.98,A:111569757;C:97553687;G:100228004;T:109523480;N:173441,73,,,,111569757,97553687,100228004,109523480,173441,SRX21286656,SRS18536769,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94179,,0.06596,,0.74499,,0.46809,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24964,SRR25557815,SRX21286656,SRS18536769,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control VII,GSM7688781,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control VII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688781,GSM7688781: Control VII; Danio rerio; RNA Seq,GSM7688781 r1,GSM7688781,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-VII_S21_L002_R1_001.fastq.gz,fastq,422419362.0,5707444.0,GSM7688781 r2,0:74.01,A:112476977;C:98366185;G:101046586;T:110369882;N:159732,74,,,,112476977,98366185,101046586,110369882,159732,SRX21286656,SRS18536769,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94275,,0.06539,,0.74523,,0.47247,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24965,SRR25557816,SRX21286656,SRS18536769,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control VII,GSM7688781,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control VII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688781,GSM7688781: Control VII; Danio rerio; RNA Seq,GSM7688781 r1,GSM7688781,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-VII_S21_L003_R1_001.fastq.gz,fastq,424260551.0,5733133.0,GSM7688781 r3,0:74.00,A:112957538;C:98789480;G:101496747;T:110850186;N:166600,74,,,,112957538,98789480,101496747,110850186,166600,SRX21286656,SRS18536769,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94174,,0.06482,,0.74304,,0.46935,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 24966,SRR25557817,SRX21286656,SRS18536769,SRP453884,PRJNA1003026,Molecular Analyses of V0v Spinal Interneurons and Identification of Transcriptional Regulators Downstream of Evx1 and Evx2 in These Cells. [bulk RNA Seq],GSE240238,Transcriptome Analysis,Background: V0v spinal interneurons are highly conserved glutamatergic commissural neurons that function in locomotor circuits. We have previously shown that Evx1 and Evx2 are required to specify the neurotransmitter phenotype of these cells. However we still know very little about the gene regulatory networks that act downstream of these transcription factors in V0v cells. Methods: To identify candidate members of V0v gene regulatory networks we FAC sorted WT and evx1;evx2 double mutant zebrafish V0v spinal interneurons and expression profiled them using microarrays and scRNA seq. We also used in situ hybridization to compare expression of a subset of candidate genes in evx1;evx2 mutants and wild type siblings. Results: Our data reveal two molecularly distinct subtypes of V0v spinal interneurons at 48 h and suggest that by this stage of development evx1;evx2 double mutant cells transfate into either inhibitory spinal interneurons or motoneurons. Our results also identify 25 transcriptional regulator genes that require Evx1/2 for their expression in V0v interneurons plus a further 11 transcriptional regulator genes that are repressed in V0v interneurons by Evx1/2. Two of the latter genes are hmx2 and hmx3a. Intriguingly we show that Hmx2/3a repress dI2 interneuronal expression of skor1a and nefma two genes that require Evx1/2 for their expression in V0v interneurons. This suggests that Evx1/2 might regulate skor1a and nefma expression in V0v interneurons by repressing Hmx2/3a expression. Conclusions: This study identifies two molecularly distinct subsets of V0v spinal interneurons as well as multiple transcriptional regulators that are strong candidates for acting downstream of Evx1/2 to specify the essential functional characteristics of V0v interneurons. Our data further suggest that in the absence of both Evx1 and Evx2 V0v spinal interneurons initially change their neurotransmitter phenotypes from excitatory to inhibitory and then later start to express markers of distinct types of inhibitory spinal interneurons or motoneurons. Taken together our findings significantly increase our knowledge of V0v spinal development and move us closer towards the essential goal of identifying the complete gene regulatory networks that specify this crucial cell type. Overall design: Ten samples were analysed in total all at 27 hpf. Five biological repicates were performed for V1 and dI2 spinal interneurons from uninjected wild type control embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background. Five biological replicates were performed for V1 and dI2 spinal interneurons from hmx2;hmx3a double knock down DKD morphant embryos in the Tghmx CNEIII:cfos:Gal4 VP16 UAS:EGFPSU41 background.,parent bioproject:PRJNA1003022,pubmed:38017520,,Control VII,GSM7688781,,source name:Spinal Cord|tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control|geo loc name:missing|collection date:missing,Control VII,We analyzed the data using Partek Flow Genomic Analysis Software https://www.partek.com/partek flow/. We trimmed the adapter sequence “CTGTCTCTTATACACATCT” from the 3’ end using default parameters before trimming bases from the 5’ end selecting an end minimum quality value Phred score of 32 and a minimum read length of 65 bases. We aligned reads using default parameters and the STAR 2.6.1d algorithm. We normalized the log expression ratios using a Trimmed Means of M values TMM weighted algorithm. We performed differential expression analysis using the Gene Specific Analysis GSA algorithm in Partek Flow. The outcome of GSA was assessed by hierarchical clustering heatmap plotting clustering by features using average linkage and Euclidean cluster distance and point distance metrics respectively. Assembly: Lawson Lab zebrafish transcriptome V4.3.2 https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ Supplementary files format and content: Tab separated differential expression analysis file comparing all uninjected control samples versus all hmx2;hmx3a DKD morphant embryos.,Spinal Cord,The hmx2;hmx3a DKD morphant embryos used in this study were obtained by injecting 3.5 nl of a mixture containing 2 ng/nl each of a translation blocking hmx2 morpholino 5’ TTCCGCTGTCCTCCGAATTATTCAT and a translation blocking hmx3a morpholino 5’ ACGTATCCTGTGTTGTTTCGGGCAT plus 5 ng/nl of a control zebrafish p53 morpholino 5’ GCGCCATTGCTTTGCAAGAATTG into the single cell of a one cell stage Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 embryo all morpholinos obtained from Gene Tools. Morpholino injections always produce a spectrum of phenotypes since it is hard to ensure that every cell receives the same dose. Therefore prior to processing for FACS at 27 hpf we removed any embryos with severely abnormal morphology stunted length and/or severely developmentally delayed likely caused by receiving too much morpholino. DKD morphant embryos display a slight curled tail down morphology. Embryos that lacked this morphology and may therefore not have received any or sufficient morpholino were also removed before processing for FACS.,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz’s L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer’s instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,The hmx2;hmx3a double knockdown DKD morphant embryos used in this study exhibit delayed development from somitogenesis stages onwards when compared to uninjected controls. To circumvent this they were incubated at 32oC from 9 hpf onwards. This ensured that control and injected embryos reached the desired developmental stage of 27 hpf at approximately the same time. The lateral line primordium does not migrate in DKD animals so this could not be used to stage injected embryos. Instead these embryos were visually inspected and processed for fluorescence activated cell sorting FACS when they displayed the same head trunk angle head size and eye size as prim staged uninjected control embryos.,tissue:Spinal Cord|cell line:Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41|cell type:V1 and dI2 spinal interneurons|genotype:Wild type|treatment:Uninjected control,GSM7688781,GSM7688781: Control VII; Danio rerio; RNA Seq,GSM7688781 r1,GSM7688781,1,Uninjected control embryos and hmx2;hmx3a DKD morphant embryos in the Tghmx CNEIII:cfos:GAL4 VP16 UAS:EGFPSU41 background generated as described above were screened for fluorescence from 24 hpf onwards. Only EGFP positive control and hmx2;hmx3a DKD morphant animals were used for dissociation and fluorescent activated cell sorting FACS at 27 hpf. Embryos were deyolked dissected and dissociated as described in GSE145916 with the following modifications: Trunk tissue was dissected anteriorly at the boundary between the hindbrain and spinal cord and posteriorly immediately above the end of the yolk extension. To ensure complete dissociation of trunk tissue with the Papain Dissociation System Worthington Biochemical Corporation LK003150 trunks were incubated in 1 ml Papain/DNase mix with