rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
101,DRR189403,DRX179868,DRS200418,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 30 min post test session of 2 weeks memory test in non trace 2 Way Active Avoidance coditioning 3,SAMD00182246,,sample name:CSUS Tel 30 2w memory 3|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182246,DRX179868,CSUS Tel 30 2w memory 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182246,,,,2791119960.0,77531110.0,DRR189403,0:36,A:685050951;C:641519684;G:664655385;T:799677669;N:216271,36,,,,685050951,641519684,664655385,799677669,216271,DRX179868,DRS200418,DRA008865,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89653,,0.1773,,0.70725,,0.49873,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Larval,Larval,Brain,Nervous System
102,DRR189402,DRX179867,DRS200417,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 30 min post test session of 2 weeks memory test in non trace 2 Way Active Avoidance coditioning 2,SAMD00182245,,sample name:CSUS Tel 30 2w memory 2|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182245,DRX179867,CSUS Tel 30 2w memory 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182245,,,,1505449224.0,41818034.0,DRR189402,0:36,A:369895057;C:346914787;G:358624651;T:429897489;N:117240,36,,,,369895057,346914787,358624651,429897489,117240,DRX179867,DRS200417,DRA008865,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89514,,0.17677,,0.7025,,0.49571,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Larval,Larval,Brain,Nervous System
103,DRR189401,DRX179866,DRS200416,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 30 min post test session of 2 weeks memory test in non trace 2 Way Active Avoidance coditioning 1,SAMD00182244,,sample name:CSUS Tel 30 2w memory 1|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182244,DRX179866,CSUS Tel 30 2w memory 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182244,,,,2088507024.0,58014084.0,DRR189401,0:36,A:516255405;C:478036869;G:496415722;T:597637091;N:161937,36,,,,516255405,478036869,496415722,597637091,161937,DRX179866,DRS200416,DRA008865,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89533,,0.18553,,0.70981,,0.49554,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Larval,Larval,Brain,Nervous System
104,DRR189400,DRX179865,DRS200401,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 30 min post test session of 1 day memory test in non trace 2 Way Active Avoidance coditioning 3,SAMD00182243,,sample name:CSUS Tel 30 1d memory 3|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182243,DRX179865,CSUS Tel 30 1d memory 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182243,,,,1340808120.0,37244670.0,DRR189400,0:36,A:330513975;C:306935584;G:320089399;T:383165274;N:103888,36,,,,330513975,306935584,320089399,383165274,103888,DRX179865,DRS200401,DRA008864,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89272,,0.19494,,0.70335,,0.49456,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
105,DRR189399,DRX179864,DRS200400,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 30 min post test session of 1 day memory test in non trace 2 Way Active Avoidance coditioning 2,SAMD00182242,,sample name:CSUS Tel 30 1d memory 2|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182242,DRX179864,CSUS Tel 30 1d memory 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182242,,,,1279740096.0,35548336.0,DRR189399,0:36,A:314850837;C:294188093;G:304654881;T:365946483;N:99802,36,,,,314850837,294188093,304654881,365946483,99802,DRX179864,DRS200400,DRA008864,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89485,,0.18205,,0.70593,,0.49333,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
106,DRR189398,DRX179863,DRS200399,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 30 min post test session of 1 day memory test in non trace 2 Way Active Avoidance coditioning 1,SAMD00182241,,sample name:CSUS Tel 30 1d memory 1|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182241,DRX179863,CSUS Tel 30 1d memory 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182241,,,,3012353100.0,83676475.0,DRR189398,0:36,A:740795057;C:693120664;G:717419185;T:860784745;N:233449,36,,,,740795057,693120664,717419185,860784745,233449,DRX179863,DRS200399,DRA008864,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89676,,0.1791,,0.70569,,0.49835,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
107,DRR189397,DRX179862,DRS200428,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post exposure to the conditioning tank 3,SAMD00182240,,sample name:Cont Tel 60 3|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182240,DRX179862,Cont Tel 60 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,500Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182240,,,,5590147750.0,111802955.0,DRR189397,0:50,A:1365131560;C:1269631295;G:1366791321;T:1588422020;N:171554,50,,,,1365131560,1269631295,1366791321,1588422020,171554,DRX179862,DRS200428,DRA008863,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89334,,0.16354,,0.7011,,0.49383,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
108,DRR189396,DRX179861,DRS200427,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post exposure to the conditioning tank 2,SAMD00182239,,sample name:Cont Tel 60 2|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182239,DRX179861,Cont Tel 60 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,500Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182239,,,,6429019650.0,128580393.0,DRR189396,0:50,A:1570141412;C:1457539089;G:1572785681;T:1828358007;N:195461,50,,,,1570141412,1457539089,1572785681,1828358007,195461,DRX179861,DRS200427,DRA008863,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89595,,0.16204,,0.70743,,0.49805,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
109,DRR189395,DRX179860,DRS200426,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post exposure to the conditioning tank 1,SAMD00182238,,sample name:Cont Tel 60 1|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182238,DRX179860,Cont Tel 60 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,500Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182238,,,,6644185850.0,132883717.0,DRR189395,0:50,A:1637322491;C:1498943556;G:1616212676;T:1891505597;N:201530,50,,,,1637322491,1498943556,1616212676,1891505597,201530,DRX179860,DRS200426,DRA008863,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89573,,0.16421,,0.7037,,0.49805,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
110,DRR189394,DRX179859,DRS200407,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post light stimulation in the conditioning tank 3,SAMD00182237,,sample name:CS Tel 60 3|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182237,DRX179859,CS Tel 60 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182237,,,,1387078956.0,38529971.0,DRR189394,0:36,A:333990578;C:315361737;G:337599372;T:400057968;N:69301,36,,,,333990578,315361737,337599372,400057968,69301,DRX179859,DRS200407,DRA008862,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.88133,,0.18418,,0.70747,,0.4971,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
111,DRR189393,DRX179858,DRS200406,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post light stimulation in the conditioning tank 2,SAMD00182236,,sample name:CS Tel 60 2|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182236,DRX179858,CS Tel 60 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182236,,,,537029424.0,14917484.0,DRR189393,0:36,A:127421487;C:122494467;G:132164579;T:154921150;N:27741,36,,,,127421487,122494467,132164579,154921150,27741,DRX179858,DRS200406,DRA008862,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.88264,,0.17793,,0.7083,,0.49123,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
112,DRR189392,DRX179857,DRS200405,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post light stimulation in the conditioning tank 1,SAMD00182235,,sample name:CS Tel 60 1|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182235,DRX179857,CS Tel 60 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182235,,,,3163663656.0,87879546.0,DRR189392,0:36,A:766146692;C:714108562;G:771785405;T:911468887;N:154110,36,,,,766146692,714108562,771785405,911468887,154110,DRX179857,DRS200405,DRA008862,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.88114,,0.1803,,0.7052,,0.4917,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
113,DRR189391,DRX179856,DRS200404,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post electrical shock delivery in the conditioning tank 3,SAMD00182234,,sample name:US Tel 60 3|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182234,DRX179856,US Tel 60 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182234,,,,1535884704.0,42663464.0,DRR189391,0:36,A:367444721;C:350978310;G:375524359;T:441859454;N:77860,36,,,,367444721,350978310,375524359,441859454,77860,DRX179856,DRS200404,DRA008861,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.88103,,0.1788,,0.7082,,0.49462,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
