rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
25182,SRR25670729,SRX21396042,SRS18636200,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA germ ring PAL seq v4,GSM7716871,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA germ ring PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716871,GSM7716871: Fish embryo mRNA germ ring PAL seq v4; Danio rerio; OTHER,GSM7716871 r1,GSM7716871,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep1_raw_read2.fastq.gz Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep1_raw_read1.fastq.gz,fastq fastq,2834842912.0,9234016.0,GSM7716871 r1,0:52 1:255,A:725811118;C:702410592;G:747583409;T:651018348;N:8019445,52,255,,,725811118,702410592,747583409,651018348,8019445,SRX21396042,SRS18636200,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00023,0.30494,8e-05,0.01793,0.99967,0.99971,0.5,1.0,52,255,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25183,SRR25670730,SRX21396042,SRS18636200,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA germ ring PAL seq v4,GSM7716871,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA germ ring PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716871,GSM7716871: Fish embryo mRNA germ ring PAL seq v4; Danio rerio; OTHER,GSM7716871 r1,GSM7716871,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_germ_ring_PAL_seq_v4_rep2_raw_read2.fastq.gz,fastq fastq,3473033898.0,11312814.0,GSM7716871 r2,0:52 1:255,A:853178471;C:899976159;G:962100712;T:750811461;N:6967095,52,255,,,853178471,899976159,962100712,750811461,6967095,SRX21396042,SRS18636200,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00049,0.0,0.00012,0.0,0.99941,1.0,0.64864,,52,255,T,T,mates < 9% mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25184,SRR25670731,SRX21396041,SRS18636199,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA zfs:0000015 PAL seq v4,GSM7716870,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA zfs:0000015 PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716870,GSM7716870: Fish embryo mRNA zfs:0000015 PAL seq v4; Danio rerio; OTHER,GSM7716870 r1,GSM7716870,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep1_raw_read2.fastq.gz,fastq fastq,2695203962.0,8779166.0,GSM7716870 r1,0:52 1:255,A:684535386;C:669852151;G:719008886;T:614209811;N:7597728,52,255,,,684535386,669852151,719008886,614209811,7597728,SRX21396041,SRS18636199,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00117,0.35837,0.00017,0.00682,0.99859,0.99963,0.69473,1.0,52,255,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25185,SRR25670732,SRX21396041,SRS18636199,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA zfs:0000015 PAL seq v4,GSM7716870,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA zfs:0000015 PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716870,GSM7716870: Fish embryo mRNA zfs:0000015 PAL seq v4; Danio rerio; OTHER,GSM7716870 r1,GSM7716870,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep2_raw_read2.fastq.gz Fish_embryo_mRNA_30percent_epiboly_PAL_seq_v4_rep2_raw_read1.fastq.gz,fastq fastq,3476338446.0,11323578.0,GSM7716870 r2,0:52 1:255,A:841832234;C:898325199;G:968774318;T:760398070;N:7008625,52,255,,,841832234,898325199,968774318,760398070,7008625,SRX21396041,SRS18636199,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00245,0.0,0.00047,0.0,0.99803,1.0,0.58536,,52,255,T,T,mates < 9% mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25186,SRR25670733,SRX21396040,SRS18636198,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA sphere PAL seq v4,GSM7716869,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA sphere PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716869,GSM7716869: Fish embryo mRNA sphere PAL seq v4; Danio rerio; OTHER,GSM7716869 r1,GSM7716869,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_sphere_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_sphere_PAL_seq_v4_rep1_raw_read2.fastq.gz,fastq fastq,3211687254.0,10461522.0,GSM7716869 r1,0:52 1:255,A:813560400;C:775326762;G:854563477;T:759161458;N:9075157,52,255,,,813560400,775326762,854563477,759161458,9075157,SRX21396040,SRS18636198,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00088,0.43191,0.0004,0.01556,0.99916,0.99961,0.55769,1.0,52,255,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25187,SRR25670734,SRX21396040,SRS18636198,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA sphere PAL seq v4,GSM7716869,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA sphere PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716869,GSM7716869: Fish embryo mRNA sphere PAL seq v4; Danio rerio; OTHER,GSM7716869 r1,GSM7716869,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_sphere_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_sphere_PAL_seq_v4_rep2_raw_read2.fastq.gz,fastq fastq,3179916131.0,10358033.0,GSM7716869 r2,0:52 1:255,A:771755667;C:804256300;G:883166175;T:714242073;N:6495916,52,255,,,771755667,804256300,883166175,714242073,6495916,SRX21396040,SRS18636198,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00186,0.0,0.00088,0.0,0.99862,1.0,0.64705,,52,255,T,T,mates < 9% mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25188,SRR25670735,SRX21396039,SRS18636197,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA 1024cell PAL seq v4,GSM7716868,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA 1024cell PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716868,GSM7716868: Fish embryo mRNA 1024cell PAL seq v4; Danio rerio; OTHER,GSM7716868 r1,GSM7716868,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep1_raw_read2.fastq.gz,fastq fastq,2191900794.0,7139742.0,GSM7716868 r1,0:52 1:255,A:571954354;C:551162617;G:572445400;T:490238669;N:6099754,52,255,,,571954354,551162617,572445400,490238669,6099754,SRX21396039,SRS18636197,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.0011,0.43387,6e-05,0.01058,0.99864,0.99971,0.74576,1.0,52,255,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Zygote,Embryo,Embryo Imprecise,All anatomical structures
25189,SRR25670736,SRX21396039,SRS18636197,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA 1024cell PAL seq v4,GSM7716868,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA 1024cell PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716868,GSM7716868: Fish embryo mRNA 1024cell PAL seq v4; Danio rerio; OTHER,GSM7716868 r1,GSM7716868,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_1024cell_PAL_seq_v4_rep2_raw_read2.fastq.gz,fastq fastq,3840723193.0,12510499.0,GSM7716868 r2,0:52 1:255,A:985340216;C:991311706;G:1034487140;T:821820974;N:7763157,52,255,,,985340216,991311706,1034487140,821820974,7763157,SRX21396039,SRS18636197,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.0021,0.0,0.00026,0.0,0.99859,1.0,0.71022,,52,255,T,T,mates < 9% mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Zygote,Embryo,Embryo Imprecise,All anatomical structures
25190,SRR25670737,SRX21396038,SRS18636196,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA 128cell PAL seq v4,GSM7716867,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA 128cell PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716867,GSM7716867: Fish embryo mRNA 128cell PAL seq v4; Danio rerio; OTHER,GSM7716867 r1,GSM7716867,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_128cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_128cell_PAL_seq_v4_rep1_raw_read2.fastq.gz,fastq fastq,2104868443.0,6856249.0,GSM7716867 r1,0:52 1:255,A:539122676;C:505234642;G:558793048;T:495876292;N:5841785,52,255,,,539122676,505234642,558793048,495876292,5841785,SRX21396038,SRS18636196,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00035,0.29379,7e-05,0.01129,0.99949,0.99971,0.55882,0.79591,52,255,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25191,SRR25670738,SRX21396038,SRS18636196,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA 128cell PAL seq v4,GSM7716867,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA 128cell PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716867,GSM7716867: Fish embryo mRNA 128cell PAL seq v4; Danio rerio; OTHER,GSM7716867 r1,GSM7716867,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_128cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_128cell_PAL_seq_v4_rep2_raw_read2.fastq.gz,fastq fastq,3135806371.0,10214353.0,GSM7716867 r2,0:52 