gentle rocking at 28.5oC for 30 minutes. The digested tissue was then allowed to settle for 10 seconds before the Papain/DNase mix was carefully decanted until approximately 500 µl remained. Immediately post homogenising the digested tissue mixture with a sterile p200 tip we passed each sample through a 40 µm Flowmi cell strainer Merck BAH136800040 into a sterile microcentrifuge tube. post Papain inactivation samples were resuspended in 1 ml Leibovitz's L 15 medium ThermoFisher Scientific 21083027 + 0.5% FBS and stored on ice. Immediately before FACS DAPI Merck D9542 and Draq5 BioLegend 424101 were added at a final concentration of 5 µg/ml and 5 µM respectively. FACS was performed using a Becton Dickinson FACS Aria III Cell Sorter at the SUNY Upstate Medical University Research Flow Core using the parameters described by Cerda et al. 2008 with the following modifications. Ice cold samples were filtered through 35 µm mesh strainers in to 5 ml round bottomed polystyrene tubes Corning Falcon 352235. All FAC sorting and collection steps were performed at +4oC using a 100 µm nozzle and 20 psi sort pressure. Successive doublet exclusion gates forward scatter height x forward scatter width followed by side scatter height x side scatter width were used to finesse capture of real single cells. Accurate live/dead filtering was performed by selecting for DAPI negative sick cells are DAPI permeant and excluded and Draq 5 positive only healthy nuclei are Draq 5 permeant cells. Cells were sorted directly in to sterile 1.5 ml microcentrifuge tubes containing 100 µl of Buffer RLT Qiagen RNeasy Micro Kit 74004 plus 143 mMβ mercaptoethanol. Sorted cells were stored at 80oC prior to RNA extraction. Frozen FAC sorted cell lysates were removed from storage at 80oC and thawed in a 37oC waterbath before transferring to sterile microcentrifuge tubes. If necessary sample volumes were completed to 250 µl with UltraPure DNase/RNase Free distilled water ThermoFisher Scientific 10977035. 750 µl TRIzol LS Reagent ThermoFisher Scientific 10296028 was added to each 250 µl sample before homogenising by gently pipetting up and down ten times with a sterile p1000 pipette tip. Samples were immediately transferred to Phasemaker tubes which had been pre centrifuged as per the manufacturer's instructions ThermoFisher Scientific A33248 before incubating for 5 minutes at room temperature. 200 µl chloroform was added to each sample. The tubes were then shaken vigorously for 15 seconds and incubated for a further 5 minutes at room temperature. The samples were then centrifuged for 5 minutes at 16 000 x g at 4oC before transferring the RNA containing upper aqueous phase to a sterile centrifuge tube and adding one volume of 70% RNase free ethanol. Samples were inverted to mix thoroughly and the supernatant immediately loaded to an RNEasy MinElute column from the RNeasy Micro Kit Qiagen 74004 before centrifuging for 15 seconds at 10 000 rpm. Wash steps with RW1 buffer RPE buffer and 80% RNase free ethanol was performed as per the RNeasy Micro Kit instructions. Samples were eluted in 14 µl RNase free water. RNA integrity was assessed with the Agilent RNA 6000 Pico chip Agilent 5067 1513 on an Agilent 2100 Bioanalyzer. Only samples with RNA integrity RIN values >9 were used for library preparation. RNA concentrations were measured with the Qubit RNA High Sensitivity Assay Kit ThermoFisher Scientific Q32852 and a Qubit 3.0 fluorometer ThermoFisher Scientific Q33216. cDNA was synthesised using the SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara 634888 and used to make sequencing libraries with the Nextera XT DNA Library Preparation Kit Illumina FC 131 1024. cDNA and library quality were measured with the Agilent High Sensitivity DNA Kit Agilent 5067 4626 on an Agilent 2100 Bioanalyzer. Libraries were sequenced on an Illumina NextSeq500 to a depth of 20 million reads per sample Illumina NextSeq 500/500 High Output Kit v2.5 75 cycles 20024906.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453884,,loader:fastq load.py,Control-VII_S21_L004_R1_001.fastq.gz,fastq,417875320.0,5646817.0,GSM7688781 r4,0:74.00,A:111226895;C:97273168;G:100030641;T:109182520;N:162096,74,,,,111226895,97273168,100030641,109182520,162096,SRX21286656,SRS18536769,SRA1688461,"Lewis Lab, Biology, Syracuse University","Lewis Lab, Biology, Syracuse University",1,0.94352,,0.06524,,0.74442,,0.47095,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2023-08-07,Multi-stage,Embryo,Spinal Cord,Nervous System 25091,SRR25567703,SRX21296461,SRS18545739,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 Homo replicate 2 RNAseq,GSM7696246,,source name:homozygous tie1 mutant embryos|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 Homo replicate 2 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,homozygous tie1 mutant embryos,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696246,GSM7696246: EC tie1 Homo replicate 2 RNAseq; Danio rerio; RNA Seq,GSM7696246 r1,GSM7696246,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,413-Tie1-KO2_S4_L001_R1_001.fastq.gz,fastq,445428400.0,5860900.0,GSM7696246 r1,0:76,A:143568074;C:79903177;G:79677344;T:142230186;N:49619,76,,,,143568074,79903177,79677344,142230186,49619,SRX21296461,SRS18545739,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.75644,,0.67481,,0.78062,,0.49002,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25092,SRR25567704,SRX21296461,SRS18545739,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 Homo replicate 2 RNAseq,GSM7696246,,source name:homozygous tie1 mutant embryos|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 Homo replicate 2 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,homozygous tie1 mutant embryos,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696246,GSM7696246: EC tie1 Homo replicate 2 RNAseq; Danio rerio; RNA Seq,GSM7696246 r1,GSM7696246,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,413-Tie1-KO2_S4_L002_R1_001.fastq.gz,fastq,436280280.0,5740530.0,GSM7696246 r2,0:76,A:140668025;C:78248456;G:77919880;T:139381210;N:62709,76,,,,140668025,78248456,77919880,139381210,62709,SRX21296461,SRS18545739,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.75737,,0.67543,,0.77796,,0.494,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25093,SRR25567705,SRX21296461,SRS18545739,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 Homo replicate 2 RNAseq,GSM7696246,,source name:homozygous tie1 mutant embryos|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 Homo replicate 2 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,homozygous tie1 mutant embryos,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696246,GSM7696246: EC tie1 Homo replicate 2 RNAseq; Danio rerio; RNA Seq,GSM7696246 r1,GSM7696246,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,413-Tie1-KO2_S4_L003_R1_001.fastq.gz,fastq,453115800.0,5962050.0,GSM7696246 r3,0:76,A:145977328;C:81331359;G:81042932;T:144726596;N:37585,76,,,,145977328,81331359,81042932,144726596,37585,SRX21296461,SRS18545739,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.75941,,0.67812,,0.78255,,0.49198,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25094,SRR25567706,SRX21296461,SRS18545739,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 Homo replicate 2 RNAseq,GSM7696246,,source name:homozygous tie1 mutant embryos|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 Homo replicate 2 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,homozygous tie1 mutant embryos,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696246,GSM7696246: EC tie1 Homo replicate 2 RNAseq; Danio rerio; RNA Seq,GSM7696246 r1,GSM7696246,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,413-Tie1-KO2_S4_L004_R1_001.fastq.gz,fastq,451629316.0,5942491.0,GSM7696246 r4,0:76,A:145539227;C:81081378;G:80692220;T:144283694;N:32797,76,,,,145539227,81081378,80692220,144283694,32797,SRX21296461,SRS18545739,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.75907,,0.67763,,0.78074,,0.49757,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25095,SRR25567707,SRX21296460,SRS18545738,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 Homo replicate 1 RNAseq,GSM7696245,,source name:homozygous tie1 mutant embryos|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 Homo replicate 1 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,homozygous tie1 mutant embryos,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696245,GSM7696245: EC tie1 Homo replicate 1 RNAseq; Danio rerio; RNA Seq,GSM7696245 r1,GSM7696245,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,412-Tie1-KO1_S3_L001_R1_001.fastq.gz,fastq,438903344.0,5775044.0,GSM7696245 r1,0:76,A:141636851;C:79318996;G:78779375;T:139120411;N:47711,76,,,,141636851,79318996,78779375,139120411,47711,SRX21296460,SRS18545738,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.76357,,0.65866,,0.76238,,0.48958,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25096,SRR25567708,SRX21296460,SRS18545738,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 