114,DRR189390,DRX179855,DRS200403,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post electrical shock delivery in the conditioning tank 2,SAMD00182233,,sample name:US Tel 60 2|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182233,DRX179855,US Tel 60 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182233,,,,737309916.0,20480831.0,DRR189390,0:36,A:176982713;C:168284406;G:179343270;T:212662841;N:36686,36,,,,176982713,168284406,179343270,212662841,36686,DRX179855,DRS200403,DRA008861,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.87995,,0.18515,,0.70816,,0.49393,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
115,DRR189389,DRX179854,DRS200402,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post electrical shock delivery in the conditioning tank 1,SAMD00182232,,sample name:US Tel 60 1|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182232,DRX179854,US Tel 60 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182232,,,,595837404.0,16551039.0,DRR189389,0:36,A:143956004;C:134783754;G:145443580;T:171624939;N:29127,36,,,,143956004,134783754,145443580,171624939,29127,DRX179854,DRS200402,DRA008861,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.87682,,0.18328,,0.70309,,0.49081,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
116,DRR189388,DRX179853,DRS200452,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post light and electrical shock association in non trace 2 Way Active Avoidance coditioning 3,SAMD00182231,,sample name:CSUS Tel 60 3|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182231,DRX179853,CSUS Tel 60 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182231,,,,608050044.0,16890279.0,DRR189388,0:36,A:145025778;C:137906052;G:149542672;T:175545338;N:30204,36,,,,145025778,137906052,149542672,175545338,30204,DRX179853,DRS200452,DRA008860,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.87983,,0.18602,,0.70445,,0.49195,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
117,DRR189387,DRX179852,DRS200451,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post light and electrical shock association in non trace 2 Way Active Avoidance coditioning 2,SAMD00182230,,sample name:CSUS Tel 60 2|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182230,DRX179852,CSUS Tel 60 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182230,,,,777589452.0,21599707.0,DRR189387,0:36,A:185463269;C:177742981;G:190443063;T:223900096;N:40043,36,,,,185463269,177742981,190443063,223900096,40043,DRX179852,DRS200451,DRA008860,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.88331,,0.17918,,0.70516,,0.48956,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
118,DRR189386,DRX179851,DRS200450,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of adult zebrafrish 60 min post light and electrical shock association in non trace 2 Way Active Avoidance coditioning 1,SAMD00182229,,sample name:CSUS Tel 60 1|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182229,DRX179851,CSUS Tel 60 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182229,,,,2738622348.0,76072843.0,DRR189386,0:36,A:662989485;C:622023190;G:663013857;T:790459930;N:135886,36,,,,662989485,622023190,663013857,790459930,135886,DRX179851,DRS200450,DRA008860,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.87743,,0.19164,,0.70025,,0.49073,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
119,DRR189385,DRX179850,DRS200435,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of EMX3 / adult zebrafish 3,SAMD00182228,,sample name:Emx3 Adult Tel 3|genotype:Emx3 / |tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182228,DRX179850,Emx3 / Adult Tel 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182228,,,,1323636552.0,36767682.0,DRR189385,0:36,A:309582925;C:310206951;G:325673647;T:378136039;N:36990,36,,,,309582925,310206951,325673647,378136039,36990,DRX179850,DRS200435,DRA008859,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.8932,,0.19244,,0.71334,,0.50591,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
120,DRR189384,DRX179849,DRS200434,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of EMX3 / adult zebrafish 2,SAMD00182227,,sample name:Emx3 Adult Tel 2|genotype:Emx3 / |tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182227,DRX179849,Emx3 / Adult Tel 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182227,,,,2994105168.0,83169588.0,DRR189384,0:36,A:709730692;C:691531995;G:727245229;T:865514929;N:82323,36,,,,709730692,691531995,727245229,865514929,82323,DRX179849,DRS200434,DRA008859,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.90382,,0.1826,,0.70197,,0.49719,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
121,DRR189383,DRX179848,DRS200433,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of EMX3 / adult zebrafish 1,SAMD00182226,,sample name:Emx3 Adult Tel 1|genotype:Emx3 / |tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182226,DRX179848,Emx3 / Adult Tel 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182226,,,,1151464896.0,31985136.0,DRR189383,0:36,A:272427216;C:266708394;G:280781178;T:331515997;N:32111,36,,,,272427216,266708394,280781178,331515997,32111,DRX179848,DRS200433,DRA008859,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89942,,0.17402,,0.70364,,0.49438,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
122,DRR189382,DRX179847,DRS200421,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of wild type adult zebrafish 3,SAMD00182225,,sample name:WT Adult Tel 3|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182225,DRX179847,WT Adult Tel 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182225,,,,2837488824.0,78819134.0,DRR189382,0:36,A:678395895;C:655098137;G:687520693;T:816395518;N:78581,36,,,,678395895,655098137,687520693,816395518,78581,DRX179847,DRS200421,DRA008858,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89483,,0.18623,,0.70544,,0.49839,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
123,DRR189381,DRX179846,DRS200420,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of wild type adult zebrafish 2,SAMD00182224,,sample name:WT Adult Tel 2|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182224,DRX179846,WT Adult Tel 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182224,,,,1456800264.0,40466674.0,DRR189381,0:36,A:345320431;C:336838149;G:356264798;T:418336552;N:40334,36,,,,345320431,336838149,356264798,418336552,40334,DRX179846,DRS200420,DRA008858,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89496,,0.18691,,0.70802,,0.49721,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
124,DRR189380,DRX179845,DRS200419,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Telencephalon of wild type adult zebrafish 1,SAMD00182223,,sample name:WT Adult Tel 1|genotype:wild type|tissue:brain,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182223,DRX179845,WT Adult Tel 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182223,,,,2533282452.0,70368957.0,DRR189380,0:36,A:602595083;C:585466052;G:616064286;T:729086926;N:70105,36,,,,602595083,585466052,616064286,729086926,70105,DRX179845,DRS200419,DRA008858,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89412,,0.19005,,0.70816,,0.49843,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Adult,Adult,Brain,Nervous System
125,DRR189379,DRX179844,DRS200410,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Whole body of EMX3 / larval zebrafish 5dpf 3,SAMD00182222,,sample name:Emx3 Larva body 3|genotype:Emx3 / |tissue:whole body,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182222,DRX179844,Emx3 / Larva body 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182222,,,,1759409208.0,48872478.0,DRR189379,0:36,A:401147348;C:424523813;G:426350919;T:507310828;N:76300,36,,,,401147348,424523813,426350919,507310828,76300,DRX179844,DRS200410,DRA008857,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.90975,,0.11439,,0.66076,,0.47775,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Larval,Larval,Trunk,Surface Structure
126,DRR189378,DRX179843,DRS200409,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Whole body of EMX3 / larval zebrafish 5dpf 2,SAMD00182221,,sample name:Emx3 Larva body 2|genotype:Emx3 / |tissue:whole body,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182221,DRX179843,Emx3 / Larva body 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182221,,,,1318201020.0,36616695.0,DRR189378,0:36,A:297850068;C:316786585;G:323717530;T:379789606;N:57231,36,,,,297850068,316786585,323717530,379789606,57231,DRX179843,DRS200409,DRA008857,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.9116,,0.11269,,0.65837,,0.46733,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Larval,Larval,Trunk,Surface Structure
127,DRR189377,DRX179842,DRS200408,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Whole body of EMX3 / larval zebrafish 5dpf 1,SAMD00182220,,sample name:Emx3 Larva body 1|genotype:Emx3 / |tissue:whole body,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182220,DRX179842,Emx3 / Larva body 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182220,,,,812483964.0,22568999.0,DRR189377,0:36,A:185173338;C:197790160;G:197482964;T:232000884;N:36618,36,,,,185173338,197790160,197482964,232000884,36618,DRX179842,DRS200408,DRA008857,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.91107,,0.1171,,0.65981,,0.47458,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Larval,Larval,Trunk,Surface Structure