1:255,A:776612486;C:774126305;G:853951502;T:724788612;N:6327466,52,255,,,776612486,774126305,853951502,724788612,6327466,SRX21396038,SRS18636196,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00066,0.0,0.00011,0.0,0.99939,1.0,0.55737,,52,255,T,T,mates < 9% mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25192,SRR25670739,SRX21396037,SRS18636195,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA 8cell PAL seq v4,GSM7716866,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA 8cell PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716866,GSM7716866: Fish embryo mRNA 8cell PAL seq v4; Danio rerio; OTHER,GSM7716866 r1,GSM7716866,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_8cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_8cell_PAL_seq_v4_rep1_raw_read2.fastq.gz,fastq fastq,2618998887.0,8530941.0,GSM7716866 r1,0:52 1:255,A:673066508;C:641446717;G:706546263;T:590452494;N:7486905,52,255,,,673066508,641446717,706546263,590452494,7486905,SRX21396037,SRS18636195,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.0009,0.43244,0.00014,0.0054,0.99902,0.99967,0.54901,1.0,52,255,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25193,SRR25670740,SRX21396037,SRS18636195,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA 8cell PAL seq v4,GSM7716866,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA 8cell PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716866,GSM7716866: Fish embryo mRNA 8cell PAL seq v4; Danio rerio; OTHER,GSM7716866 r1,GSM7716866,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_8cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_8cell_PAL_seq_v4_rep2_raw_read2.fastq.gz,fastq fastq,3028839589.0,9865927.0,GSM7716866 r2,0:52 1:255,A:756368817;C:758868409;G:836949742;T:670545278;N:6107343,52,255,,,756368817,758868409,836949742,670545278,6107343,SRX21396037,SRS18636195,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00156,0.0,0.00026,0.0,0.99835,1.0,0.44791,,52,255,T,T,mates < 9% mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Multi-stage,Embryo,Embryo Imprecise,All anatomical structures
25194,SRR25670741,SRX21396036,SRS18636194,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA 1cell PAL seq v4,GSM7716865,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA 1cell PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716865,GSM7716865: Fish embryo mRNA 1cell PAL seq v4; Danio rerio; OTHER,GSM7716865 r1,GSM7716865,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_1cell_PAL_seq_v4_rep1_raw_read1.fastq.gz Fish_embryo_mRNA_1cell_PAL_seq_v4_rep1_raw_read2.fastq.gz,fastq fastq,2050143851.0,6677993.0,GSM7716865 r1,0:52 1:255,A:536391564;C:527126186;G:557802929;T:422990166;N:5833006,52,255,,,536391564,527126186,557802929,422990166,5833006,SRX21396036,SRS18636194,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00016,0.46479,4e-05,0.01408,0.99979,0.99969,0.54545,1.0,52,255,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Zygote,Embryo,Embryo Imprecise,All anatomical structures
25195,SRR25670742,SRX21396036,SRS18636194,SRP455680,PRJNA1006406,Control of polyA tail length and translation in vertebrate oocytes and early embryos,GSE241107,Other,During oocyte maturation and early embryonic development  polyA tail lengths strongly influence mRNA translation. However  how tail lengths are controlled at different developmental stages has been unclear. Here  we performed tail length and translational profiling of mRNA reporter libraries each with > 10 million three prime UTR sequence variants in frog oocytes and embryos  and fish embryos. These analyses revealed that the UUUUA motif specifies cytoplasmic polyadenylation and identified diverse context features that modulate the activity of this 5 mer. Additional sequence motifs drive stage specific deadenylation in embryos  and UUUUA and C rich motifs drive tail length independent translational repression in oocytes. A neural network model accurately predicts tail length change during oocyte maturation in frogs  mice  and humans. Analyses of human sequence variants showed that those predicted to disrupt tail length control have been under negative selection  implying that our insights into control of polyA tail length and translation have implications for human health and fertility. Overall design: Sythetic mRNA reporter libraries with random three prime UTR sequences under four different sequence contexts were injected into frog oocytes and embryos and fish embryos. PolyA tail lengths were measured to at different developmental stages to examine sequence motifs that caused tail length changes. At the same time  polyA tail lengths of endogenous mRNAs from frog oocytes and embryos  fish embryos  and mouse oocytes were measured to investiage how their tail lengths were controlled. Please note that sample titles have been updated on Jan 6  2024.,,,,Fish embryo mRNA 1cell PAL seq v4,GSM7716865,,source name:embryo|tissue:embryo|treatment:N1|geo loc name:missing|collection date:missing,Fish embryo mRNA 1cell PAL seq v4,For gene specific tail seq of mRNA reporters  data were processed with a custom script available at https://github.com/coffeebond/MPRA tail seq. For PAL seq v3 or v4  reads were trimmed with cutadapt v3.7 with the parameters “ m 15   quality base=64  q 20 20   match read wildcards  e 0.05  a NNNNATCTCGTATGCCGTCTTCTGCTTG  O 7”. The trimmed reads were mapped using STAR v2.7.1a to the reference database containing the genomic sequences of the organism from which the mRNAs were obtained  the genomic sequences of humans or fish  depending on which spike in RNAs were used  and the sequences of the polyA standards generated previously  with the parameters “  runThreadN 16   runMode alignReads   outFilterMultimapNmax 1   outReadsUnmapped Fastx   outFilterType BySJout   outSAMattributes All   outSAMtype BAM Unsorted SortedByCoordinate”. Uniquely mapped read were furhter processed with a custom script available at https://github.com/coffeebond/PAL seq. Assembly: Homo sapiens: GRCh38.p7 primary assembly. Mus muculus: GRCh38.p4  primary assembly. Xenopus laevis: v10.1 assembly. Danio rerio: GRCz11 assembly. Supplementary files format and content: For gene specific tail seq of mRNA reporters  tab delimited text files with columns indicating 1 sequence of the variable region; 2 median tail length; 3 number of reads; 4–7 tail lengths at quantile 10  25  75  and 90. Supplementary files format and content: For PAL seq v3 or v4  tab delimited files with columns indicating 1 gene ID or polyA site ID; 2 read cluster ID; 3 tail length Library strategy: PAL seq v4,embryo,,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer’s suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,tissue:embryo|treatment:N1,GSM7716865,GSM7716865: Fish embryo mRNA 1cell PAL seq v4; Danio rerio; OTHER,GSM7716865 r1,GSM7716865,1,Frog oocytes and embryos were lysed in ice cold buffer RL 20 mM HEPES pH 7.5  100 mM KCl  5 mM MgCl2  1% [v/v] Triton X 100  100 µg/ml cycloheximide  cOmplete protease inhibitor cocktail [1 tablet per 10 ml buffer]  and 200 units/ml SUPERase•In in a volume of 10 µl per oocyte/embryo by vigorous shaking and pipetting. Lysates were cleared by centrifugation at 5000 g at 4°C for 10 min. The supernatant was transfered to a new tube and mixed with the Tri reagent for RNA isolation. Fish embryos were de chorionated by incubation with 2 mg/ml pronase in E3 medium for 4 min. post removing all E3 medium  Tri Reagent was added to the embryos for RNA isolation. Mouse GV oocytes were collected in 37°C MEM in the presence of milrinone to prevent maturation. Cumulus cells were removed from cumulus oocyte complexes by repeated aspiration through a glass pipette. GV oocytes were then collected in TRI reagent for RNA isolation. Mouse MII oocytes were harvested from the oviducts of hCG induced mice 16 hr  denuded with 3 mg/ml hyaluronidase for 2 min  washed  and then collected in Tri reagent for RNA isolation. For gene specific tail seq of reporter libraries  total RNA with reporter mRNA libraries was ligated to a pre adenylated 3ʹ adapter directly in most cases  but for the N60 library injected into fish embryos and frog oocytes  the N37 PAS N17 library injected into fish embryos and frog oocytes  and the CPEmos N60 and N60LC PASmos libraries injected into frog oocytes  reporter library mRNAs were enriched by anti sense oligo capture with biotinylated oligos. RNA isolated from the oocyte or embryo lysate was mixed