Homo replicate 1 RNAseq,GSM7696245,,source name:homozygous tie1 mutant embryos|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 Homo replicate 1 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,homozygous tie1 mutant embryos,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696245,GSM7696245: EC tie1 Homo replicate 1 RNAseq; Danio rerio; RNA Seq,GSM7696245 r1,GSM7696245,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,412-Tie1-KO1_S3_L002_R1_001.fastq.gz,fastq,429344216.0,5649266.0,GSM7696245 r2,0:76,A:138620131;C:77579442;G:76950101;T:136131396;N:63146,76,,,,138620131,77579442,76950101,136131396,63146,SRX21296460,SRS18545738,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.76216,,0.65728,,0.76132,,0.4958,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25097,SRR25567709,SRX21296460,SRS18545738,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 Homo replicate 1 RNAseq,GSM7696245,,source name:homozygous tie1 mutant embryos|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 Homo replicate 1 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,homozygous tie1 mutant embryos,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696245,GSM7696245: EC tie1 Homo replicate 1 RNAseq; Danio rerio; RNA Seq,GSM7696245 r1,GSM7696245,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,412-Tie1-KO1_S3_L003_R1_001.fastq.gz,fastq,446301792.0,5872392.0,GSM7696245 r3,0:76,A:143941333;C:80689335;G:80111561;T:141523625;N:35938,76,,,,143941333,80689335,80111561,141523625,35938,SRX21296460,SRS18545738,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.76416,,0.65858,,0.76177,,0.48634,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25098,SRR25567710,SRX21296460,SRS18545738,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 Homo replicate 1 RNAseq,GSM7696245,,source name:homozygous tie1 mutant embryos|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 Homo replicate 1 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,homozygous tie1 mutant embryos,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696245,GSM7696245: EC tie1 Homo replicate 1 RNAseq; Danio rerio; RNA Seq,GSM7696245 r1,GSM7696245,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,412-Tie1-KO1_S3_L004_R1_001.fastq.gz,fastq,443971252.0,5841727.0,GSM7696245 r4,0:76,A:143197029;C:80287228;G:79639533;T:140816381;N:31081,76,,,,143197029,80287228,79639533,140816381,31081,SRX21296460,SRS18545738,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.77093,,0.66467,,0.76081,,0.49407,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25099,SRR25567711,SRX21296459,SRS18545737,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 WT/Het replicate 2 RNAseq,GSM7696244,,source name:wild type and heterozygous siblings|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 WT/Het replicate 2 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,wild type and heterozygous siblings,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696244,GSM7696244: EC tie1 WT/Het replicate 2 RNAseq; Danio rerio; RNA Seq,GSM7696244 r1,GSM7696244,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,411-Tie1-WT-HT2_S2_L001_R1_001.fastq.gz,fastq,392537796.0,5164971.0,GSM7696244 r1,0:76,A:124144181;C:72762157;G:72562894;T:123025322;N:43242,76,,,,124144181,72762157,72562894,123025322,43242,SRX21296459,SRS18545737,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.78106,,0.59772,,0.73553,,0.48949,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25100,SRR25567712,SRX21296459,SRS18545737,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 WT/Het replicate 2 RNAseq,GSM7696244,,source name:wild type and heterozygous siblings|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 WT/Het replicate 2 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,wild type and heterozygous siblings,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696244,GSM7696244: EC tie1 WT/Het replicate 2 RNAseq; Danio rerio; RNA Seq,GSM7696244 r1,GSM7696244,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,411-Tie1-WT-HT2_S2_L002_R1_001.fastq.gz,fastq,384487572.0,5059047.0,GSM7696244 r2,0:76,A:121620414;C:71266999;G:70967086;T:120577709;N:55364,76,,,,121620414,71266999,70967086,120577709,55364,SRX21296459,SRS18545737,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.77986,,0.59517,,0.73547,,0.48651,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25101,SRR25567713,SRX21296459,SRS18545737,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 WT/Het replicate 2 RNAseq,GSM7696244,,source name:wild type and heterozygous siblings|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 WT/Het replicate 2 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,wild type and heterozygous siblings,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696244,GSM7696244: EC tie1 WT/Het replicate 2 RNAseq; Danio rerio; RNA Seq,GSM7696244 r1,GSM7696244,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,411-Tie1-WT-HT2_S2_L003_R1_001.fastq.gz,fastq,399939360.0,5262360.0,GSM7696244 r3,0:76,A:126400057;C:74196301;G:73931308;T:125379595;N:32099,76,,,,126400057,74196301,73931308,125379595,32099,SRX21296459,SRS18545737,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.77917,,0.59465,,0.7359,,0.48952,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25102,SRR25567714,SRX21296459,SRS18545737,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 WT/Het replicate 2 RNAseq,GSM7696244,,source name:wild type and heterozygous siblings|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 WT/Het replicate 2 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,wild type and heterozygous siblings,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696244,GSM7696244: EC tie1 WT/Het replicate 2 RNAseq; Danio rerio; RNA Seq,GSM7696244 r1,GSM7696244,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,411-Tie1-WT-HT2_S2_L004_R1_001.fastq.gz,fastq,398035712.0,5237312.0,GSM7696244 r4,0:76,A:125843687;C:73845902;G:73489490;T:124828195;N:28438,76,,,,125843687,73845902,73489490,124828195,28438,SRX21296459,SRS18545737,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.77934,,0.59613,,0.73608,,0.48475,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25103,SRR25567715,SRX21296458,SRS18545736,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 WT/Het replicate 1 RNAseq,GSM7696243,,source name:wild type and heterozygous siblings|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 WT/Het replicate 1 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,wild type and heterozygous siblings,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696243,GSM7696243: EC tie1 WT/Het replicate 1 RNAseq; Danio rerio; RNA Seq,GSM7696243 r1,GSM7696243,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,410-Tie1-WT-HT1_S1_L001_R1_001.fastq.gz,fastq,412291944.0,5424894.0,GSM7696243 r1,0:76,A:129182868;C:77123147;G:77053023;T:128887593;N:45313,76,,,,129182868,77123147,77053023,128887593,45313,SRX21296458,SRS18545736,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.79085,,0.52962,,0.7349,,0.48594,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25104,SRR25567716,SRX21296458,SRS18545736,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 WT/Het replicate 1 RNAseq,GSM7696243,,source name:wild type and heterozygous siblings|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 WT/Het replicate 1 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,wild type and heterozygous siblings,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696243,GSM7696243: EC tie1 WT/Het replicate 1 RNAseq; Danio rerio; RNA Seq,GSM7696243 r1,GSM7696243,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,410-Tie1-WT-HT1_S1_L002_R1_001.fastq.gz,fastq,404294768.0,5319668.0,GSM7696243 r2,0:76,A:126685179;C:75658897;G:75455501;T:126437486;N:57705,76,,,,126685179,75658897,75455501,126437486,57705,SRX21296458,SRS18545736,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.79163,,0.52938,,0.73304,,0.48118,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25105,SRR25567717,SRX21296458,SRS18545736,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 WT/Het replicate 1 RNAseq,GSM7696243,,source name:wild type and heterozygous siblings|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 WT/Het replicate 1 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,wild type and heterozygous siblings,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696243,GSM7696243: EC tie1 WT/Het replicate 1 RNAseq; Danio rerio; RNA Seq,GSM7696243 r1,GSM7696243,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,410-Tie1-WT-HT1_S1_L003_R1_001.fastq.gz,fastq,419693128.0,5522278.0,GSM7696243 r3,0:76,A:131491219;C:78551884;G:78434940;T:131179828;N:35257,76,,,,131491219,78551884,78434940,131179828,35257,SRX21296458,SRS18545736,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.79077,,0.52836,,0.73419,,0.48215,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25106,SRR25567718,SRX21296458,SRS18545736,SRP453968,PRJNA1003386,Transcriptional