128,DRR189376,DRX179841,DRS200449,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Whole body of wild type larval zebrafish 5dpf 3,SAMD00182219,,sample name:WT Larva body 3|genotype:wild type|tissue:whole body,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182219,DRX179841,WT Larva body 3,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182219,,,,4030038144.0,111945504.0,DRR189376,0:36,A:943709984;C:971756680;G:977594500;T:1136798448;N:178532,36,,,,943709984,971756680,977594500,1136798448,178532,DRX179841,DRS200449,DRA008856,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.89574,,0.12331,,0.65831,,0.48096,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Larval,Larval,Trunk,Surface Structure
129,DRR189375,DRX179840,DRS200448,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Whole body of wild type larval zebrafish 5dpf 2,SAMD00182218,,sample name:WT Larva body 2|genotype:wild type|tissue:whole body,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182218,DRX179840,WT Larva body 2,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182218,,,,1991670804.0,55324189.0,DRR189375,0:36,A:454367176;C:479012055;G:488407231;T:569793674;N:90668,36,,,,454367176,479012055,488407231,569793674,90668,DRX179840,DRS200448,DRA008856,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.90911,,0.12455,,0.65494,,0.47971,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Larval,Larval,Trunk,Surface Structure
130,DRR189374,DRX179839,DRS200447,DRP003977,PRJDB4470,Gene expression analysis of the zebrafish brain,DRP003977,Other,Gene expression profiling by RNA seq of specific regions and subpopulations of neurons in the zebrafish brain that control behaviors.,,,,Whole body of wild type larval zebrafish 5dpf 1,SAMD00182217,,sample name:WT Larva body 1|genotype:wild type|tissue:whole body,,,,,,,,,Illumina HiSeq 3000 sequencing of SAMD00182217,DRX179839,WT Larva body 1,1,SureSelect Strand Specific RNA Library Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 3000,360Application ReadForward1,DRP003977,Illumina HiSeq 3000 sequencing of SAMD00182217,,,,1018340100.0,28287225.0,DRR189374,0:36,A:233370050;C:244140659;G:247795084;T:292989542;N:44765,36,,,,233370050,244140659,247795084,292989542,44765,DRX179839,DRS200447,DRA008856,NIG|National Institute of Genetics (Japan),National Institute of Genetics (Japan),1,0.91078,,0.12578,,0.6524,,0.48016,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2021-08-08,Larval,Larval,Trunk,Surface Structure
174,DRR084198,DRX078029,DRS086523,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,in vivo testosterone treatment,zebrafish ovary isolated from adult fish in vivo testoster1 treatment. [RNAseq replicate2],SAMD00073605,,sample name:TES1 4th|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073605,DRX078029,zebrafish ovary isolated from adult fish in vivo testosterone treatment. [RNAseq replicate2],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073605,,,,1382763132.0,38410087.0,DRR084198,0:36,A:314367195;C:333340483;G:353519828;T:378654329;N:2881297,36,,,,314367195,333340483,353519828,378654329,2881297,DRX078029,DRS086523,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.90366,,0.02033,,0.77104,,0.46543,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
175,DRR084197,DRX078028,DRS086522,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,natural paring early sample,zebrafish ovary isolated from adult fish natural paring oocyte maturation. [RNAseq replicate2],SAMD00073604,,sample name:M 4th|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073604,DRX078028,zebrafish ovary isolated from adult fish natural paring oocyte maturation. [RNAseq replicate2],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073604,,,,1389837888.0,38606608.0,DRR084197,0:36,A:320671418;C:336948866;G:347550258;T:381720581;N:2946765,36,,,,320671418,336948866,347550258,381720581,2946765,DRX078028,DRS086522,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.89763,,0.02235,,0.76445,,0.46381,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Zygote,Embryo,Multi-tissue,Multi-system
176,DRR084196,DRX078027,DRS086521,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,in vivo ethanol treatment,zebrafish ovary isolated from adult fish in vivo ethanol treatment. [RNAseq replicate2],SAMD00073603,,sample name:Et 4th|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073603,DRX078027,zebrafish ovary isolated from adult fish in vivo ethanol treatment. [RNAseq replicate2],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073603,,,,1456791660.0,40466435.0,DRR084196,0:36,A:336533534;C:355126203;G:368021063;T:394179246;N:2931614,36,,,,336533534,355126203,368021063,394179246,2931614,DRX078027,DRS086521,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.89408,,0.02082,,0.77027,,0.45866,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
177,DRR084195,DRX078026,DRS086520,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,natural paring late sample,zebrafish ovary isolated from adult fish natural paring ovulation. [RNAseq replicate2],SAMD00073602,,sample name:O 4th|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073602,DRX078026,zebrafish ovary isolated from adult fish natural paring ovulation. [RNAseq replicate2],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073602,,,,1627945092.0,45220697.0,DRR084195,0:36,A:381205209;C:392853175;G:410714269;T:439790560;N:3381879,36,,,,381205209,392853175,410714269,439790560,3381879,DRX078026,DRS086520,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.89419,,0.02159,,0.76848,,0.46407,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
178,DRR084194,DRX078025,DRS086519,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,in vivo maturation inducing hormone DHP treatment,zebrafish ovary isolated from adult fish in vivo maturation inducing horm1 DHP treatment. [RNAseq replicate2],SAMD00073601,,sample name:DHP 4th|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073601,DRX078025,zebrafish ovary isolated from adult fish in vivo maturation inducing hormone DHP treatment. [RNAseq replicate2],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073601,,,,969680196.0,26935561.0,DRR084194,0:36,A:223558856;C:233793515;G:244712298;T:265549055;N:2066472,36,,,,223558856,233793515,244712298,265549055,2066472,DRX078025,DRS086519,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.90178,,0.02203,,0.76579,,0.46491,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
179,DRR084193,DRX078024,DRS086518,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,in vivo diethylstilbestrol DES treatment,zebrafish ovary isolated from adult fish in vivo diethylstilbestrol DES treatment. [RNAseq replicate2],SAMD00073600,,sample name:DES 4th|replicate:biological replicate 2,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073600,DRX078024,zebrafish ovary isolated from adult fish in vivo diethylstilbestrol DES treatment. [RNAseq replicate2],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073600,,,,825301296.0,22925036.0,DRR084193,0:36,A:189771874;C:198593952;G:209666041;T:225480165;N:1789264,36,,,,189771874,198593952,209666041,225480165,1789264,DRX078024,DRS086518,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.90036,,0.0197,,0.7721,,0.45773,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
180,DRR084192,DRX078023,DRS086517,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,natural paring late sample,zebrafish ovary isolated from adult fish natural paring ovulation. [RNAseq replicate1],SAMD00073599,,sample name:O|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073599,DRX078023,zebrafish ovary isolated from adult fish natural paring ovulation. [RNAseq replicate1],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073599,,,,1474870356.0,40968621.0,DRR084192,0:36,A:334130826;C:361572335;G:369758908;T:409173431;N:234856,36,,,,334130826,361572335,369758908,409173431,234856,DRX078023,DRS086517,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.91516,,0.02086,,0.76792,,0.47914,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
181,DRR084191,DRX078022,DRS086516,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,natural paring early sample,zebrafish ovary isolated from adult fish natural paring oocyte maturation. [RNAseq replicate1],SAMD00073598,,sample name:M|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073598,DRX078022,zebrafish ovary isolated from adult fish natural paring oocyte maturation. [RNAseq replicate1],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073598,,,,1050981012.0,29193917.0,DRR084191,0:36,A:241048832;C:256186268;G:260277071;T:293299597;N:169244,36,,,,241048832,256186268,260277071,293299597,169244,DRX078022,DRS086516,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.9088,,0.02369,,0.7624,,0.47998,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Zygote,Embryo,Multi-tissue,Multi-system