with 8 pmol KXSH009  8 pmol KXSH010  and 2x SSC 0.3 M NaCl  30 mM sodium citrate pH 7.0 in a total of 50 µl. The RNA and oligos were annealed by incubation at 70°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 40 µl MyOne Streptavidin C1 beads Thermo Fisher  65002 and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack and removed. The beads were washed twice with 300 µl 1xB&W buffer 5 mM Tris HCl pH 7.5  0.5 mM EDTA  1 M NaCl and once with 300 µl 2x SSC. The RNA was eluted from the beads first with 100 µl 10 mM HEPES pH 7.5 at 65°C for 3 min and then second with 100 µl water at 65°C for 3 min. The eluates were combined  precipitated with ethanol  and resuspended in 6.5 µl water. The anti sense oligo enriched RNA or the RNA isolated from oocyte or embryo lysates was ligated to a pre adenylated 3ʹ adapter in a 10 µl reaction containing 5 µM 3ʹ adapter KXS330  50 mM HEPES pH 7.5  10 mM MgCl2  10 mM dithiothreitol  1 unit/µl T4 RNA ligase 1 New England Biolabs  M0204S. The ligation reaction was incubated at 23°C for 150 min. post ligation  RNA was extracted with phenol/chloroform  precipitated with ethanol  and resuspended in 11.4 µl water. The ligated RNA was mixed with 0.6 µl 100 µM reverse transcription primer KXS037 in a total volume of 12 µl  incubated at 65°C for 5 min  and cooled on ice for 1 min. The annealed RNA was reverse transcribed in a 20 µl reaction containing 1x First Strand Buffer  500 µM dNTPs  5 mM dithiothreitol  1 unit/µl SUPERase•In  and 200 units SuperScript III Thermo Fisher  18080044 at 50°C for 1 hr. post reverse transcription  RNA was hydrolyzed with 3.3 µl 1 M NaOH at 90°C for 10 min  followed by neutralization with 36.7 µl 1 M HEPES pH 7.5 and the cDNA was collected by desalting with a Micro Bio Spin P 30 column. The cDNA library was amplified in a 50 µl PCR reaction with KXS037 and a barcoded primer Supplemental using the KAPA HiFi HotStart Kits following the manufacturer's suggested protocol for 10–15 cycles. The PCR amplified library was cleaned up twice with AMPure XP beads Beckman Coulter  A63881 with a beads to sample ratio of 1.2. For sequencing of endogenous mRNA polyA tail length  libraries were prepared with PAL seq v3 for frog oocytes or PAL seq v4 for frog embryos  fish embryos  and mouse oocytes as described previously PMID: 34213414. When preparing the sequencing libraries of mRNAs from fish embryos  a different 3ʹ adapter KXS013 was used for 3ʹ end ligation  and polyA selected mRNA from HeLa cells was used as spike in  replacing polyA selected mRNA from zebrafish ZF4 cell line. The first round of sequencing results suggested that a large fraction of the fish mRNA libraries was 5.8S rRNA. The cDNA of 5.8S rRNA was depleted from the cDNA libraries with an antisense oligo. The seven cDNA libraries made from mRNAs of zebrafish embryos at different stages were mixed at roughly equal molar ratios in a total of 5 fmol. Fifty pmol KXSH015 and 2x SSC were added in a total of 100 µl. The cDNAs and the oligo were annealed by incubation at 65°C for 5 min and then slowly cooling to 23°C at 0.1°C/sec. The annealed mixture was combined with 100 µl MyOne Streptavidin C1 beads and incubated for 20 min at 23°C on a thermal mixer  shaking with 15 sec on and 1 min 45 sec off. The supernatant was separated from the beads with a magnetic rack. The beads were washed once with 200 µl 1xB&W buffer. The supernatant and the wash were combined  precipitated with ethanol  and resuspended in 30 µl water. The oligo depleted libraries were sequenced again as a technical replicate. Sequencing data of replicates were merged for each sample post monitoring consistency.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP455680,,,Fish_embryo_mRNA_1cell_PAL_seq_v4_rep2_raw_read1.fastq.gz Fish_embryo_mRNA_1cell_PAL_seq_v4_rep2_raw_read2.fastq.gz,fastq fastq,3406093776.0,11094768.0,GSM7716865 r2,0:52 1:255,A:868054279;C:890446070;G:945289336;T:695324057;N:6980034,52,255,,,868054279,890446070,945289336,695324057,6980034,SRX21396036,SRS18636194,SRA1694849,Whitehead Institute,Whitehead Institute,2,0.00049,0.0,0.00014,0.0,0.99939,1.0,0.58974,,52,255,T,T,mates < 9% mapping rate,illumina,hiseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,United States,2023-08-17,Zygote,Embryo,Embryo Imprecise,All anatomical structures
33990,SRR31030860,SRX26416598,SRS22936450,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep4 minus,GSM8578751,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep4 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578751,GSM8578751: ZF NES GAPDH Rep4 minus; Danio rerio; OTHER,GSM8578751 r1,GSM8578751,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep4_minus.R1.fq.gz ZF_NES_GAPDH_Rep4_minus.R2.fq.gz,fastq fastq,1100578200.0,3668594.0,GSM8578751 r1,0:150 1:150,A:287878221;C:249390946;G:265835736;T:297454600;N:18697,150,150,,,287878221,249390946,265835736,297454600,18697,SRX26416598,SRS22936450,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33991,SRR31030861,SRX26416597,SRS22936451,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep3 plus,GSM8578750,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep3 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578750,GSM8578750: ZF NES GAPDH Rep3 plus; Danio rerio; OTHER,GSM8578750 r1,GSM8578750,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep3_plus.R1.fq.gz ZF_NES_GAPDH_Rep3_plus.R2.fq.gz,fastq fastq,1231779300.0,4105931.0,GSM8578750 r1,0:150 1:150,A:322256597;C:278991471;G:297394980;T:333116282;N:19970,150,150,,,322256597,278991471,297394980,333116282,19970,SRX26416597,SRS22936451,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33992,SRR31030862,SRX26416596,SRS22936449,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep3 minus,GSM8578749,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep3 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578749,GSM8578749: ZF NES GAPDH Rep3 minus; Danio rerio; OTHER,GSM8578749 r1,GSM8578749,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep3_minus.R1.fq.gz ZF_NES_GAPDH_Rep3_minus.R2.fq.gz,fastq fastq,1002124500.0,3340415.0,GSM8578749 r1,0:150 1:150,A:262024969;C:227163761;G:242157218;T:270761424;N:17128,150,150,,,262024969,227163761,242157218,270761424,17128,SRX26416596,SRS22936449,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33993,SRR31030863,SRX26416595,SRS22936448,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep2 plus,GSM8578748,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep2 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578748,GSM8578748: ZF NES GAPDH Rep2 plus; Danio rerio; OTHER,GSM8578748 r1,GSM8578748,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep2_plus.R1.fq.gz ZF_NES_GAPDH_Rep2_plus.R2.fq.gz,fastq fastq,1051565100.0,3505217.0,GSM8578748 r1,0:150 1:150,A:275784945;C:237523425;G:253300749;T:284937948;N:18033,150,150,,,275784945,237523425,253300749,284937948,18033,SRX26416595,SRS22936448,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33994,SRR31030864,SRX26416594,SRS22936447,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep2 minus,GSM8578747,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep2 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578747,GSM8578747: ZF NES GAPDH Rep2 minus; Danio rerio; OTHER,GSM8578747 r1,GSM8578747,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep2_minus.R1.fq.gz ZF_NES_GAPDH_Rep2_minus.R2.fq.gz,fastq fastq,1021837200.0,3406124.0,GSM8578747 r1,0:150 1:150,A:268290250;C:230525208;G:245949056;T:277056045;N:16641,150,150,,,268290250,230525208,245949056,277056045,16641,SRX26416594,SRS22936447,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33995,SRR31030865,SRX26416593,SRS22936446,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep1 plus,GSM8578746,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep1 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578746,GSM8578746: ZF NES GAPDH Rep1 plus; Danio rerio; OTHER,GSM8578746 r1,GSM8578746,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep1_plus.R1.fq.gz ZF_NES_GAPDH_Rep1_plus.R2.fq.gz,fastq fastq,1093620300.0,3645401.0,GSM8578746 r1,0:150 1:150,A:285989719;C:247805250;G:264181043;T:295625946;N:18342,150,150,,,285989719,247805250,264181043,295625946,18342,SRX26416593,SRS22936446,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33996,SRR31030866,SRX26416592,SRS22936445,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep1 