profiles of venous and lymphatic endothelial cells from tie1 mutant zebrafish,GSE240329,Transcriptome Analysis,To investigate what kind of gene expression is regulated downstream of Tie1 signaling we performed RNA seq analyses on venous and lymphatic endothelial cells ECs between homozygous tie1 mutant embryos and their wild type and heterozygous siblings during secondary sprouting respectively. Our analyses indicate that Tie1 signaling controls a series of gene expression involved in lymphatic development including EC migration proliferation and differentiation. Overall design: Comparative gene expression profiling analysis of RNA seq data for endothelial cells from homozygous tie1 mutant embryos and their wild type and heterozygous siblings in zebrafish.,,pubmed:38742432,,EC tie1 WT/Het replicate 1 RNAseq,GSM7696243,,source name:wild type and heterozygous siblings|tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed|geo loc name:missing|collection date:missing,EC tie1 WT/Het replicate 1 RNAseq,RNA Seq data were trimmed using Trim Galore version 0.6.6 and Cutadapt version 2.8. The reads were mapped to a reference genome GRCz11 using HISAT2 version 2.2.1 and the resulting aligned reads were sorted and indexed using SAMtools version 1.7. Relative abundances of genes were measured in TPM using StringTie version 2.1.4. Assembly: GRCz 11 Supplementary files format and content: Excel CSV files include transcripts per million TPM for each sample.,wild type and heterozygous siblings,,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer’s instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,tissue:Trunk and Tail|cell type:Endothelial cells|genotype:Tgkdrl:EGFP;Tglyve1:DsRed,GSM7696243,GSM7696243: EC tie1 WT/Het replicate 1 RNAseq; Danio rerio; RNA Seq,GSM7696243 r1,GSM7696243,1,Trunk and tail region from 47 hpf Tgkdrl:EGFP;Tglyve1:DsRed tie1 / zebrafish embryos with blood flow and their tie1+/? siblings were manually dissected and collected into a low binding 12 well plate. post washed in E3 media samples were incubated with 1 ml of lysis solution containing collagenase P Roche and TrypLE Express Enzyme Gibco for 20 minutes under occasional pipetting. The dissociated cells in suspension medium phenol red free DMEM with 1% FBS 0.8 mM calcium chloride 50 U/ml penicillin and 0.05 mg/ml streptomycin were subjected to cell sorting using a FACS Aria III cell sorter BD Bioscience. EGFP and DsRed double positive cells were collected as venous and lymphatic endothelial cells for further RNA preparation. Total RNAs were prepared from kdrl:EGFP+/lyve1:DsRed+ ECs of tie1 / embryos and their tie1+/? siblings using the NucleoSpin XS kit Macherey Nagel 740902.50 according to the manufacturer's instructions. Reverse transcription and cDNA library preparation were performed with a SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Clontech 634888. Libraries were prepared using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina New England Biolabs E7760,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP453968,,,410-Tie1-WT-HT1_S1_L004_R1_001.fastq.gz,fastq,418155268.0,5502043.0,GSM7696243 r4,0:76,A:130978746;C:78285682;G:78062725;T:130798846;N:29269,76,,,,130978746,78285682,78062725,130798846,29269,SRX21296458,SRS18545736,SRA1688627,"Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute","Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute",1,0.78728,,0.52541,,0.73484,,0.48813,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nebnext,sc,single_cell_plate,smartseq,,Japan,2023-08-08,Pharyngula,Embryo,Multi-tissue,Multi-system 25320,SRR25810878,SRX21533024,SRS18745490,SRP457576,PRJNA1010780,Effect of egr3 knockout on gene expression of dissected zebrafish hearts,GSE241935,Transcriptome Analysis,To screen for Egr3 targets mediating cardiac valve development we assessed gene expression on dissected hearts of egr3 mutants and wild type siblings. Overall design: To evaluate the transcriptional differences underlying the egr3 mutant phenotype we conducted a bulk RNA seq analysis in dissected zebrafish hearts at 48 hpf. We dissected 20 hearts for each biological duplicate of egr3 mutant and wild type sibling samples in cold DMEM with 10% FBS. Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12µl of RNase free water. Analysis of the obtained reads confirmed the 11bp deletion in the mutant samples. 1. Boezio G. L. M. et al. The developing epicardium regulates cardiac chamber morphogenesis by promoting cardiomyocyte growth. Dis Model Mech 16 2023. https://doi.org:10.1242/dmm.049571,,pubmed:38748804,,egr3 wild type siblings 2,GSM7745909,,source name:Heart|tissue:Heart|genotype:bns577+/+|geo loc name:missing|collection date:missing,egr3 wild type siblings 2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 2.27.1 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.2 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.30.1 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2 and batch corrected using CountClust each biological replicate = one batch Dey K et al. Visualizing the structure of RNA seq expression data using grade of membership models. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Assembly: danRer11 Supplementary files format and content: libryr size notmalize amd batch corrected counts,Heart,,Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.,,tissue:Heart|genotype:bns577+/+,GSM7745909,GSM7745909: egr3 wild type siblings 2; Danio rerio; RNA Seq,GSM7745909 r1,GSM7745909,1,Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP457576,,loader:fastq load.py,E22_3626_Lib_Agatha_egr3_WT2_R1.fastq.gz,fastq,3473319384.0,49279465.0,GSM7745909 r1,0:70.48,A:943794847;C:792135324;G:792042625;T:945083925;N:262663,70,,,,943794847,792135324,792042625,945083925,262663,SRX21533024,SRS18745490,SRA1702458,MPI for heart and lung research,MPI for heart and lung research,1,0.68549,,0.04588,,0.76865,,0.44964,,71,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Germany,2023-08-30,Undetermined,Undetermined,Heart,Cardiovascular System 25321,SRR25810879,SRX21533023,SRS18745489,SRP457576,PRJNA1010780,Effect of egr3 knockout on gene expression of dissected zebrafish hearts,GSE241935,Transcriptome Analysis,To screen for Egr3 targets mediating cardiac valve development we assessed gene expression on dissected hearts of egr3 mutants and wild type siblings. Overall design: To evaluate the transcriptional differences underlying the egr3 mutant phenotype we conducted a bulk RNA seq analysis in dissected zebrafish hearts at 48 hpf. We dissected 20 hearts for each biological duplicate of egr3 mutant and wild type sibling samples in cold DMEM with 10% FBS. Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12µl of RNase free water. Analysis of the obtained reads confirmed the 11bp deletion in the mutant samples. 1. Boezio G. L. M. et al. The developing epicardium regulates cardiac chamber morphogenesis by promoting cardiomyocyte growth. Dis Model Mech 16 2023. https://doi.org:10.1242/dmm.049571,,pubmed:38748804,,egr3 wild type siblings 1,GSM7745908,,source name:Heart|tissue:Heart|genotype:bns577+/+|geo loc name:missing|collection date:missing,egr3 wild type siblings 1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 2.27.1 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.2 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.30.1 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2 and batch corrected using CountClust each biological replicate = one batch Dey K et al. Visualizing the structure of RNA seq expression data using grade of membership models. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Assembly: danRer11 Supplementary files format and content: libryr size notmalize amd batch corrected counts,Heart,,Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.,,tissue:Heart|genotype:bns577+/+,GSM7745908,GSM7745908: egr3 wild type siblings 1; Danio rerio; RNA Seq,GSM7745908 r1,GSM7745908,1,Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP457576,,loader:fastq load.py,E22_3626_Lib_Agatha_egr3_WT1_R1.fastq.gz,fastq,3909248616.0,55045571.0,GSM7745908 r1,0:71.02,A:1048107387;C:905014546;G:907455489;T:1048528690;N:142504,71,,,,1048107387,905014546,907455489,1048528690,142504,SRX21533023,SRS18745489,SRA1702458,MPI for heart and lung research,MPI for heart and lung research,1,0.94958,,0.06298,,0.74819,,0.45762,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Germany,2023-08-30,Undetermined,Undetermined,Heart,Cardiovascular System 25322,SRR25810880,SRX21533022,SRS18745488,SRP457576,PRJNA1010780,Effect of egr3 knockout on gene expression of dissected zebrafish hearts,GSE241935,Transcriptome Analysis,To screen for Egr3 targets mediating cardiac valve development we assessed gene expression on dissected hearts of egr3 mutants and wild type siblings. Overall design: To evaluate the transcriptional differences underlying the egr3 mutant phenotype we conducted a bulk RNA seq analysis in dissected zebrafish hearts at 48 hpf. We dissected 20 hearts for each biological duplicate of egr3 mutant and wild type sibling samples in cold DMEM with 10% FBS. Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12µl of RNase free water. Analysis of the obtained reads confirmed the 11bp deletion in the mutant samples. 1. Boezio G. L. M. et al. The developing epicardium regulates cardiac chamber morphogenesis by promoting cardiomyocyte growth. Dis Model Mech 16 2023. https://doi.org:10.1242/dmm.049571,,pubmed:38748804,,egr3 mutants 2,GSM7745907,,source name:Heart|tissue:Heart|genotype:bns577 / |geo loc name:missing|collection date:missing,egr3 mutants 2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 2.27.1 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.2 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.30.1 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2 and batch corrected using CountClust each biological replicate = one batch Dey K et al. Visualizing the structure of RNA seq expression data using grade of membership models. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Assembly: danRer11 Supplementary files format and content: libryr size notmalize amd batch corrected counts,Heart,,Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.,,tissue:Heart|genotype:bns577 / ,GSM7745907,GSM7745907: egr3 mutants 2; Danio rerio; RNA Seq,GSM7745907 r1,GSM7745907,1,Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP457576,,loader:fastq load.py,E22_3626_Lib_Agatha_egr3_Mut2_R1.fastq.gz,fastq,3432675258.0,48483287.0,GSM7745907 r1,0:70.80,A:925832958;C:788551205;G:790129536;T:927993012;N:168547,70,,,,925832958,788551205,790129536,927993012,168547,SRX21533022,SRS18745488,SRA1702458,MPI for heart and lung research,MPI for heart and lung research,1,0.75652,,0.04046,,0.76455,,0.46333,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Germany,2023-08-30,Undetermined,Undetermined,Heart,Cardiovascular System 25323,SRR25810881,SRX21533021,SRS18745487,SRP457576,PRJNA1010780,Effect of egr3 knockout on gene expression of dissected zebrafish hearts,GSE241935,Transcriptome Analysis,To screen for Egr3 targets mediating cardiac valve development we assessed gene expression on dissected hearts of egr3 mutants and wild type siblings. Overall design: To evaluate the transcriptional differences underlying the egr3 mutant phenotype we conducted a bulk RNA seq analysis in dissected zebrafish hearts at 48 hpf. We dissected 20 hearts for each biological duplicate of egr3 mutant and wild type sibling samples in cold DMEM with 10% FBS. Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12µl of RNase free water. Analysis of the obtained reads confirmed the 11bp deletion in the mutant samples. 1. Boezio G. L. M. et al. The developing epicardium regulates cardiac chamber morphogenesis by promoting cardiomyocyte growth. Dis Model Mech 16 2023. https://doi.org:10.1242/dmm.049571,,pubmed:38748804,,egr3 mutants 1,GSM7745906,,source name:Heart|tissue:Heart|genotype:bns577 / |geo loc name:missing|collection date:missing,egr3 mutants 1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Aligned reads were filtered to remove: duplicates with Picard 2.27.1 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.2 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. The raw count matrix was normalized with DESeq2 version 1.30.1 Love et al. Moderated estimation of fold change and dispersion for RNA Seq data with DESeq2 and batch corrected using CountClust each biological replicate = one batch Dey K et al. Visualizing the structure of RNA seq expression data using grade of membership models. Genes were classified as significantly differentially expressed at average count > 5 multiple testing adjusted p value < 0.05 and 0.585 < log2FC > 0.585. Assembly: danRer11 Supplementary files format and content: libryr size notmalize amd batch corrected counts,Heart,,Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.,,tissue:Heart|genotype:bns577 / ,GSM7745906,GSM7745906: egr3 mutants 1; Danio rerio; RNA Seq,GSM7745906 r1,GSM7745906,1,Total RNA was isolated using the miRNeasy micro Kit Qiagen 217084 followed by on column DNase digestion DNase Free DNase Set Qiagen 79254 and final elution was performed in 12μl of RNase free water 10ng total RNA was used for SMART Seq® v4 Ultra® Low Input RNA Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP457576,,loader:fastq load.py,E22_3626_Lib_Agatha_egr3_Mut1_R1.fastq.gz,fastq,3838969347.0,54545950.0,GSM7745906 r1,0:70.38,A:1016913415;C:902500250;G:903033204;T:1016194618;N:327860,70,,,,1016913415,902500250,903033204,1016194618,327860,SRX21533021,SRS18745487,SRA1702458,MPI for heart and lung research,MPI for heart and lung research,1,0.9511,,0.05017,,0.75341,,0.47152,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Germany,2023-08-30,Undetermined,Undetermined,Heart,Cardiovascular System 26558,SRR26173859,SRX21885960,SRS18977085,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 F17 R1,GSM7804200,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 F17 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804200,GSM7804200: V2a sample2 354 F17 R1; Danio rerio; RNA Seq,GSM7804200 r1,GSM7804200,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_F17_R1.fastq.gz,fastq,26979490.0,627430.0,GSM7804200 r1,0:43,A:7493119;C:5872644;G:6013311;T:7600416;N:0,43,,,,7493119,5872644,6013311,7600416,0,SRX21885960,SRS18977085,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.82979,,0.33034,,0.94253,,0.53995,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26559,SRR26173860,SRX21885959,SRS18977083,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 F16 R1,GSM7804199,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 F16 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804199,GSM7804199: V2a sample2 354 F16 R1; Danio rerio; RNA Seq,GSM7804199 r1,GSM7804199,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_F16_R1.fastq.gz,fastq,26312130.0,611910.0,GSM7804199 r1,0:43,A:7117249;C:5957278;G:6103577;T:7134026;N:0,43,,,,7117249,5957278,6103577,7134026,0,SRX21885959,SRS18977083,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.87071,,0.23579,,0.90678,,0.52226,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26560,SRR26173861,SRX21885958,SRS18977084,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 F15 R1,GSM7804198,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 F15 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804198,GSM7804198: V2a sample2 354 F15 R1; Danio rerio; RNA Seq,GSM7804198 r1,GSM7804198,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_F15_R1.fastq.gz,fastq,32073872.0,745904.0,GSM7804198 r1,0:43,A:8695962;C:7255833;G:7422516;T:8699561;N:0,43,,,,8695962,7255833,7422516,8699561,0,SRX21885958,SRS18977084,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.86262,,0.24391,,0.90881,,0.52511,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26561,SRR26173862,SRX21885957,SRS18977081,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 F14 R1,GSM7804197,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 F14 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804197,GSM7804197: V2a sample2 354 F14 R1; Danio rerio; RNA Seq,GSM7804197 r1,GSM7804197,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_F14_R1.fastq.gz,fastq,31158875.0,724625.0,GSM7804197 r1,0:43,A:8769852;C:6707813;G:6866255;T:8814955;N:0,43,,,,8769852,6707813,6866255,8814955,0,SRX21885957,SRS18977081,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.8739,,0.27254,,0.9246,,0.54185,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26562,SRR26173863,SRX21885956,SRS18977082,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 F13 R1,GSM7804196,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 F13 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804196,GSM7804196: V2a sample2 354 F13 R1; Danio rerio; RNA Seq,GSM7804196 r1,GSM7804196,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_F13_R1.fastq.gz,fastq,41289804.0,960228.0,GSM7804196 r1,0:43,A:11114918;C:9358398;G:9568761;T:11247727;N:0,43,,,,11114918,9358398,9568761,11247727,0,SRX21885956,SRS18977082,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.82861,,0.29409,,0.93235,,0.49485,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26563,SRR26173864,SRX21885955,SRS18977079,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 F12 R1,GSM7804195,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 F12 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804195,GSM7804195: V2a sample2 354 F12 R1; Danio rerio; RNA Seq,GSM7804195 r1,GSM7804195,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_F12_R1.fastq.gz,fastq,30569259.0,710913.0,GSM7804195 r1,0:43,A:8286806;C:6854804;G:7028453;T:8399196;N:0,43,,,,8286806,6854804,7028453,8399196,0,SRX21885955,SRS18977079,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.80426,,0.29136,,0.94123,,0.54305,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26564,SRR26173865,SRX21885954,SRS18977080,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 