182,DRR084190,DRX078021,DRS086515,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,in vivo maturation inducing hormone DHP treatment,zebrafish ovary isolated from adult fish in vivo maturation inducing horm1 DHP treatment. [RNAseq replicate1],SAMD00073597,,sample name:DHP|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073597,DRX078021,zebrafish ovary isolated from adult fish in vivo maturation inducing hormone DHP treatment. [RNAseq replicate1],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073597,,,,1527194556.0,42422071.0,DRR084190,0:36,A:352068936;C:371030475;G:383086948;T:420761508;N:246689,36,,,,352068936,371030475,383086948,420761508,246689,DRX078021,DRS086515,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.91815,,0.02248,,0.76209,,0.46867,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
183,DRR084189,DRX078020,DRS086514,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,in vivo testosterone treatment,zebrafish ovary isolated from adult fish in vivo testoster1 treatment. [RNAseq replicate1],SAMD00073596,,sample name:TES|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073596,DRX078020,zebrafish ovary isolated from adult fish in vivo testosterone treatment. [RNAseq replicate1],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073596,,,,1403618796.0,38989411.0,DRR084189,0:36,A:321063874;C:342718133;G:352434647;T:387171455;N:230687,36,,,,321063874,342718133,352434647,387171455,230687,DRX078020,DRS086514,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.91583,,0.02212,,0.76073,,0.47596,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
184,DRR084188,DRX078019,DRS086513,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,in vivo diethylstilbestrol DES treatment,zebrafish ovary isolated from adult fish in vivo diethylstilbestrol DES treatment. [RNAseq replicate1],SAMD00073595,,sample name:DES|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073595,DRX078019,zebrafish ovary isolated from adult fish in vivo diethylstilbestrol DES treatment. [RNAseq replicate1],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073595,,,,1532053512.0,42557042.0,DRR084188,0:36,A:342701220;C:372650449;G:392432461;T:424025702;N:243680,36,,,,342701220,372650449,392432461,424025702,243680,DRX078019,DRS086513,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.91276,,0.01965,,0.77358,,0.46461,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
185,DRR084187,DRX078018,DRS086512,DRP004758,PRJDB5490,Fine selection of up regulated genes duirng ovulation by in vivo induction of oocyte maturation and ovulation in zebrafish,DRP004758,Other,Two essential processes oocyte maturation and ovulation before oocytes become fertilizable that are independently induced but co operatively proceeded at the final step in oogenesis. Eventhough these two processes are induced by same maturation inducing steroid 17 20 beta dihydroxy 4 pregnen 3 one 17 20 beta DHP in teleost the receptor for each pathway is suggested to be different and thus signal transduction pathways are different. While much progresses achieved on the molecular mechanisms for induction of oocyte maturation the mechanisms to induce ovulation is under elucidation. Previously we established the procedure that can make it possible to prepare the ovarian tissue which contains oocyte maturation induced oocytes in vivo. In the same way ovulation can be induced in alive zebrafish. Thus it became possible to select the genes up regulated according to ovulation by compare the gene expression between maturation inducing genes in matured oocytes and both maturation and ovulation inducing genes in ovulated eggs. In vivo bioassay has been applied to prepare maturated and ovulated ovarian samples. Specifically up regulated genes to induce ovulation will be selected by RNA seq analysis. The mRNA abundance of highly up regulated genes will be confirmed by q PCR analysis. By this project ovulation inducing genes will be selected and its roles in induction of ovulation will be addressed in the future.,,,in vivo ethanol treatment,zebrafish ovary isolated from adult fish in vivo ethanol treatment. [RNAseq replicate1],SAMD00073594,,sample name:EtOH|replicate:biological replicate 1,,,,,,,,,Illumina HiSeq 2500 sequencing of SAMD00073594,DRX078018,zebrafish ovary isolated from adult fish in vivo ethanol treatment. [RNAseq replicate1],1,Agilent SureSelect Strand Specific RNA Prep Kit,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 2500,360Application ReadForward1,DRP004758,Illumina HiSeq 2500 sequencing of SAMD00073594,,,,1152032724.0,32000909.0,DRR084187,0:36,A:265166034;C:279617628;G:285136940;T:321928656;N:183466,36,,,,265166034,279617628,285136940,321928656,183466,DRX078018,DRS086512,DRA005484,SHIZUOKA|Shizuoka University,Shizuoka University,1,0.90791,,0.02405,,0.75972,,0.48931,,36,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Japan,2019-01-23,Adult,Adult,Gonad,Reproductive System
9651,ERR3266392,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L001_R1_001.fastq.gz,fastq,603238067.0,8014716.0,E MTAB 7846:sponge tdr gfp positive rep2 lane1,0:75.27 1:0,A:164797697;C:136552121;G:141138007;T:160737152;N:13090,75,0,,,164797697,136552121,141138007,160737152,13090,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95083,,0.06432,,0.71532,,0.50098,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9652,ERR3266393,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L002_R1_001.fastq.gz,fastq,603749720.0,8021069.0,E MTAB 7846:sponge tdr gfp positive rep2 lane2,0:75.27 1:0,A:164972969;C:136661417;G:141205792;T:160896264;N:13278,75,0,,,164972969,136661417,141205792,160896264,13278,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.951,,0.06542,,0.71768,,0.50051,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9653,ERR3266394,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L003_R1_001.fastq.gz,fastq,608154053.0,8079704.0,E MTAB 7846:sponge tdr gfp positive rep2 lane3,0:75.27 1:0,A:166117918;C:137731172;G:142320339;T:161970092;N:14532,75,0,,,166117918,137731172,142320339,161970092,14532,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95155,,0.0657,,0.71634,,0.49493,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9654,ERR3266395,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L004_R1_001.fastq.gz,fastq,599143392.0,7959897.0,E MTAB 7846:sponge tdr gfp positive rep2 lane4,0:75.27 1:0,A:163706904;C:135622453;G:140192351;T:159605249;N:16435,75,0,,,163706904,135622453,140192351,159605249,16435,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95061,,0.06431,,0.71764,,0.50166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9655,ERR3266388,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L001_R1_001.fastq.gz,fastq,616761505.0,8202480.0,E MTAB 7846:sponge tdr gfp positive rep1 lane1,0:75.19 1:0,A:168679238;C:139548565;G:143969797;T:164545362;N:18543,75,0,,,168679238,139548565,143969797,164545362,18543,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95019,,0.06806,,0.7097,,0.50337,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9656,ERR3266389,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L002_R1_001.fastq.gz,fastq,617529482.0,8212485.0,E MTAB 7846:sponge tdr gfp positive rep1 lane2,0:75.19 1:0,A:168925757;C:139655387;G:144096837;T:164831236;N:20265,75,0,,,168925757,139655387,144096837,164831236,20265,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9492,,0.06753,,0.712,,0.49881,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9657,ERR3266390,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L003_R1_001.fastq.gz,fastq,624156883.0,8300861.0,E MTAB 7846:sponge tdr gfp positive rep1 lane3,0:75.19 1:0,A:170696950;C:141302376;G:145759286;T:166377781;N:20490,75,0,,,170696950,141302376,145759286,166377781,20490,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94917,,0.06724,,0.71291,,0.50783,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9658,ERR3266391,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L004_R1_001.fastq.gz,fastq,615013615.0,8179180.0,E MTAB 7846:sponge tdr gfp positive rep1 lane4,0:75.19 1:0,A:168237742;C:139106952;G:143535658;T:164110735;N:22528,75,0,,,168237742,139106952,143535658,164110735,22528,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94892,,0.06723,,0.71206,,0.50775,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9659,ERR3266384,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L001_R1_001.fastq.gz,fastq,659562366.0,8762947.0,E MTAB 7846:sponge tdr gfp negative rep2 lane1,0:75.27 1:0,A:178744772;C:150091912;G:155092318;T:175619332;N:14032,75,0,,,178744772,150091912,155092318,175619332,14032,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9517,,0.06908,,0.70822,,0.48025,,73,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9660,ERR3266385,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L002_R1_001.fastq.gz,fastq,658688825.0,8751176.0,E MTAB 7846:sponge tdr gfp negative rep2 lane2,0:75.27 1:0,A:178540155;C:149844100;G:154850294;T:175438757;N:15519,75,0,,,178540155,149844100,154850294,175438757,15519,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95059,,0.06748,,0.70806,,0.48177,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9661,ERR3266386,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L003_R1_001.fastq.gz,fastq,665901310.0,8846927.0,E MTAB 7846:sponge tdr gfp negative rep2 lane3,0:75.27 