minus,GSM8578745,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep1 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578745,GSM8578745: ZF NES GAPDH Rep1 minus; Danio rerio; OTHER,GSM8578745 r1,GSM8578745,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep1_minus.R1.fq.gz ZF_NES_GAPDH_Rep1_minus.R2.fq.gz,fastq fastq,911747100.0,3039157.0,GSM8578745 r1,0:150 1:150,A:239833349;C:205185786;G:218897710;T:247814511;N:15744,150,150,,,239833349,205185786,218897710,247814511,15744,SRX26416592,SRS22936445,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33997,SRR31030867,SRX26416591,SRS22936444,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep4 plus,GSM8578744,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep4 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578744,GSM8578744: ZF H2B MALAT1 Rep4 plus; Danio rerio; OTHER,GSM8578744 r1,GSM8578744,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep4_plus.R1.fq.gz ZF_H2B_MALAT1_Rep4_plus.R2.fq.gz,fastq fastq,842103300.0,2807011.0,GSM8578744 r1,0:150 1:150,A:204870477;C:222752099;G:215404135;T:199062275;N:14314,150,150,,,204870477,222752099,215404135,199062275,14314,SRX26416591,SRS22936444,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33998,SRR31030868,SRX26416590,SRS22936442,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep4 minus,GSM8578743,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep4 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578743,GSM8578743: ZF H2B MALAT1 Rep4 minus; Danio rerio; OTHER,GSM8578743 r1,GSM8578743,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep4_minus.R1.fq.gz ZF_H2B_MALAT1_Rep4_minus.R2.fq.gz,fastq fastq,1166375100.0,3887917.0,GSM8578743 r1,0:150 1:150,A:283781955;C:308660466;G:298298204;T:275614377;N:20098,150,150,,,283781955,308660466,298298204,275614377,20098,SRX26416590,SRS22936442,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
33999,SRR31030869,SRX26416589,SRS22936443,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep3 plus,GSM8578742,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep3 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578742,GSM8578742: ZF H2B MALAT1 Rep3 plus; Danio rerio; OTHER,GSM8578742 r1,GSM8578742,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep3_plus.R1.fq.gz ZF_H2B_MALAT1_Rep3_plus.R2.fq.gz,fastq fastq,1159439400.0,3864798.0,GSM8578742 r1,0:150 1:150,A:282055391;C:306842216;G:296569227;T:273952570;N:19996,150,150,,,282055391,306842216,296569227,273952570,19996,SRX26416589,SRS22936443,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34000,SRR31030870,SRX26416588,SRS22936440,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep3 minus,GSM8578741,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep3 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578741,GSM8578741: ZF H2B MALAT1 Rep3 minus; Danio rerio; OTHER,GSM8578741 r1,GSM8578741,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep3_minus.R1.fq.gz ZF_H2B_MALAT1_Rep3_minus.R2.fq.gz,fastq fastq,1008297600.0,3360992.0,GSM8578741 r1,0:150 1:150,A:245277585;C:266840408;G:257911846;T:238251305;N:16456,150,150,,,245277585,266840408,257911846,238251305,16456,SRX26416588,SRS22936440,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34001,SRR31030871,SRX26416587,SRS22936441,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep2 plus,GSM8578740,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep2 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578740,GSM8578740: ZF H2B MALAT1 Rep2 plus; Danio rerio; OTHER,GSM8578740 r1,GSM8578740,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep2_plus.R1.fq.gz ZF_H2B_MALAT1_Rep2_plus.R2.fq.gz,fastq fastq,1419263400.0,4730878.0,GSM8578740 r1,0:150 1:150,A:345302268;C:375591885;G:362956395;T:335387828;N:25024,150,150,,,345302268,375591885,362956395,335387828,25024,SRX26416587,SRS22936441,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34002,SRR31030872,SRX26416586,SRS22936439,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep2 minus,GSM8578739,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep2 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578739,GSM8578739: ZF H2B MALAT1 Rep2 minus; Danio rerio; OTHER,GSM8578739 r1,GSM8578739,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep2_minus.R1.fq.gz ZF_H2B_MALAT1_Rep2_minus.R2.fq.gz,fastq fastq,1249910700.0,4166369.0,GSM8578739 r1,0:150 1:150,A:304074828;C:330741431;G:319677748;T:295395235;N:21458,150,150,,,304074828,330741431,319677748,295395235,21458,SRX26416586,SRS22936439,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34003,SRR31030873,SRX26416585,SRS22936438,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep1 plus,GSM8578738,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep1 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578738,GSM8578738: ZF H2B MALAT1 Rep1 plus; Danio rerio; OTHER,GSM8578738 r1,GSM8578738,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep1_plus.R1.fq.gz ZF_H2B_MALAT1_Rep1_plus.R2.fq.gz,fastq fastq,1257872700.0,4192909.0,GSM8578738 r1,0:150 1:150,A:306022947;C:332851039;G:321699513;T:297277788;N:21413,150,150,,,306022947,332851039,321699513,297277788,21413,SRX26416585,SRS22936438,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34004,SRR31030874,SRX26416584,SRS22936437,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B MALAT1 Rep1 minus,GSM8578737,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B MALAT1 Rep1 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578737,GSM8578737: ZF H2B MALAT1 Rep1 minus; Danio rerio; OTHER,GSM8578737 r1,GSM8578737,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_MALAT1_Rep1_minus.R1.fq.gz ZF_H2B_MALAT1_Rep1_minus.R2.fq.gz,fastq fastq,1377040200.0,4590134.0,GSM8578737 r1,0:150 1:150,A:335021330;C:364359707;G:352178356;T:325457746;N:23061,150,150,,,335021330,364359707,352178356,325457746,23061,SRX26416584,SRS22936437,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34005,SRR31030875,SRX26416583,SRS22936435,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep4 plus,GSM8578736,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep4 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578736,GSM8578736: ZF H2B GAPDH Rep4 plus; Danio rerio; OTHER,GSM8578736 r1,GSM8578736,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep4_plus.R1.fq.gz ZF_H2B_GAPDH_Rep4_plus.R2.fq.gz,fastq fastq,1051103100.0,3503677.0,GSM8578736 r1,0:150 1:150,A:274220771;C:238733668;G:254670769;T:283460283;N:17609,150,150,,,274220771,238733668,254670769,283460283,17609,SRX26416583,SRS22936435,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34006,SRR31030876,SRX26416582,SRS22936436,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep4 minus,GSM8578735,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep4 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578735,GSM8578735: ZF H2B GAPDH Rep4 minus; Danio rerio; OTHER,GSM8578735 r1,GSM8578735,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep4_minus.R1.fq.gz ZF_H2B_GAPDH_Rep4_minus.R2.fq.gz,fastq fastq,1206485700.0,4021619.0,GSM8578735 r1,0:150 1:150,A:314740194;C:274101014;G:292357972;T:325267132;N:19388,150,150,,,314740194,274101014,292357972,325267132,19388,SRX26416582,SRS22936436,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34007,SRR31030877,SRX26416581,SRS22936434,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep3 plus,GSM8578734,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep3 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578734,GSM8578734: ZF H2B GAPDH Rep3 plus; Danio rerio; OTHER,GSM8578734 r1,GSM8578734,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep3_plus.R1.fq.gz ZF_H2B_GAPDH_Rep3_plus.R2.fq.gz,fastq fastq,1140550200.0,3801834.0,GSM8578734 r1,0:150 1:150,A:297636297;C:258828826;G:276373993;T:307692213;N:18871,150,150,,,297636297,258828826,276373993,307692213,18871,SRX26416581,SRS22936434,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34008,SRR31030878,SRX26416580,SRS22936433,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep3 minus,GSM8578733,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep3 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578733,GSM8578733: ZF H2B GAPDH Rep3 minus; Danio rerio; OTHER,GSM8578733 r1,GSM8578733,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep3_minus.R1.fq.gz ZF_H2B_GAPDH_Rep3_minus.R2.fq.gz,fastq