F11 R1,GSM7804194,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 F11 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804194,GSM7804194: V2a sample2 354 F11 R1; Danio rerio; RNA Seq,GSM7804194 r1,GSM7804194,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_F11_R1.fastq.gz,fastq,29626097.0,688979.0,GSM7804194 r1,0:43,A:8063765;C:6645347;G:6803778;T:8113207;N:0,43,,,,8063765,6645347,6803778,8113207,0,SRX21885954,SRS18977080,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.84972,,0.26423,,0.9234,,0.54087,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26565,SRR26173866,SRX21885953,SRS18977078,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 F10 R1,GSM7804193,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 F10 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804193,GSM7804193: V2a sample2 354 F10 R1; Danio rerio; RNA Seq,GSM7804193 r1,GSM7804193,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_F10_R1.fastq.gz,fastq,24594409.0,571963.0,GSM7804193 r1,0:43,A:6605642;C:5535165;G:5682586;T:6771016;N:0,43,,,,6605642,5535165,5682586,6771016,0,SRX21885953,SRS18977078,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.77683,,0.28872,,0.94633,,0.52513,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26566,SRR26173867,SRX21885952,SRS18977077,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 E9 R1,GSM7804168,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 E9 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804168,GSM7804168: V2a sample2 354 E9 R1; Danio rerio; RNA Seq,GSM7804168 r1,GSM7804168,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_E9_R1.fastq.gz,fastq,33259941.0,773487.0,GSM7804168 r1,0:43,A:9004615;C:7506729;G:7674909;T:9073688;N:0,43,,,,9004615,7506729,7674909,9073688,0,SRX21885952,SRS18977077,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.85528,,0.32094,,0.89217,,0.50224,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26567,SRR26173868,SRX21885951,SRS18977076,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 E8 R1,GSM7804167,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 E8 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804167,GSM7804167: V2a sample2 354 E8 R1; Danio rerio; RNA Seq,GSM7804167 r1,GSM7804167,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_E8_R1.fastq.gz,fastq,45348316.0,1054612.0,GSM7804167 r1,0:43,A:12143243;C:10459395;G:10612458;T:12133220;N:0,43,,,,12143243,10459395,10612458,12133220,0,SRX21885951,SRS18977076,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.8783,,0.19318,,0.88572,,0.49101,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26568,SRR26173869,SRX21885950,SRS18977075,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 E7 R1,GSM7804166,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 E7 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804166,GSM7804166: V2a sample2 354 E7 R1; Danio rerio; RNA Seq,GSM7804166 r1,GSM7804166,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_E7_R1.fastq.gz,fastq,30522002.0,709814.0,GSM7804166 r1,0:43,A:8167984;C:7033955;G:7127866;T:8192197;N:0,43,,,,8167984,7033955,7127866,8192197,0,SRX21885950,SRS18977075,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.87804,,0.20762,,0.88418,,0.51381,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26569,SRR26173870,SRX21885949,SRS18977074,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 E6 R1,GSM7804165,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 E6 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804165,GSM7804165: V2a sample2 354 E6 R1; Danio rerio; RNA Seq,GSM7804165 r1,GSM7804165,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_E6_R1.fastq.gz,fastq,39095858.0,909206.0,GSM7804165 r1,0:43,A:10597068;C:8804712;G:8974908;T:10719170;N:0,43,,,,10597068,8804712,8974908,10719170,0,SRX21885949,SRS18977074,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.8093,,0.38297,,0.91545,,0.56195,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26570,SRR26173871,SRX21885948,SRS18977073,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 E5 R1,GSM7804164,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 E5 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804164,GSM7804164: V2a sample2 354 E5 R1; Danio rerio; RNA Seq,GSM7804164 r1,GSM7804164,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_E5_R1.fastq.gz,fastq,33632880.0,782160.0,GSM7804164 r1,0:43,A:9099447;C:7602241;G:7747634;T:9183558;N:0,43,,,,9099447,7602241,7747634,9183558,0,SRX21885948,SRS18977073,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.83226,,0.28405,,0.90715,,0.52148,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26571,SRR26173872,SRX21885947,SRS18977072,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 E4 R1,GSM7804163,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 E4 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804163,GSM7804163: V2a sample2 354 E4 R1; Danio rerio; RNA Seq,GSM7804163 r1,GSM7804163,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_E4_R1.fastq.gz,fastq,10823057.0,251699.0,GSM7804163 r1,0:43,A:3014035;C:2419189;G:2487845;T:2901988;N:0,43,,,,3014035,2419189,2487845,2901988,0,SRX21885947,SRS18977072,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.85783,,0.26946,,0.91033,,0.52459,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26572,SRR26173873,SRX21885946,SRS18977068,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 E3 R1,GSM7804162,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 E3 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804162,GSM7804162: V2a sample2 354 E3 R1; Danio rerio; RNA Seq,GSM7804162 r1,GSM7804162,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_E3_R1.fastq.gz,fastq,49775381.0,1157567.0,GSM7804162 r1,0:43,A:13325978;C:11313973;G:11568082;T:13567348;N:0,43,,,,13325978,11313973,11568082,13567348,0,SRX21885946,SRS18977068,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.80873,,0.29504,,0.93791,,0.52789,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26573,SRR26173874,SRX21885945,SRS18977070,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 E2 R1,GSM7804161,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 E2 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804161,GSM7804161: V2a sample2 354 E2 R1; Danio rerio; RNA Seq,GSM7804161 r1,GSM7804161,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_E2_R1.fastq.gz,fastq,44072334.0,1024938.0,GSM7804161 r1,0:43,A:11780930;C:10068667;G:10185567;T:12037170;N:0,43,,,,11780930,10068667,10185567,12037170,0,SRX21885945,SRS18977070,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.78009,,0.2621,,0.943,,0.54719,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26574,SRR26173875,SRX21885944,SRS18977071,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 D1 R1,GSM7804136,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 D1 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804136,GSM7804136: V2a sample2 354 D1 R1; Danio rerio; RNA Seq,GSM7804136 r1,GSM7804136,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_D1_R1.fastq.gz,fastq,49923.0,1161.0,GSM7804136 r1,0:43,A:12799;C:11604;G:11134;T:14386;N:0,43,,,,12799,11604,11134,14386,0,SRX21885944,SRS18977071,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.5773,,0.18478,,0.99472,,0.51097,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26575,SRR26173876,SRX21885943,SRS18977069,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 C24 R1,GSM7804135,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 C24 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804135,GSM7804135: V2a sample2 354 C24 R1; Danio rerio; RNA Seq,GSM7804135 r1,GSM7804135,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_C24_R1.fastq.gz,fastq,30735540.0,714780.0,GSM7804135 r1,0:43,A:7999390;C:7036767;G:7190113;T:8509270;N:0,43,,,,7999390,7036767,7190113,8509270,0,SRX21885943,SRS18977069,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.48457,,0.16974,,0.99328,,0.82979,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26576,SRR26173877,SRX21885942,SRS18977067,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 C23 R1,GSM7804134,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 C23 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804134,GSM7804134: V2a sample2 354 C23 R1; Danio rerio; RNA Seq,GSM7804134 r1,GSM7804134,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_C23_R1.fastq.gz,fastq,24386031.0,567117.0,GSM7804134 r1,0:43,A:6620599;C:5230020;G:5371347;T:7164065;N:0,43,,,,6620599,5230020,5371347,7164065,0,SRX21885942,SRS18977067,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.55183,,0.13531,,0.99105,,0.54904,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26577,SRR26173878,SRX21885941,SRS18977064,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 C22 R1,GSM7804133,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 