1:0,A:180412445;C:151589489;G:156677030;T:177206192;N:16154,75,0,,,180412445,151589489,156677030,177206192,16154,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95095,,0.06855,,0.7082,,0.4787,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9662,ERR3266387,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L004_R1_001.fastq.gz,fastq,655674573.0,8711278.0,E MTAB 7846:sponge tdr gfp negative rep2 lane4,0:75.27 1:0,A:177658097;C:149188009;G:154201531;T:174609176;N:17760,75,0,,,177658097,149188009,154201531,174609176,17760,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9503,,0.06838,,0.70926,,0.47475,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9663,ERR3266380,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L001_R1_001.fastq.gz,fastq,634491637.0,8440052.0,E MTAB 7846:sponge tdr gfp negative rep1 lane1,0:75.18 1:0,A:170881257;C:145535643;G:150561786;T:167495156;N:17795,75,0,,,170881257,145535643,150561786,167495156,17795,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94996,,0.05672,,0.70571,,0.48691,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9664,ERR3266381,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L002_R1_001.fastq.gz,fastq,632900752.0,8418846.0,E MTAB 7846:sponge tdr gfp negative rep1 lane2,0:75.18 1:0,A:170454908;C:145141392;G:150172752;T:167112562;N:19138,75,0,,,170454908,145141392,150172752,167112562,19138,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94905,,0.05627,,0.70457,,0.4865,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9665,ERR3266382,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L003_R1_001.fastq.gz,fastq,638530115.0,8494045.0,E MTAB 7846:sponge tdr gfp negative rep1 lane3,0:75.17 1:0,A:171907482;C:146526309;G:151612209;T:168464163;N:19952,75,0,,,171907482,146526309,151612209,168464163,19952,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94919,,0.05578,,0.70849,,0.48073,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9666,ERR3266383,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L004_R1_001.fastq.gz,fastq,627433322.0,8346505.0,E MTAB 7846:sponge tdr gfp negative rep1 lane4,0:75.17 1:0,A:169016383;C:143886824;G:148914725;T:165593528;N:21862,75,0,,,169016383,143886824,148914725,165593528,21862,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94993,,0.05721,,0.7052,,0.48878,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9667,ERR3266376,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L001_R1_001.fastq.gz,fastq,618672195.0,8218047.0,E MTAB 7846:sponge isl gfp positive rep2 lane1,0:75.28 1:0,A:166422886;C:142212204;G:146857539;T:163167819;N:11747,75,0,,,166422886,142212204,146857539,163167819,11747,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94979,,0.08351,,0.70863,,0.47581,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9668,ERR3266377,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L002_R1_001.fastq.gz,fastq,618709102.0,8218295.0,E MTAB 7846:sponge isl gfp positive rep2 lane2,0:75.28 1:0,A:166470432;C:142189977;G:146819280;T:163216323;N:13090,75,0,,,166470432,142189977,146819280,163216323,13090,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94977,,0.08255,,0.70644,,0.47228,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9669,ERR3266378,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L003_R1_001.fastq.gz,fastq,625353059.0,8306375.0,E MTAB 7846:sponge isl gfp positive rep2 lane3,0:75.29 1:0,A:168233274;C:143793178;G:148510556;T:164802476;N:13575,75,0,,,168233274,143793178,148510556,164802476,13575,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95014,,0.08368,,0.70743,,0.47846,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9670,ERR3266379,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L004_R1_001.fastq.gz,fastq,615204990.0,8171748.0,E MTAB 7846:sponge isl gfp positive rep2 lane4,0:75.28 1:0,A:165565861;C:141380152;G:146028839;T:162214263;N:15875,75,0,,,165565861,141380152,146028839,162214263,15875,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94954,,0.08233,,0.70834,,0.48166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9671,ERR3266372,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L001_R1_001.fastq.gz,fastq,626474467.0,8318996.0,E MTAB 7846:sponge isl gfp positive rep1 lane1,0:75.31 1:0,A:170186220;C:142441110;G:147048643;T:166786401;N:12093,75,0,,,170186220,142441110,147048643,166786401,12093,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94907,,0.08132,,0.69684,,0.4736,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9672,ERR3266373,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L002_R1_001.fastq.gz,fastq,626477579.0,8318750.0,E MTAB 7846:sponge isl gfp positive rep1 lane2,0:75.31 1:0,A:170185337;C:142396801;G:147032265;T:166850532;N:12644,75,0,,,170185337,142396801,147032265,166850532,12644,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.08253,,0.6957,,0.47554,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9673,ERR3266374,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L003_R1_001.fastq.gz,fastq,632098509.0,8393388.0,E MTAB 7846:sponge isl gfp positive rep1 lane3,0:75.31 1:0,A:171699353;C:143766296;G:148442110;T:168177264;N:13486,75,0,,,171699353,143766296,148442110,168177264,13486,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94866,,0.08247,,0.69601,,0.48009,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9674,ERR3266375,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L004_R1_001.fastq.gz,fastq,622997479.0,8272752.0,E MTAB 7846:sponge isl gfp positive rep1 lane4,0:75.31 1:0,A:169306677;C:141586415;G:146241288;T:165847752;N:15347,75,0,,,169306677,141586415,146241288,165847752,15347,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9483,,0.08034,,0.69662,,0.47868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9675,ERR3266368,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L001_R1_001.fastq.gz,fastq,707454819.0,9395082.0,E MTAB 7846:sponge isl gfp negative rep2 lane1,0:75.30 1:0,A:194991862;C:157927850;G:163280639;T:191241488;N:12980,75,0,,,194991862,157927850,163280639,191241488,12980,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93871,,0.08926,,0.70806,,0.46501,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9676,ERR3266369,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L002_R1_001.fastq.gz,fastq,704791838.0,9359668.0,E MTAB 7846:sponge isl gfp negative rep2 lane2,0:75.30 1:0,A:194317422;C:157276895;G:162624670;T:190558322;N:14529,75,0,,,194317422,157276895,162624670,190558322,14529,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93816,,0.08859,,0.70999,,0.4661,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9677,ERR3266370,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L003_R1_001.fastq.gz,fastq,715991833.0,9508323.0,E MTAB 7846:sponge isl gfp negative rep2 lane3,0:75.30 1:0,A:197297222;C:159913026;G:165363927;T:193402765;N:14893,75,0,,,197297222,159913026,165363927,193402765,14893,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93844,,0.08854,,0.70828,,0.46042,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9678,ERR3266371,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L004_R1_001.fastq.gz,fastq,703723869.0,9345669.0,E MTAB 7846:sponge isl gfp negative rep2 lane4,0:75.30 1:0,A:194029886;C:157050176;G:162432310;T:190193608;N:17889,75,0,,,194029886,157050176,162432310,190193608,17889,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93897,,0.08993,,0.70863,,0.45707,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9679,ERR3266364,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L001_R1_001.fastq.gz,fastq,676581458.0,8983758.0,E MTAB 7846:sponge isl gfp negative rep1 lane1,0:75.31 1:0,A:184297337;C:153352193;G:158268476;T:180651038;N:12414,75,0,,,184297337,153352193,158268476,180651038,12414,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94981,,0.07715,,0.69138,,0.47243,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9680,ERR3266365,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L002_R1_001.fastq.gz,fastq,676876555.0,8987445.0,E MTAB 7846:sponge isl gfp negative rep1 lane2,0:75.31 1:0,A:184435129;C:153332402;G:158323789;T:180770978;N:14257,75,0,,,184435129,153332402,158323789,180770978,14257,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94901,,0.07805,,0.69179,,0.47182,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9681,ERR3266366,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L003_R1_001.fastq.gz,fastq,681771213.0,9052615.0,E MTAB 7846:sponge isl gfp negative rep1 lane3,0:75.31 1:0,A:185717696;C:154552039;G:159567102;T:181919781;N:14595,75,0,,,185717696,154552039,159567102,181919781,14595,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94923,,0.07768,,0.69167,,0.47219,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9682,ERR3266367,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L004_R1_001.fastq.gz,fastq,671169917.0,8911624.0,E MTAB 7846:sponge isl gfp negative rep1 lane4,0:75.31 1:0,A:182910490;C:152045814;G:157010053;T:179186548;N:17012,75,0,,,182910490,152045814,157010053,179186548,17012,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.07612,,0.69106,,0.47736,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9683,ERR3266360,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L001_R1_001.fastq.gz,fastq,745666738.0,9917771.0,E MTAB 