fastq,782406600.0,2608022.0,GSM8578733 r1,0:150 1:150,A:204132316;C:177696721;G:189675433;T:210888939;N:13191,150,150,,,204132316,177696721,189675433,210888939,13191,SRX26416580,SRS22936433,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34009,SRR31030879,SRX26416579,SRS22936431,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep2 plus,GSM8578732,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep2 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578732,GSM8578732: ZF H2B GAPDH Rep2 plus; Danio rerio; OTHER,GSM8578732 r1,GSM8578732,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep2_plus.R1.fq.gz ZF_H2B_GAPDH_Rep2_plus.R2.fq.gz,fastq fastq,958297200.0,3194324.0,GSM8578732 r1,0:150 1:150,A:250011335;C:217600823;G:232206339;T:258462392;N:16311,150,150,,,250011335,217600823,232206339,258462392,16311,SRX26416579,SRS22936431,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34010,SRR31030880,SRX26416578,SRS22936432,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep2 minus,GSM8578731,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep2 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578731,GSM8578731: ZF H2B GAPDH Rep2 minus; Danio rerio; OTHER,GSM8578731 r1,GSM8578731,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep2_minus.R1.fq.gz ZF_H2B_GAPDH_Rep2_minus.R2.fq.gz,fastq fastq,1020926700.0,3403089.0,GSM8578731 r1,0:150 1:150,A:266429488;C:231749424;G:247353147;T:275377720;N:16921,150,150,,,266429488,231749424,247353147,275377720,16921,SRX26416578,SRS22936432,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34011,SRR31030881,SRX26416577,SRS22936430,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep1 plus,GSM8578730,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep1 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:plus DBF,GSM8578730,GSM8578730: ZF H2B GAPDH Rep1 plus; Danio rerio; OTHER,GSM8578730 r1,GSM8578730,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep1_plus.R1.fq.gz ZF_H2B_GAPDH_Rep1_plus.R2.fq.gz,fastq fastq,1134318600.0,3781062.0,GSM8578730 r1,0:150 1:150,A:295931335;C:257596481;G:274848790;T:305922827;N:19167,150,150,,,295931335,257596481,274848790,305922827,19167,SRX26416577,SRS22936430,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34012,SRR31030882,SRX26416576,SRS22936429,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF H2B GAPDH Rep1 minus,GSM8578729,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF H2B GAPDH Rep1 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo H2B|treatment:minus DBF,GSM8578729,GSM8578729: ZF H2B GAPDH Rep1 minus; Danio rerio; OTHER,GSM8578729 r1,GSM8578729,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_H2B_GAPDH_Rep1_minus.R1.fq.gz ZF_H2B_GAPDH_Rep1_minus.R2.fq.gz,fastq fastq,752638800.0,2508796.0,GSM8578729 r1,0:150 1:150,A:196331185;C:170899863;G:182460258;T:202935049;N:12445,150,150,,,196331185,170899863,182460258,202935049,12445,SRX26416576,SRS22936429,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate1-mate2 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34013,SRR31031004,SRX26416454,SRS22936307,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT pDBF Rep3,GSM8578770,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb WT pDBF Rep3,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF,GSM8578770,GSM8578770: Zeb WT pDBF Rep3; Danio rerio; OTHER,GSM8578770 r1,GSM8578770,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_pDBF_Rep3.R1.fq.gz Zeb_WT_pDBF_Rep3.R2.fq.gz,fastq fastq,23216831100.0,77389437.0,GSM8578770 r1,0:150 1:150,A:7577896837;C:3508911439;G:4823311862;T:7306393244;N:317718,150,150,,,7577896837,3508911439,4823311862,7306393244,317718,SRX26416454,SRS22936307,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34014,SRR31031005,SRX26416453,SRS22936305,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT pDBF Rep2,GSM8578769,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb WT pDBF Rep2,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF,GSM8578769,GSM8578769: Zeb WT pDBF Rep2; Danio rerio; OTHER,GSM8578769 r1,GSM8578769,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_pDBF_Rep2.R1.fq.gz Zeb_WT_pDBF_Rep2.R2.fq.gz,fastq fastq,27237049500.0,90790165.0,GSM8578769 r1,0:150 1:150,A:8800724632;C:4062692793;G:5651432074;T:8721823175;N:376826,150,150,,,8800724632,4062692793,5651432074,8721823175,376826,SRX26416453,SRS22936305,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34015,SRR31031006,SRX26416452,SRS22936306,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT pDBF Rep1,GSM8578768,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb WT pDBF Rep1,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:plus DBF,GSM8578768,GSM8578768: Zeb WT pDBF Rep1; Danio rerio; OTHER,GSM8578768 r1,GSM8578768,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_pDBF_Rep1.R1.fq.gz Zeb_WT_pDBF_Rep1.R2.fq.gz,fastq fastq,22364115300.0,74547051.0,GSM8578768 r1,0:150 1:150,A:7336106577;C:3346831944;G:4451536371;T:7229335436;N:304972,150,150,,,7336106577,3346831944,4451536371,7229335436,304972,SRX26416452,SRS22936306,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34016,SRR31031007,SRX26416451,SRS22936304,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT mDBF Rep3,GSM8578767,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb WT mDBF Rep3,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF,GSM8578767,GSM8578767: Zeb WT mDBF Rep3; Danio rerio; OTHER,GSM8578767 r1,GSM8578767,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_mDBF_Rep3.R1.fq.gz Zeb_WT_mDBF_Rep3.R2.fq.gz,fastq fastq,20112719100.0,67042397.0,GSM8578767 r1,0:150 1:150,A:6537370232;C:2924919118;G:3973928235;T:6676228153;N:273362,150,150,,,6537370232,2924919118,3973928235,6676228153,273362,SRX26416451,SRS22936304,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34017,SRR31031008,SRX26416450,SRS22936303,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT mDBF Rep2,GSM8578766,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb WT mDBF Rep2,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF,GSM8578766,GSM8578766: Zeb WT mDBF Rep2; Danio rerio; OTHER,GSM8578766 r1,GSM8578766,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_mDBF_Rep2.R1.fq.gz Zeb_WT_mDBF_Rep2.R2.fq.gz,fastq fastq,24839552100.0,82798507.0,GSM8578766 r1,0:150 1:150,A:8176074473;C:3715794630;G:4984816273;T:7962528150;N:338574,150,150,,,8176074473,3715794630,4984816273,7962528150,338574,SRX26416450,SRS22936303,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34018,SRR31031009,SRX26416449,SRS22936302,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb WT mDBF Rep1,GSM8578765,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb WT mDBF Rep1,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:wildtype|treatment:minus DBF,GSM8578765,GSM8578765: Zeb WT mDBF Rep1; Danio rerio; OTHER,GSM8578765 r1,GSM8578765,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_WT_mDBF_Rep1.R1.fq.gz Zeb_WT_mDBF_Rep1.R2.fq.gz,fastq fastq,23029785600.0,76765952.0,GSM8578765 r1,0:150 1:150,A:7509388471;C:3438475939;G:4820328116;T:7261277960;N:315114,150,150,,,7509388471,3438475939,4820328116,7261277960,315114,SRX26416449,SRS22936302,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34019,SRR31031010,SRX26416448,SRS22936301,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb NES pDBF Rep2,GSM8578764,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb NES pDBF Rep2,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578764,GSM8578764: Zeb NES pDBF Rep2; Danio rerio; OTHER,GSM8578764 r1,GSM8578764,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_NES_pDBF_Rep2.R1.fq.gz Zeb_NES_pDBF_Rep2.R2.fq.gz,fastq fastq,25465584900.0,84885283.0,GSM8578764 r1,0:150 1:150,A:7944190976;C:4330095891;G:5473069331;T:7718120992;N:107710,150,150,,,7944190976,4330095891,5473069331,7718120992,107710,SRX26416448,SRS22936301,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34020,SRR31031011,SRX26416447,SRS22936300,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb NES pDBF Rep1,GSM8578763,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,Zeb NES pDBF Rep1,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578763,GSM8578763: Zeb NES pDBF Rep1; Danio rerio; OTHER,GSM8578763 r1,GSM8578763,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_NES_pDBF_Rep1.R1.fq.gz Zeb_NES_pDBF_Rep1.R2.fq.gz,fastq fastq,21107351400.0,70357838.0,GSM8578763 