C22 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804133,GSM7804133: V2a sample2 354 C22 R1; Danio rerio; RNA Seq,GSM7804133 r1,GSM7804133,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_C22_R1.fastq.gz,fastq,35984550.0,836850.0,GSM7804133 r1,0:43,A:9917644;C:7959027;G:8126203;T:9981676;N:0,43,,,,9917644,7959027,8126203,9981676,0,SRX21885941,SRS18977064,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.85473,,0.2804,,0.91165,,0.52909,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26578,SRR26173879,SRX21885940,SRS18977065,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 C21 R1,GSM7804132,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 C21 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804132,GSM7804132: V2a sample2 354 C21 R1; Danio rerio; RNA Seq,GSM7804132 r1,GSM7804132,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_C21_R1.fastq.gz,fastq,32265738.0,750366.0,GSM7804132 r1,0:43,A:8963112;C:7046873;G:7192067;T:9063686;N:0,43,,,,8963112,7046873,7192067,9063686,0,SRX21885940,SRS18977065,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.8426,,0.36876,,0.91179,,0.58759,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26579,SRR26173880,SRX21885939,SRS18977066,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 C20 R1,GSM7804131,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 C20 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804131,GSM7804131: V2a sample2 354 C20 R1; Danio rerio; RNA Seq,GSM7804131 r1,GSM7804131,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_C20_R1.fastq.gz,fastq,33471157.0,778399.0,GSM7804131 r1,0:43,A:9073629;C:7510863;G:7675381;T:9211284;N:0,43,,,,9073629,7510863,7675381,9211284,0,SRX21885939,SRS18977066,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.82141,,0.28926,,0.93655,,0.49873,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26580,SRR26173881,SRX21885938,SRS18977062,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 C19 R1,GSM7804130,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 C19 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804130,GSM7804130: V2a sample2 354 C19 R1; Danio rerio; RNA Seq,GSM7804130 r1,GSM7804130,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_C19_R1.fastq.gz,fastq,30131304.0,700728.0,GSM7804130 r1,0:43,A:8036932;C:6893678;G:7034855;T:8165839;N:0,43,,,,8036932,6893678,7034855,8165839,0,SRX21885938,SRS18977062,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.80896,,0.25245,,0.94067,,0.54072,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26581,SRR26173882,SRX21885937,SRS18977061,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 C18 R1,GSM7804129,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 C18 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804129,GSM7804129: V2a sample2 354 C18 R1; Danio rerio; RNA Seq,GSM7804129 r1,GSM7804129,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_C18_R1.fastq.gz,fastq,31050429.0,722103.0,GSM7804129 r1,0:43,A:8363024;C:7088111;G:7227301;T:8371993;N:0,43,,,,8363024,7088111,7227301,8371993,0,SRX21885937,SRS18977061,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.87399,,0.20843,,0.89881,,0.49682,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26582,SRR26173883,SRX21885936,SRS18977063,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 B17 R1,GSM7804104,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 B17 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804104,GSM7804104: V2a sample2 354 B17 R1; Danio rerio; RNA Seq,GSM7804104 r1,GSM7804104,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_B17_R1.fastq.gz,fastq,47093729.0,1095203.0,GSM7804104 r1,0:43,A:13057598;C:10185883;G:10457076;T:13393172;N:0,43,,,,13057598,10185883,10457076,13393172,0,SRX21885936,SRS18977063,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.80343,,0.36098,,0.95059,,0.52562,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26583,SRR26173884,SRX21885935,SRS18977060,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 B16 R1,GSM7804103,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 B16 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804103,GSM7804103: V2a sample2 354 B16 R1; Danio rerio; RNA Seq,GSM7804103 r1,GSM7804103,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_B16_R1.fastq.gz,fastq,34160791.0,794437.0,GSM7804103 r1,0:43,A:9178469;C:7729053;G:7901331;T:9351938;N:0,43,,,,9178469,7729053,7901331,9351938,0,SRX21885935,SRS18977060,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.79028,,0.25695,,0.94627,,0.51668,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26584,SRR26173885,SRX21885934,SRS18977059,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 B15 R1,GSM7804102,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 B15 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804102,GSM7804102: V2a sample2 354 B15 R1; Danio rerio; RNA Seq,GSM7804102 r1,GSM7804102,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_B15_R1.fastq.gz,fastq,29152495.0,677965.0,GSM7804102 r1,0:43,A:7966546;C:6516464;G:6675123;T:7994362;N:0,43,,,,7966546,6516464,6675123,7994362,0,SRX21885934,SRS18977059,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.83832,,0.25969,,0.92673,,0.51661,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26585,SRR26173886,SRX21885933,SRS18977057,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 B14 R1,GSM7804101,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 B14 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804101,GSM7804101: V2a sample2 354 B14 R1; Danio rerio; RNA Seq,GSM7804101 r1,GSM7804101,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_B14_R1.fastq.gz,fastq,23811379.0,553753.0,GSM7804101 r1,0:43,A:6532691;C:5215122;G:5353003;T:6710563;N:0,43,,,,6532691,5215122,5353003,6710563,0,SRX21885933,SRS18977057,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.74067,,0.3282,,0.95272,,0.49582,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26586,SRR26173887,SRX21885932,SRS18977058,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 B13 R1,GSM7804100,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 B13 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804100,GSM7804100: V2a sample2 354 B13 R1; Danio rerio; RNA Seq,GSM7804100 r1,GSM7804100,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_B13_R1.fastq.gz,fastq,18141356.0,421892.0,GSM7804100 r1,0:43,A:4926550;C:4092334;G:4186281;T:4936191;N:0,43,,,,4926550,4092334,4186281,4936191,0,SRX21885932,SRS18977058,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.87463,,0.22642,,0.89826,,0.50541,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26587,SRR26173888,SRX21885931,SRS18977056,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 B12 R1,GSM7804099,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 B12 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804099,GSM7804099: V2a sample2 354 B12 R1; Danio rerio; RNA Seq,GSM7804099 r1,GSM7804099,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_B12_R1.fastq.gz,fastq,34932039.0,812373.0,GSM7804099 r1,0:43,A:9555191;C:7704451;G:7897587;T:9774810;N:0,43,,,,9555191,7704451,7897587,9774810,0,SRX21885931,SRS18977056,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.80402,,0.30224,,0.93592,,0.53659,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26588,SRR26173889,SRX21885930,SRS18977055,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 B11 R1,GSM7804098,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 B11 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804098,GSM7804098: V2a sample2 354 B11 R1; Danio rerio; RNA Seq,GSM7804098 r1,GSM7804098,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_B11_R1.fastq.gz,fastq,35987087.0,836909.0,GSM7804098 r1,0:43,A:9801738;C:8047161;G:8248020;T:9890168;N:0,43,,,,9801738,8047161,8248020,9890168,0,SRX21885930,SRS18977055,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.81805,,0.24526,,0.92092,,0.54523,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26589,SRR26173890,SRX21885929,SRS18977054,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 B10 R1,GSM7804097,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 B10 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804097,GSM7804097: V2a sample2 354 B10 R1; Danio rerio; RNA Seq,GSM7804097 r1,GSM7804097,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_B10_R1.fastq.gz,fastq,33252846.0,773322.0,GSM7804097 r1,0:43,A:8996915;C:7433025;G:7633859;T:9189047;N:0,43,,,,8996915,7433025,7633859,9189047,0,SRX21885929,SRS18977054,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.78892,,0.28622,,0.94237,,0.53023,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26590,SRR26173891,SRX21885928,SRS18977053,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 A9 R1,GSM7804072,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 A9 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804072,GSM7804072: V2a sample2 354 A9 R1; Danio rerio; RNA Seq,GSM7804072 