7846:sponge ccn gfp positive rep2 lane1,0:75.18 1:0,A:207714377;C:163732420;G:169037726;T:205161925;N:20290,75,0,,,207714377,163732420,169037726,205161925,20290,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94006,,0.17809,,0.68166,,0.48912,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9684,ERR3266361,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L002_R1_001.fastq.gz,fastq,747693645.0,9944395.0,E MTAB 7846:sponge ccn gfp positive rep2 lane2,0:75.19 1:0,A:208257288;C:164106384;G:169478025;T:205830399;N:21549,75,0,,,208257288,164106384,169478025,205830399,21549,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93873,,0.17738,,0.68296,,0.49656,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9685,ERR3266362,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L003_R1_001.fastq.gz,fastq,756134124.0,10056818.0,E MTAB 7846:sponge ccn gfp positive rep2 lane3,0:75.19 1:0,A:210573012;C:166089133;G:171475300;T:207973232;N:23447,75,0,,,210573012,166089133,171475300,207973232,23447,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94077,,0.18001,,0.68004,,0.49812,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9686,ERR3266363,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L004_R1_001.fastq.gz,fastq,747687619.0,9944417.0,E MTAB 7846:sponge ccn gfp positive rep2 lane4,0:75.19 1:0,A:208315943;C:164104155;G:169484250;T:205757712;N:25559,75,0,,,208315943,164104155,169484250,205757712,25559,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94025,,0.17965,,0.68124,,0.49249,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9687,ERR3266356,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L001_R1_001.fastq.gz,fastq,600153564.0,7972767.0,E MTAB 7846:sponge ccn gfp positive rep1 lane1,0:75.28 1:0,A:165075878;C:133961511;G:138306424;T:162797903;N:11848,75,0,,,165075878,133961511,138306424,162797903,11848,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95367,,0.14146,,0.69154,,0.46621,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9688,ERR3266357,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L002_R1_001.fastq.gz,fastq,600790169.0,7981038.0,E MTAB 7846:sponge ccn gfp positive rep1 lane2,0:75.28 1:0,A:165262968;C:133988329;G:138458635;T:163066854;N:13383,75,0,,,165262968,133988329,138458635,163066854,13383,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95365,,0.14116,,0.69301,,0.46836,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9689,ERR3266358,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L003_R1_001.fastq.gz,fastq,608611085.0,8084904.0,E MTAB 7846:sponge ccn gfp positive rep1 lane3,0:75.28 1:0,A:167402055;C:135871708;G:140314669;T:165009252;N:13401,75,0,,,167402055,135871708,140314669,165009252,13401,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95403,,0.14167,,0.69311,,0.4702,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9690,ERR3266359,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L004_R1_001.fastq.gz,fastq,599558663.0,7964718.0,E MTAB 7846:sponge ccn gfp positive rep1 lane4,0:75.28 1:0,A:164965131;C:133749666;G:138194884;T:162633558;N:15424,75,0,,,164965131,133749666,138194884,162633558,15424,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95285,,0.14085,,0.69037,,0.47345,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9691,ERR3266352,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L001_R1_001.fastq.gz,fastq,599599608.0,7970460.0,E MTAB 7846:sponge ccn gfp negative rep2 lane1,0:75.23 1:0,A:162236409;C:136907675;G:141538730;T:158902520;N:14274,75,0,,,162236409,136907675,141538730,158902520,14274,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95404,,0.05923,,0.69737,,0.48627,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9692,ERR3266353,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L002_R1_001.fastq.gz,fastq,600057776.0,7976438.0,E MTAB 7846:sponge ccn gfp negative rep2 lane2,0:75.23 1:0,A:162367410;C:136994919;G:141577782;T:159102194;N:15471,75,0,,,162367410,136994919,141577782,159102194,15471,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.953,,0.06085,,0.6952,,0.48868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9693,ERR3266354,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L003_R1_001.fastq.gz,fastq,607089697.0,8069901.0,E MTAB 7846:sponge ccn gfp negative rep2 lane3,0:75.23 1:0,A:164235344;C:138684000;G:143335680;T:160819270;N:15403,75,0,,,164235344,138684000,143335680,160819270,15403,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95245,,0.06055,,0.69589,,0.48813,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9694,ERR3266355,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L004_R1_001.fastq.gz,fastq,598098243.0,7950223.0,E MTAB 7846:sponge ccn gfp negative rep2 lane4,0:75.23 1:0,A:161836808;C:136564804;G:141157424;T:158521860;N:17347,75,0,,,161836808,136564804,141157424,158521860,17347,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95299,,0.06032,,0.69501,,0.48928,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9695,ERR3266348,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L001_R1_001.fastq.gz,fastq,668175990.0,8872549.0,E MTAB 7846:sponge ccn gfp negative rep1 lane1,0:75.31 1:0,A:179859350;C:153483169;G:158360605;T:176462088;N:10778,75,0,,,179859350,153483169,158360605,176462088,10778,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95955,,0.07154,,0.69696,,0.46425,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9696,ERR3266349,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L002_R1_001.fastq.gz,fastq,668154755.0,8872093.0,E MTAB 7846:sponge ccn gfp negative rep1 lane2,0:75.31 1:0,A:179811687;C:153454931;G:158314391;T:176560936;N:12810,75,0,,,179811687,153454931,158314391,176560936,12810,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96029,,0.06969,,0.69684,,0.46725,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9697,ERR3266350,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L003_R1_001.fastq.gz,fastq,676984426.0,8989004.0,E MTAB 7846:sponge ccn gfp negative rep1 lane3,0:75.31 1:0,A:182159685;C:155578195;G:160511499;T:178722363;N:12684,75,0,,,182159685,155578195,160511499,178722363,12684,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96012,,0.07159,,0.69554,,0.46811,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9698,ERR3266351,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L004_R1_001.fastq.gz,fastq,666031892.0,8843695.0,E MTAB 7846:sponge ccn gfp negative rep1 lane4,0:75.31 1:0,A:179243298;C:152946459;G:157873912;T:175953752;N:14471,75,0,,,179243298,152946459,157873912,175953752,14471,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96014,,0.07169,,0.69493,,0.47058,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures
9874,ERR4132490,ERX4099806,ERS4552001,ERP121652,PRJEB38247,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E-MTAB-9054,Transcriptome Analysis,Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R904,SAMEA6824372,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 11T17:12:34Z|External Id:SAMEA6824372|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 11T17:12:34Z|INSDC status:public|Submitter Id:E MTAB 9054:R904|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:low exposure|individual:mixed pool of 10 fish|organism part:whole organism|rin values:10|sample name:E MTAB 9054:R904|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E MTAB 9054:R904 s,R904 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:6 propyl 2 thiouracil|Experimental Factor: dose:0.001,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121652,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,R904_sr.fastq.gz,fastq,1605165390.0,31794192.0,E MTAB 9054:R904,0:50.49 1:0,A:412564740;C:388045945;G:374953342;T:427657902;N:1943461,50,0,,,412564740,388045945,374953342,427657902,1943461,ERX4099806,ERS4552001,ERA2597157,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.93893,,0.09893,,0.64646,,0.47809,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-11,Larval,Larval,Whole Organism,All anatomical structures
9875,ERR4132489,ERX4099805,ERS4552000,ERP121652,PRJEB38247,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E-MTAB-9054,Transcriptome Analysis,Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R900,SAMEA6824371,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 11T17:12:34Z|External Id:SAMEA6824371|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 11T17:12:34Z|INSDC status:public|Submitter Id:E MTAB 9054:R900|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:low exposure|individual:mixed pool of 10 fish|organism part:whole organism|rin values:9.6|sample name:E MTAB 9054:R900|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E MTAB 9054:R900 s,R900 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:6 propyl 2 thiouracil|Experimental Factor: dose:0.001,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121652,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,R900_sr.fastq.gz,fastq,1597198644.0,31638370.0,E MTAB 9054:R900,0:50.48 1:0,A:410085529;C:386591071;G:373950085;T:424276623;N:2295336,50,0,,,410085529,386591071,373950085,424276623,2295336,ERX4099805,ERS4552000,ERA2597157,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.93876,,0.09801,,0.64889,,0.48057,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-11,Larval,Larval,Whole Organism,All anatomical structures