r1,0:150 1:150,A:6528579219;C:3620666961;G:4496642830;T:6461373643;N:88747,150,150,,,6528579219,3620666961,4496642830,6461373643,88747,SRX26416447,SRS22936300,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34021,SRR31031012,SRX26416446,SRS22936299,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb NES mDBF Rep2,GSM8578762,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb NES mDBF Rep2,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578762,GSM8578762: Zeb NES mDBF Rep2; Danio rerio; OTHER,GSM8578762 r1,GSM8578762,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_NES_mDBF_Rep2.R1.fq.gz Zeb_NES_mDBF_Rep2.R2.fq.gz,fastq fastq,21542967300.0,71809891.0,GSM8578762 r1,0:150 1:150,A:6722613760;C:3654507931;G:4628076548;T:6537678084;N:90977,150,150,,,6722613760,3654507931,4628076548,6537678084,90977,SRX26416446,SRS22936299,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34022,SRR31031013,SRX26416445,SRS22936297,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,Zeb NES mDBF Rep1,GSM8578761,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,Zeb NES mDBF Rep1,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578761,GSM8578761: Zeb NES mDBF Rep1; Danio rerio; OTHER,GSM8578761 r1,GSM8578761,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,Zeb_NES_mDBF_Rep1.R1.fq.gz Zeb_NES_mDBF_Rep1.R2.fq.gz,fastq fastq,23038870800.0,76796236.0,GSM8578761 r1,0:150 1:150,A:7216059153;C:3815899397;G:4909028200;T:7097787584;N:96466,150,150,,,7216059153,3815899397,4909028200,7097787584,96466,SRX26416445,SRS22936297,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34023,SRR31031014,SRX26416444,SRS22936298,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep4 plus,GSM8578760,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep4 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578760,GSM8578760: ZF NES MALAT1 Rep4 plus; Danio rerio; OTHER,GSM8578760 r1,GSM8578760,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep4_plus.R1.fq.gz ZF_NES_MALAT1_Rep4_plus.R2.fq.gz,fastq fastq,1091293200.0,3637644.0,GSM8578760 r1,0:150 1:150,A:265519561;C:288647650;G:279105515;T:258001510;N:18964,150,150,,,265519561,288647650,279105515,258001510,18964,SRX26416444,SRS22936298,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34024,SRR31031015,SRX26416443,SRS22936296,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep4 minus,GSM8578759,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep4 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578759,GSM8578759: ZF NES MALAT1 Rep4 minus; Danio rerio; OTHER,GSM8578759 r1,GSM8578759,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep4_minus.R1.fq.gz ZF_NES_MALAT1_Rep4_minus.R2.fq.gz,fastq fastq,1395963600.0,4653212.0,GSM8578759 r1,0:150 1:150,A:339654289;C:369433701;G:356957685;T:329893853;N:24072,150,150,,,339654289,369433701,356957685,329893853,24072,SRX26416443,SRS22936296,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34025,SRR31031016,SRX26416442,SRS22936295,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep3 plus,GSM8578758,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep3 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578758,GSM8578758: ZF NES MALAT1 Rep3 plus; Danio rerio; OTHER,GSM8578758 r1,GSM8578758,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep3_plus.R1.fq.gz ZF_NES_MALAT1_Rep3_plus.R2.fq.gz,fastq fastq,1556195100.0,5187317.0,GSM8578758 r1,0:150 1:150,A:378553535;C:411730281;G:398086882;T:367797563;N:26839,150,150,,,378553535,411730281,398086882,367797563,26839,SRX26416442,SRS22936295,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34026,SRR31031017,SRX26416441,SRS22936294,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep3 minus,GSM8578757,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep3 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578757,GSM8578757: ZF NES MALAT1 Rep3 minus; Danio rerio; OTHER,GSM8578757 r1,GSM8578757,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep3_minus.R1.fq.gz ZF_NES_MALAT1_Rep3_minus.R2.fq.gz,fastq fastq,1511328900.0,5037763.0,GSM8578757 r1,0:150 1:150,A:367639521;C:400036694;G:386523395;T:357103340;N:25950,150,150,,,367639521,400036694,386523395,357103340,25950,SRX26416441,SRS22936294,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34027,SRR31031018,SRX26416440,SRS22936293,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep2 plus,GSM8578756,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep2 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578756,GSM8578756: ZF NES MALAT1 Rep2 plus; Danio rerio; OTHER,GSM8578756 r1,GSM8578756,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep2_plus.R1.fq.gz ZF_NES_MALAT1_Rep2_plus.R2.fq.gz,fastq fastq,1451137800.0,4837126.0,GSM8578756 r1,0:150 1:150,A:353052445;C:383981771;G:371154128;T:342925275;N:24181,150,150,,,353052445,383981771,371154128,342925275,24181,SRX26416440,SRS22936293,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34028,SRR31031019,SRX26416439,SRS22936292,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep2 minus,GSM8578755,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep2 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578755,GSM8578755: ZF NES MALAT1 Rep2 minus; Danio rerio; OTHER,GSM8578755 r1,GSM8578755,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep2_minus.R1.fq.gz ZF_NES_MALAT1_Rep2_minus.R2.fq.gz,fastq fastq,1286489400.0,4288298.0,GSM8578755 r1,0:150 1:150,A:312986127;C:340482608;G:329001591;T:303997982;N:21092,150,150,,,312986127,340482608,329001591,303997982,21092,SRX26416439,SRS22936292,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34029,SRR31031020,SRX26416438,SRS22936291,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep1 plus,GSM8578754,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep1 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578754,GSM8578754: ZF NES MALAT1 Rep1 plus; Danio rerio; OTHER,GSM8578754 r1,GSM8578754,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep1_plus.R1.fq.gz ZF_NES_MALAT1_Rep1_plus.R2.fq.gz,fastq fastq,1146380100.0,3821267.0,GSM8578754 r1,0:150 1:150,A:278826422;C:303464534;G:293239572;T:270830265;N:19307,150,150,,,278826422,303464534,293239572,270830265,19307,SRX26416438,SRS22936291,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34030,SRR31031021,SRX26416437,SRS22936289,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES MALAT1 Rep1 minus,GSM8578753,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF|geo loc name:missing|collection date:missing,ZF NES MALAT1 Rep1 minus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:minus DBF,GSM8578753,GSM8578753: ZF NES MALAT1 Rep1 minus; Danio rerio; OTHER,GSM8578753 r1,GSM8578753,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_MALAT1_Rep1_minus.R1.fq.gz ZF_NES_MALAT1_Rep1_minus.R2.fq.gz,fastq fastq,1149087000.0,3830290.0,GSM8578753 r1,0:150 1:150,A:279487473;C:304130198;G:293947979;T:271501018;N:20332,150,150,,,279487473,304130198,293947979,271501018,20332,SRX26416437,SRS22936289,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
34031,SRR31031022,SRX26416436,SRS22936290,SRP539182,PRJNA1174121,Quantification of subcellular RNA localization through direct detection of RNA oxidation,GSE279714,Other,Across cell types and organisms  thousands of RNAs display asymmetric subcellular distributions. The study of this process often requires quantifying abundances of specific RNAs at precise subcellular locations. To analyze subcellular transcriptomes  multiple proximity based techniques have been developed in which RNAs near a localized bait protein are specifically labeled  facilitating their biotinylation and purification. However  these complex methods are often laborious and require expensive enrichment reagents. To streamline the analysis of localized RNA populations  we developed Oxidation Induced Nucleotide Conversion sequencing OINC seq. In OINC seq  RNAs near a genetically encoded  localized bait protein are specifically oxidized in a photo controllable manner. These oxidation events are then directly detected and quantified using high throughput sequencing and our software package  PIGPEN  without xxx need for biotin mediated enrichment. We demonstrate that OINC seq can induce and quantify RNA oxidation with high specificity in a dose  and light dependent manner. We further show the spatial specificity of OINC seq by using