r1,GSM7804072,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_A9_R1.fastq.gz,fastq,23658600.0,550200.0,GSM7804072 r1,0:43,A:6447300;C:5342358;G:5472128;T:6396814;N:0,43,,,,6447300,5342358,5472128,6396814,0,SRX21885928,SRS18977053,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.86727,,0.23136,,0.8996,,0.52692,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26591,SRR26173892,SRX21885927,SRS18977051,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 A8 R1,GSM7804071,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 A8 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804071,GSM7804071: V2a sample2 354 A8 R1; Danio rerio; RNA Seq,GSM7804071 r1,GSM7804071,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_A8_R1.fastq.gz,fastq,18645187.0,433609.0,GSM7804071 r1,0:43,A:5151340;C:4145072;G:4243308;T:5105467;N:0,43,,,,5151340,4145072,4243308,5105467,0,SRX21885927,SRS18977051,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.86561,,0.28633,,0.89438,,0.53463,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26592,SRR26173893,SRX21885926,SRS18977052,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 A7 R1,GSM7804070,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 A7 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804070,GSM7804070: V2a sample2 354 A7 R1; Danio rerio; RNA Seq,GSM7804070 r1,GSM7804070,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_A7_R1.fastq.gz,fastq,42340466.0,984662.0,GSM7804070 r1,0:43,A:11373539;C:9660020;G:9840242;T:11466665;N:0,43,,,,11373539,9660020,9840242,11466665,0,SRX21885926,SRS18977052,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.81646,,0.24599,,0.93833,,0.57817,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26593,SRR26173894,SRX21885925,SRS18977050,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 A6 R1,GSM7804069,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 A6 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804069,GSM7804069: V2a sample2 354 A6 R1; Danio rerio; RNA Seq,GSM7804069 r1,GSM7804069,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_A6_R1.fastq.gz,fastq,23486858.0,546206.0,GSM7804069 r1,0:43,A:6654369;C:4998242;G:5115579;T:6718668;N:0,43,,,,6654369,4998242,5115579,6718668,0,SRX21885925,SRS18977050,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.84122,,0.57245,,0.77794,,0.53266,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26594,SRR26173895,SRX21885924,SRS18977048,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 A5 R1,GSM7804068,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 A5 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804068,GSM7804068: V2a sample2 354 A5 R1; Danio rerio; RNA Seq,GSM7804068 r1,GSM7804068,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_A5_R1.fastq.gz,fastq,46876450.0,1090150.0,GSM7804068 r1,0:43,A:12599291;C:10693086;G:10940020;T:12644053;N:0,43,,,,12599291,10693086,10940020,12644053,0,SRX21885924,SRS18977048,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.86707,,0.22085,,0.89412,,0.51257,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26595,SRR26173896,SRX21885923,SRS18977049,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 A4 R1,GSM7804067,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 A4 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804067,GSM7804067: V2a sample2 354 A4 R1; Danio rerio; RNA Seq,GSM7804067 r1,GSM7804067,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_A4_R1.fastq.gz,fastq,43487233.0,1011331.0,GSM7804067 r1,0:43,A:11900913;C:9677048;G:9921622;T:11987650;N:0,43,,,,11900913,9677048,9921622,11987650,0,SRX21885923,SRS18977049,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.8409,,0.27122,,0.91165,,0.55221,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26596,SRR26173897,SRX21885922,SRS18977047,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 A3 R1,GSM7804066,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 A3 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804066,GSM7804066: V2a sample2 354 A3 R1; Danio rerio; RNA Seq,GSM7804066 r1,GSM7804066,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_A3_R1.fastq.gz,fastq,44287248.0,1029936.0,GSM7804066 r1,0:43,A:12065729;C:9907516;G:10143806;T:12170197;N:0,43,,,,12065729,9907516,10143806,12170197,0,SRX21885922,SRS18977047,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.80982,,0.29232,,0.93675,,0.5661,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System 26597,SRR26173898,SRX21885921,SRS18977046,SRP463130,PRJNA1020854,Molecular blueprints for spinal circuit modules controlling locomotor speed,GSE243993,Transcriptome Analysis,The flexibility of motor actions is ingrained in the diversity of neurons and how they are organized into functional circuit modules yet our knowledge of the molecular underpinning of motor circuit modularity remains limited. Locomotion is a motor behavior characterized by sudden changes in speed and strength enabled by the coordinated recruitment of different motoneuron subtypes. Here we use adult zebrafish to link the molecular diversity of motoneurons and the rhythm generating V2a interneurons with their modular circuit organization that is responsible for changes in locomotor speed. We show that the molecular diversity of motoneurons and V2a interneurons reflects their functional segregation into slow intermediate or fast subtypes. Furthermore we reveal shared molecular signatures between V2a interneurons and motoneurons of the three speed circuit modules. Overall by characterizing how the molecular diversity of motoneurons and V2a interneurons relates to their function connectivity and behavior our study provides important insights not only into the molecular mechanisms for neuronal and circuit diversity for locomotor flexibility but also for charting circuits for motor actions in general. Overall design: To determine whether the functional subtypes of motoneurons and V2a Chx10+ interneurons are molecularly distinct we performed single cell RNA sequencing respectively on adult islet1a:GFP and chx10:GFP transgenic zebrafish using SmartSeq2.,,pubmed:37919423,,V2a sample2 354 A2 R1,GSM7804065,,source name:Spinal cord|tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons|geo loc name:missing|collection date:missing,V2a sample2 354 A2 R1,The reads from each sequenced cell were mapped to the zebrafish reference genome “Danio rerio Ensembl GRCz11” using STAR version 2.5.3a. The resulting bam files were filtered to keep only uniquely mapped reads. Most of the following analysis was performed in R version 4.0.5 R core team 2022 using the Seurat package version 4.0.2. Assembly: GRCz11 Supplementary files format and content: .csv files with gene count matrixes; .txt and .csv metadata files and .rds files containing R objects from Seurat analysis,Spinal cord,,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,tissue:Spinal cord|cell line:Chx10:GFP|cell type:V2a interneurons,GSM7804065,GSM7804065: V2a sample2 354 A2 R1; Danio rerio; RNA Seq,GSM7804065 r1,GSM7804065,1,Adult animals 7 wpf of either sex were deeply anesthetized in a slush of frozen extracellular solution containing in mM: 134 NaCl 2.9 KCl 2.1 CaCl2 1.2 MgCl2 10 HEPES and 10 glucose with pH of 7.8 adjusted with NaOH and osmolarity of 290 mOsm. The spinal cord was quickly dissected in the slush of frozen extracellular solution and collected. Two samples were prepared from the Tgislet1a:GFP line and two samples were prepared from the Tgchx10:GFP line. For each sample 6 to 10 intact isolated spinal cords were incubated in 1 ml of DMEM F12 medium Thermo Fisher #11039021 osmolarity adjusted to 280 280 mOsm containing papain 10 U/ml Worthington biochem #LK003178 on a heated shaker at 37°C for 15 min. DMEM/F 12 1 ml 280 290 mOsm was added to stop the enzymatic reaction. The sample was centrifuged at 300 g at 4°C for 5 min and then re suspended in 0.5 ml of DMEM/F 12 280 290 mOsm post removal of the supernatant. Following mechanical trituration using fire polished Pasteur pipettes the cell suspension was filtered through a cell 16 strainer 40 μm. The sample was kept at room temperature for 20 min post the addition of 0 1 ml of the nuclear DNA stain DRAQ5 Thermo Fisher #65 0880 92. Using fluorescence activated cell sorting FACs cells positive for GFP and DRAQ5 in each sample were sorted into a 384 wells plate containing a mild hypotonic lysis buffer 0.2% Triton X 100 2 U/ml RNase inhibitor and immediately snap frozen on ice then stored at 80°C. Smart Seq2,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP463130,,,SS2_18_354_A2_R1.fastq.gz,fastq,39822515.0,926105.0,GSM7804065 r1,0:43,A:10662390;C:9155016;G:9361757;T:10643352;N:0,43,,,,10662390,9155016,9361757,10643352,0,SRX21885921,SRS18977046,SRA1719948,"Neuroscience, Karolinaska Institutet","Neuroscience, Karolinaska Institutet",1,0.88377,,0.19244,,0.88627,,0.52412,,43,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,smartseq,,Sweden,2023-09-25,Juvenile,Juvenile,Spinal Cord,Nervous System