9876,ERR4132488,ERX4099804,ERS4551999,ERP121652,PRJEB38247,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E-MTAB-9054,Transcriptome Analysis,Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R896,SAMEA6824370,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 11T17:12:34Z|External Id:SAMEA6824370|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 11T17:12:34Z|INSDC status:public|Submitter Id:E MTAB 9054:R896|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:low exposure|individual:mixed pool of 10 fish|organism part:whole organism|rin values:10|sample name:E MTAB 9054:R896|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E MTAB 9054:R896 s,R896 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:6 propyl 2 thiouracil|Experimental Factor: dose:0.001,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121652,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,R896_sr.fastq.gz,fastq,1946340744.0,38553341.0,E MTAB 9054:R896,0:50.48 1:0,A:497881336;C:472722708;G:455800573;T:517246014;N:2690113,50,0,,,497881336,472722708,455800573,517246014,2690113,ERX4099804,ERS4551999,ERA2597157,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.93904,,0.10115,,0.64885,,0.47903,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-11,Larval,Larval,Whole Organism,All anatomical structures
9877,ERR4132487,ERX4099803,ERS4551998,ERP121652,PRJEB38247,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E-MTAB-9054,Transcriptome Analysis,Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R906,SAMEA6824369,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 11T17:12:34Z|External Id:SAMEA6824369|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 11T17:12:34Z|INSDC status:public|Submitter Id:E MTAB 9054:R906|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:high exposure|individual:mixed pool of 10 fish|organism part:whole organism|rin values:9.8|sample name:E MTAB 9054:R906|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E MTAB 9054:R906 s,R906 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:6 propyl 2 thiouracil|Experimental Factor: dose:0.1,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121652,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,R906_sr.fastq.gz,fastq,2341343751.0,46379726.0,E MTAB 9054:R906,0:50.48 1:0,A:597650493;C:569437401;G:551299383;T:619558551;N:3397923,50,0,,,597650493,569437401,551299383,619558551,3397923,ERX4099803,ERS4551998,ERA2597157,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.94175,,0.09795,,0.65153,,0.47478,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-11,Larval,Larval,Whole Organism,All anatomical structures
9878,ERR4132486,ERX4099802,ERS4551997,ERP121652,PRJEB38247,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E-MTAB-9054,Transcriptome Analysis,Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R902,SAMEA6824368,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 11T17:12:34Z|External Id:SAMEA6824368|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 11T17:12:34Z|INSDC status:public|Submitter Id:E MTAB 9054:R902|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:high exposure|individual:mixed pool of 10 fish|organism part:whole organism|rin values:10|sample name:E MTAB 9054:R902|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E MTAB 9054:R902 s,R902 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:6 propyl 2 thiouracil|Experimental Factor: dose:0.1,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121652,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,R902_sr.fastq.gz,fastq,1632244657.0,32331034.0,E MTAB 9054:R902,0:50.49 1:0,A:413710466;C:400183665;G:387130890;T:428954946;N:2264690,50,0,,,413710466,400183665,387130890,428954946,2264690,ERX4099802,ERS4551997,ERA2597157,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.94282,,0.09186,,0.65192,,0.48446,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-11,Larval,Larval,Whole Organism,All anatomical structures
9879,ERR4132485,ERX4099801,ERS4551996,ERP121652,PRJEB38247,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E-MTAB-9054,Transcriptome Analysis,Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R898,SAMEA6824367,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 11T17:12:34Z|External Id:SAMEA6824367|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 11T17:12:34Z|INSDC status:public|Submitter Id:E MTAB 9054:R898|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:high exposure|individual:mixed pool of 10 fish|organism part:whole organism|rin values:9.8|sample name:E MTAB 9054:R898|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E MTAB 9054:R898 s,R898 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:6 propyl 2 thiouracil|Experimental Factor: dose:0.1,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121652,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,R898_sr.fastq.gz,fastq,1973588979.0,39097363.0,E MTAB 9054:R898,0:50.48 1:0,A:501700006;C:481059078;G:466931881;T:520778140;N:3119874,50,0,,,501700006,481059078,466931881,520778140,3119874,ERX4099801,ERS4551996,ERA2597157,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.94133,,0.09578,,0.651,,0.474,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-11,Larval,Larval,Whole Organism,All anatomical structures
9880,ERR4132484,ERX4099800,ERS4551995,ERP121652,PRJEB38247,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E-MTAB-9054,Transcriptome Analysis,Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R903,SAMEA6824366,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 11T17:12:34Z|External Id:SAMEA6824366|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 11T17:12:34Z|INSDC status:public|Submitter Id:E MTAB 9054:R903|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:normal|individual:mixed pool of 10 fish|organism part:whole organism|rin values:9.8|sample name:E MTAB 9054:R903|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E MTAB 9054:R903 s,R903 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121652,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,R903_sr.fastq.gz,fastq,1978975800.0,39199481.0,E MTAB 9054:R903,0:50.48 1:0,A:502614523;C:482986303;G:468168184;T:522608062;N:2598728,50,0,,,502614523,482986303,468168184,522608062,2598728,ERX4099800,ERS4551995,ERA2597157,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.9404,,0.09216,,0.64607,,0.47417,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-11,Larval,Larval,Whole Organism,All anatomical structures
9881,ERR4132483,ERX4099799,ERS4551994,ERP121652,PRJEB38247,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E-MTAB-9054,Transcriptome Analysis,Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R899,SAMEA6824365,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 11T17:12:34Z|External Id:SAMEA6824365|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 11T17:12:34Z|INSDC status:public|Submitter Id:E MTAB 9054:R899|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:normal|individual:mixed pool of 10 fish|organism part:whole organism|rin values:10|sample name:E MTAB 9054:R899|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E MTAB 9054:R899 s,R899 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121652,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,R899_sr.fastq.gz,fastq,1556233879.0,30835141.0,E MTAB 9054:R899,0:50.47 1:0,A:394448696;C:380284673;G:367546543;T:410802983;N:3150984,50,0,,,394448696,380284673,367546543,410802983,3150984,ERX4099799,ERS4551994,ERA2597157,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.93845,,0.09509,,0.64926,,0.48436,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-11,Larval,Larval,Whole Organism,All anatomical structures
9882,ERR4132482,ERX4099798,ERS4551993,ERP121652,PRJEB38247,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E-MTAB-9054,Transcriptome Analysis,Endocrine disruption can trigger far reaching effects on environmental populations justifying a refusal of market approval for chemicals with ED properties. Ecotoxicogenomic screening was performed to identify molecular fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. 6 Propyl 2 thiouracil 6PTU CAS: 51 52 5 was tested as a model substance for anti thyroidal activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of 6PTU for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked from each sample group and pooled for RNA and protein extraction with NucleoSpin© RNA/Protein kit Macherey Nagel. RNA quality was assessed via a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing 30 million reads per sample. Initial BCL files were demultiplexed to fastq files via bcl2fastq. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library mapped read tables were then merged to a single count matrix. Using this matrix as input read counts were normalized with DESeq2 for differential gene expression analysis.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R895,SAMEA6824364,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 11T17:12:34Z|External Id:SAMEA6824364|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 11T17:12:34Z|INSDC status:public|Submitter Id:E MTAB 9054:R895|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:normal|individual:mixed pool of 10 fish|organism part:whole organism|rin values:10|sample name:E MTAB 9054:R895|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,E MTAB 9054:R895 s,R895 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. All samples were extracted on the 09.12.2019. CAS: 51 52 5 Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. 6 PTU 6 propyl 2 sulfanylidene 1H pyrimidin 4 one CAS number 51 52 5 99% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121652,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of 6 Propyl 2 thiouracil 6 PTU below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 11,R895_sr.fastq.gz,fastq,1098959757.0,21771883.0,E MTAB 9054:R895,0:50.48 1:0,A:281414032;C:266978094;G:257304686;T:291591340;N:1671605,50,0,,,281414032,266978094,257304686,291591340,1671605,ERX4099798,ERS4551993,ERA2597157,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.93996,,0.09776,,0.64989,,0.47968,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-11,Larval,Larval,Whole Organism,All anatomical structures