it to quantify subcellular transcriptomes associated with the cytoplasm  ER  and the inner and outer membranes of mitochondria. Finally  using transgenic zebrafish  we demonstrate that OINC seq allows proximity mediated RNA labeling in live animals. In sum  OINC seq together with PIGPEN provide an accessible workflow for the analysis of localized RNAs across different biological systems. Overall design: Cells and tissues were treated with and without xxx that drive localized RNA oxidation at a variety of subcellular locations  including treatment with the singlet oxygen producer Halo DBF and treatment with green light to activate Halo DBF. The extent of oxidation was then calculated at the gene level using PIGPEN software.,,pubmed:39605352;pubmed:40037712,,ZF NES GAPDH Rep4 plus,GSM8578752,,source name:2 dpf embryos|tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF|geo loc name:missing|collection date:missing,ZF NES GAPDH Rep4 plus,OINC seq Oxidation Induced Nucleotide Conversion sequencing Adapters were trimmed from reads using Cutadapt. RNA oxidation events as seen as mutations were quantified using PIGPEN https://github.com/TaliaferroLab/OINC seq Assembly: hg38 and GRCz11 Supplementary files format and content: Quantification of mutations in RNAseq data produced by PIGPEN.,2 dpf embryos,,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,HeLa cells were cultured in DMEM + pen/strep + 10% FBS. Zebrafish embryos were incubated at 28.5C in E3 medium.,tissue:2 dpf embryos|genotype:Halo NES|treatment:plus DBF,GSM8578752,GSM8578752: ZF NES GAPDH Rep4 plus; Danio rerio; OTHER,GSM8578752 r1,GSM8578752,1,RNA was extracted using Trizol and DNase treated for 30 min at 37C. Single amplicon libraries were constructed using gene specific RT PCR. Whole transcriptome libraries were created using Lexogen Quantseq library kits.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP539182,,,ZF_NES_GAPDH_Rep4_plus.R1.fq.gz ZF_NES_GAPDH_Rep4_plus.R2.fq.gz,fastq fastq,1010253300.0,3367511.0,GSM8578752 r1,0:150 1:150,A:264284161;C:228880831;G:244038984;T:273032130;N:17194,150,150,,,264284161,228880831,244038984,273032130,17194,SRX26416436,SRS22936290,SRA1993027,"Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus","Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,full_length,random_priming,lexogen,bulk,unknown,unknown,,United States,2024-10-17,Hatching,Embryo,Embryo Imprecise,All anatomical structures
49573,SRR10434662,SRX7130632,SRS5639976,SRP163087,PRJNA494251,Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis,GSE120724,Other,We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.,,pubmed:32423473,,shield Flag Elavl1a iCLIP rep2,GSM4157939,,tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf,shield Flag Elavl1a iCLIP rep2,"The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First  we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped  5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters  big  s  maxgap "" 1"" peaks are identified using tag2peak.pl with parameters  big  ss  v   prefix ""CITS""  gap 25  p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus  peak heightPH  expected PH/backgroundPH0 and pvalueP. The fifth  column represents the peak height.",zebrafish embryos,,iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc,Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.,strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf,GSM4157939,GSM4157939: shield Flag Elavl1a iCLIP rep2; Danio rerio; OTHER,GSM4157939,,1,iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc,GEO Accession:GSM4157939,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,HiSeq X Ten,,SRP163087,,,Shield_Elavl1a_iCLIP_rep2.R2.fq.gz Shield_Elavl1a_iCLIP_rep2.R1.fq.gz,fastq fastq,23879342400.0,79597808.0,GSM4157939 r1,0:150 1:150,A:6335254303;C:5166953187;G:6017120995;T:6358132998;N:1880917,150,150,,,6335254303,5166953187,6017120995,6358132998,1880917,SRX7130632,SRS5639976,SRA787572,GEO,"Life Science, Tsinghua University",2,0.14294,0.15151,0.03583,0.08959,0.99397,0.98269,0.96727,0.75507,150,150,B,B,biological fallback assumption,illumina,hiseq_era,full_length,poly_a,smarter,bulk,clip,iclip,,China,2019-11-12,Gastrula,Embryo,Embryo Imprecise,All anatomical structures
49574,SRR10434661,SRX7130631,SRS5639975,SRP163087,PRJNA494251,Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis,GSE120724,Other,We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.,,pubmed:32423473,,shield Flag Elavl1a iCLIP rep1,GSM4157938,,tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf,shield Flag Elavl1a iCLIP rep1,"The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First  we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped  5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters  big  s  maxgap "" 1"" peaks are identified using tag2peak.pl with parameters  big  ss  v   prefix ""CITS""  gap 25  p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus  peak heightPH  expected PH/backgroundPH0 and pvalueP. The fifth  column represents the peak height.",zebrafish embryos,,iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc,Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.,strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:6hpf,GSM4157938,GSM4157938: shield Flag Elavl1a iCLIP rep1; Danio rerio; OTHER,GSM4157938,,1,iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc,GEO Accession:GSM4157938,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,HiSeq X Ten,,SRP163087,,,Shield_Elavl1a_iCLIP_rep1.R1.fq.gz Shield_Elavl1a_iCLIP_rep1.R2.fq.gz,fastq fastq,22375977600.0,74586592.0,GSM4157938 r1,0:150 1:150,A:6243025236;C:5008499337;G:5418170547;T:5704514909;N:1767571,150,150,,,6243025236,5008499337,5418170547,5704514909,1767571,SRX7130631,SRS5639975,SRA787572,GEO,"Life Science, Tsinghua University",2,0.05144,0.12625,0.01219,0.09577,0.99734,0.98113,0.8629,0.52429,150,150,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,full_length,poly_a,smarter,bulk,clip,iclip,,China,2019-11-12,Gastrula,Embryo,Embryo Imprecise,All anatomical structures
49575,SRR10434660,SRX7130630,SRS5639974,SRP163087,PRJNA494251,Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis,GSE120724,Other,We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.,,pubmed:32423473,,sphere Flag Elavl1a iCLIP rep2,GSM4157937,,tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf,sphere Flag Elavl1a iCLIP rep2,"The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First  we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped  5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters  big  s  maxgap "" 1"" peaks are identified using tag2peak.pl with parameters  big  ss  v   prefix ""CITS""  gap 25  p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus  peak heightPH  expected PH/backgroundPH0 and pvalueP. The fifth  column represents the peak height.",zebrafish embryos,,iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc,Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.,strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf,GSM4157937,GSM4157937: sphere Flag Elavl1a iCLIP rep2; Danio rerio; OTHER,GSM4157937,,1,iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc,GEO Accession:GSM4157937,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,HiSeq X Ten,,SRP163087,,,Sphere_Elavl1a_iCLIP_rep2.R1.fq.gz Sphere_Elavl1a_iCLIP_rep2.R2.fq.gz,fastq fastq,22090855200.0,73636184.0,GSM4157937 r1,0:150 1:150,A:5631298996;C:5114935575;G:5742247735;T:5600647498;N:1725396,150,150,,,5631298996,5114935575,5742247735,5600647498,1725396,SRX7130630,SRS5639974,SRA787572,GEO,"Life Science, Tsinghua University",2,0.23476,0.17586,0.06861,0.08859,0.99563,0.98873,0.95465,0.79994,150,150,B,B,mate2-mate1 similar by mapping diff,illumina,hiseq_era,full_length,poly_a,smarter,bulk,clip,iclip,,China,2019-11-12,Blastula,Embryo,Embryo Imprecise,All anatomical structures