9883,ERR4140034,ERX4107347,ERS4556110,ERP121678,PRJEB38271,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups,E-MTAB-9056,Transcriptome Analysis,The aim of this sequencing experiment was to screen for ecotoxicogenomic fingerprints for endocrine disrupting chemicals affecting the thyroid system in zebrafish Danio rerio embryos as aquatic vertebrate model and alternative to animal testing. Triiodothyronine T3 CAS: 6893 02 3 was tested as a model substance for thyroidal inducing activity. In a modified version of the zebrafish embryo toxicity test OECD 236 15 fertilized eggs were exposed to two different sub lethal concentrations of T3 for xxx hours under semi static conditions. Each test comprised of a low exposure LE high exposure HE and negative control NC group and was performed in triplicates. At 96 hpf 10 larvae were randomly picked for each sample and pooled for RNA and protein extraction with NucleoSpin RNA/Protein kit Macherey Nagel. RNA quality was assessed with a 2100 Bioanalyzer system Agilent before coding RNA was purified PolyA selection with TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 4000 System Illumina in 50 bp single read mode producing roughly 30 million reads per sample. Adapter sequences were removed with trimmomatic and sequences were aligned to the D.rerio reference genome GRCz11 with STAR. Counting of feature mapped reads was performed through featureCounts. Library gene count tables were then merged to a single count matrix as input for differential gene expression analysis with DESeq2.,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 12,,Protocols: For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. T3 3 three prime 5 Triiodo L thyronine CAS number 6893 02 3 95% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,R86,SAMEA6828487,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany",ENA FIRST PUBLIC:2020 07 31T04:03:57Z|ENA LAST UPDATE:2020 05 12T15:52:19Z|External Id:SAMEA6828487|INSDC center name:Fraunhofer Institute for Molecular Biology and Applied Ecology Applied Ecology and Bioresources Division Schmallenberg Germany Institute of Ecology Evolution and Diversity Goethe University Frankfurt Frankfurt am Main Germany|INSDC first public:2020 07 31T04:03:57Z|INSDC last update:2020 05 12T15:52:19Z|INSDC status:public|Submitter Id:E MTAB 9056:R86|age:96|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 4|genotype:wild type genotype|growth condition:low exposure|individual:pool of 10 fish|organism part:whole organism|sample name:E MTAB 9056:R86|scientific name:Danio rerio|sex:mixed|strain:AB,,,,,,,,,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyro9 T3 below acute toxicity levels against untreated control groups,E MTAB 9056:R86 s,R86 s,RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups,For each sample 10 dpf 4 dpf zebrafish larvae were randomly picked from the glass well and carefully transferred to a 1.5 ml low binding Eppendorf tube. Once individuals were picked for all samples they were euthanized at the same time by placing the tubes simultaneously on ice for 10 minutes. Supernatant from the test solutions was carefully removed without xxx the larvae before adding 350µl of RP1 buffer NucleoSpin RNA Protein kit; Macherey Nagel 740933.250 for tissue homogenization. RP1 buffer was freshly prepared with TCEP as reducing agent prior extraction. For detailed information about embryonic incubation conditions and husbandry of adult broodstock please refer to the “Growth protocol”. For detailed information about exposure duration and conditions please refer to the “Treatment protocol”. Adult animal husbandry: Wild type zebrafish Danio rerio Strain AB broodstocks were maintained under flow through conditions in 150 L tanks at 26 +/ 2°C on a 12:12 h light/dark cycle. They were fed daily with TetraMin® Tetra Werke Melle Germany main feed ad libitum and nauplii of Artemia salina. The day before test start glass spawning trays with artificial substrate green glass beads stringed on stainless steel wire were placed at the bottom of each tank. post mating and spawning in the morning hours eggs were rinsed with clear Cu reduced water and placed into glass dishes for pre picking. Fish embryo incubation: For each sample 15 fertilized eggs in the early blastula stage were placed in glass petri dishes diameter 6 cm filled with 8 ml of the respective testing solution Control Low exposure High exposure. Embryos were incubated at 27 +/ 1°C on a 14:10 h light/dark cycle. At 24 hpf eggs were inspected visually and single coagulated eggs were recorded and removed. At 48 hpf overall survival hatch rates morphological malformations and physiological changes were recorded and aged solutions were replaced by fresh aerated test solutions. At 96 hpf again overall survival hatch rates morphological malformations and physiological changes were recorded before RNA and protein extraction. T3 3 three prime 5 Triiodo L thyronine CAS number 6893 02 3 95% purity was purchased from Merck KGgA Darmstadt Germany. Test solutions were freshly prepared one day prior the start of the experiment and stored at room temperature in the dark while being constantly aerated. The glass wells for the incubation of the embryos were pre saturated with the respective test solution overnight and renewed at the beginning of the experiment. Per sample about 40 50 fertilized fish eggs were pre picked in glass petri dishes 10 cm diameter filled with 30 ml of the testing solution. Using an optical binokular microscope 15 embryos of the same early blastula stage were transferred from the pre picking plate into the test glass wells filled with 8 ml of the test solution. Embryos were then incubated as described in the “growth protocol”. The pooled larvae in RP1 buffer were transferred to a screw cap eppendorf filled with 0.3 g of Lysing Matrix D MP Biomedicals 6913050 ceramic beads. Tissue homogenization was performed at 5 m/s for 40 s with FastPrep 24© MP Biomedicals 6004500 at room temperature. From here on total RNA and Protein was extracted from the tissue lysate using the NucleoSpin RNA Protein kit Macherey Nagel 740933.250 according to the manufacturer's protocol. RNA concentration was measured using a Nanodrop 2000 spectrophotometer Thermo Scientific. The sample's overall RNA quality and corresponding RIN value was fluorometrically determined through a 2100 Bioanalyzer© Instrument system Agilent G2939BA using RNApico© chips Agilent 5067 1513. Samples were stored at 80°C until they were send to the sequencing facility on dry ice. Sequencing libraries were prepared for each sample from 100 ng/µl total RNA at the sequencing facility “NGS Services for Integrative Genomics” at the University of Göttingen in Germany. According to their standard workflow cDNA libraries were prepared from protein coding mRNA that were purified through PolyA selection using the TruSeq RNA Library Prep Kit v2 Illumina.,Experimental Factor: compound:3 3 prime 5 triiodo L thyro9|Experimental Factor: dose:3.3E 06,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,ERP121678,Illumina HiSeq 4000 sequencing; RNA Seq of zebrafish embryos 96hpf treated with different concentrations of Triiodothyronine T3 below acute toxicity levels against untreated control groups,ENA FIRST PUBLIC:2020 09 30|ENA LAST UPDATE:2020 05 13,R86_sr.fastq.gz,fastq,1327826966.0,26294265.0,E MTAB 9056:R86,0:50.50 1:0,A:340934934;C:322947435;G:309801278;T:353159102;N:984217,50,0,,,340934934,322947435,309801278,353159102,984217,ERX4107347,ERS4556110,ERA2597448,"Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive","Fraunhofer Institute for Molecular Biology and Applied Ecology, Applied Ecology and Bioresources Division, Schmallenberg, Germany Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt, Frankfurt am Main, Germany|European Nucleotide Archive",1,0.9393,,0.1031,,0.65683,,0.46848,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,Germany,2020-05-12,Larval,Larval,Whole Organism,All anatomical structures