49576,SRR10434659,SRX7130629,SRS5639973,SRP163087,PRJNA494251,Dynamic landscapes and regulome of mRNA structure during zebrafish early embryogenesis,GSE120724,Other,We resolved the RNA secondary structure during zebrafish early embryogenesis based on  in vivo click selective 2' hydroxyl acylation and profiling experiment icSHAPE. We analyzed the RNA structure dynamics among different development stages.  Also  we studied which factors regulate maternal gene decay by RNA structure switch. Overall design: icSHAPE of 12 samples from zebrafish embryos at six different early development stages and 4 samples from Elavl1a deficient zebrafish embryos at sphere and shield stages  including two treated with DMSO as control and two treated with NAIN3 for each stage or condition. RNA seq of 6 samples from zebrafish embryos at 2  4  6 h.p.f. and 4 samples from Elavl1a deficient zebrafish embryos at 4 and 6 h.p.f. including two biological replicates. iCLIP seq of 4 samples from flag elavl1a mRNA injected zebrafish embryos at xxx and 6 h.p.f. including two biological replicates.,,pubmed:32423473,,sphere Flag Elavl1a iCLIP rep1,GSM4157936,,tissue:zebrafish embryos|strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf,sphere Flag Elavl1a iCLIP rep1,"The proceesing procedure is similar to CTK toolhttps://zhanglab.c2b2.columbia.edu/index.php/ICLIP data analysis using CTK. First  we trimmed three prime adaptor from reads by cutadapt collapsed duplicated reads by fastq2collapse.pl in CTK tool stripped  5’ degenerated barcode mapped clean reads to zebrafish reference genomez10 by bwav0.7.17. data from replicates was merged for peak calling We use CTK tool CITS mode to call the peaks. Reads were clustered using tag2cluster.pl with parameters  big  s  maxgap "" 1"" peaks are identified using tag2peak.pl with parameters  big  ss  v   prefix ""CITS""  gap 25  p 0.05 Genome build: z10 Supplementary files format and content: iCLIP peaks identified by CTK tool were provided in bed file format. The first three columns represent the 0 based location of the peak in the genome and the last column represents the strand.The fourth column reprents the peak ID and describes the gene locus  peak heightPH  expected PH/backgroundPH0 and pvalueP. The fifth  column represents the peak height.",zebrafish embryos,,iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc,Zebrafish wild type strain AB was raised in system water at 28.5°C under standard conditions.,strain:zebrafish embryos|cell type:normal zebrafish embryos cells|age:4hpf,GSM4157936,GSM4157936: sphere Flag Elavl1a iCLIP rep1; Danio rerio; OTHER,GSM4157936,,1,iCLIP seq was carried out as previously described Despic et al.  2017. Breifly  flag elavl1a mRNA injected embryos were collected at xxx h.p.f. and 6 h.p.f.. 400 zebrafish embryos were irradiated twice with 0.8 J/cm2 Stratalinker 2400  Stratagene  lysed  and subjected to mild RNA fragmentation. Crosslinked RNA proteins complexes were immunopurified using Anti FLAG M2 Magnetic Beads Merck  M8823 for 4 h.p.f. and 6 h.p.f. at 4 °C. RNA was extracted Library construction was performed by using Smarter smRNA Seq kit Clontech Laboratories Inc,GEO Accession:GSM4157936,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,HiSeq X Ten,,SRP163087,,,Sphere_Elavl1a_iCLIP_rep1.R2.fq.gz Sphere_Elavl1a_iCLIP_rep1.R1.fq.gz,fastq fastq,15794202300.0,52647341.0,GSM4157936 r1,0:150 1:150,A:4443931911;C:3527112429;G:3707720167;T:4114188890;N:1248903,150,150,,,4443931911,3527112429,3707720167,4114188890,1248903,SRX7130629,SRS5639973,SRA787572,GEO,"Life Science, Tsinghua University",2,0.06877,0.10388,0.02139,0.07135,0.99776,0.98413,0.87145,0.57456,150,150,B,B,mate1-mate2 similar by mapping diff,illumina,hiseq_era,full_length,poly_a,smarter,bulk,clip,iclip,,China,2019-11-12,Blastula,Embryo,Embryo Imprecise,All anatomical structures
56341,SRR10948891,SRX7615949,SRS6049208,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,Prim5 Cyt CAGE,GSM4278497,,source name:24hpf stage embryo|tissue:zebrafish embryos|Stage:24hpf|fraction:Cytosolic|molecule type:capped RNAs,Prim5 Cyt CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,24hpf stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:24hpf|fraction:Cytosolic|molecule type:capped RNAs,GSM4278497,GSM4278497: Prim5 Cyt CAGE; Danio rerio; OTHER,GSM4278497,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278497,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Prim5_Cyt_L006_R1_001.fastq.gz Prim5_Cyt_L006_R2_001.fastq.gz,fastq fastq,11647548055.0,122605769.0,GSM4278497 r1,0:51 1:44,A:2440692679;C:3082646191;G:3382532043;T:2741423146;N:253996,51,44,,,2440692679,3082646191,3382532043,2741423146,253996,SRX7615949,SRS6049208,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.98284,0.34054,0.34811,0.12661,0.90753,0.95018,0.67956,0.71841,51,44,B,T,mate2 technical by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
56342,SRR10948890,SRX7615948,SRS6049207,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,Prim5 Nuc CAGE,GSM4278496,,source name:24hpf stage embryo|tissue:zebrafish embryos|Stage:24hpf|fraction:Nuclear|molecule type:capped RNAs,Prim5 Nuc CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,24hpf stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:24hpf|fraction:Nuclear|molecule type:capped RNAs,GSM4278496,GSM4278496: Prim5 Nuc CAGE; Danio rerio; OTHER,GSM4278496,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278496,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Prim5_Nuc_L006_R1_001.fastq.gz Prim5_Nuc_L006_R2_001.fastq.gz,fastq fastq,2052983345.0,21610351.0,GSM4278496 r1,0:51 1:44,A:448698187;C:513165511;G:563783876;T:527290561;N:45210,51,44,,,448698187,513165511,563783876,527290561,45210,SRX7615948,SRS6049207,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.95137,0.36483,0.38701,0.1658,0.82292,0.90638,0.65602,0.68468,51,44,B,T,mate2 technical by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Pharyngula,Embryo,Embryo Imprecise,All anatomical structures
56343,SRR10948889,SRX7615947,SRS6049205,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,Shield Cyt CAGE,GSM4278495,,source name:Shield stage embryo|tissue:zebrafish embryos|Stage:Shield|fraction:Cytosolic|molecule type:capped RNAs,Shield Cyt CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,Shield stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:Shield|fraction:Cytosolic|molecule type:capped RNAs,GSM4278495,GSM4278495: Shield Cyt CAGE; Danio rerio; OTHER,GSM4278495,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278495,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Shield_Cyt_L006_R1_001.fastq.gz Shield_Cyt_L006_R2_001.fastq.gz,fastq fastq,8704643185.0,91627823.0,GSM4278495 r1,0:51 1:44,A:1930221949;C:2128885351;G:2388442525;T:2256907064;N:186296,51,44,,,1930221949,2128885351,2388442525,2256907064,186296,SRX7615947,SRS6049205,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.89389,0.40438,0.14385,0.06093,0.78792,0.8352,0.5381,0.52296,51,44,B,B,mate2-mate1 similar by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures
56344,SRR10948888,SRX7615946,SRS6049206,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,Shield Nuc CAGE,GSM4278494,,source name:Shield stage embryo|tissue:zebrafish embryos|Stage:Shield|fraction:Nuclear|molecule type:capped RNAs,Shield Nuc CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,Shield stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:Shield|fraction:Nuclear|molecule type:capped RNAs,GSM4278494,GSM4278494: Shield Nuc CAGE; Danio rerio; OTHER,GSM4278494,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278494,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Shield_Nuc_L006_R1_001.fastq.gz Shield_Nuc_L006_R2_001.fastq.gz,fastq fastq,1700102330.0,17895814.0,GSM4278494 r1,0:51 1:44,A:370009933;C:422952763;G:478245997;T:428857334;N:36303,51,44,,,370009933,422952763,478245997,428857334,36303,SRX7615946,SRS6049206,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.9163,0.35706,0.26264,0.1183,0.78244,0.863,0.6044,0.56423,51,44,B,T,mate2 technical by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Gastrula,Embryo,Embryo Imprecise,All anatomical structures
56345,SRR10948887,SRX7615945,SRS6049203,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,Dome Cyt CAGE,GSM4278493,,source name:Dome stage embryo|tissue:zebrafish embryos|Stage:Dome|fraction:Cytosolic|molecule type:capped RNAs,Dome Cyt CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,Dome stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:Dome|fraction:Cytosolic|molecule type:capped RNAs,GSM4278493,GSM4278493: Dome Cyt CAGE; Danio rerio; OTHER,GSM4278493,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278493,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Dome_Cyt_L006_R1_001.fastq.gz Dome_Cyt_L006_R2_001.fastq.gz,fastq fastq,2925028910.0,30789778.0,GSM4278493 r1,0:51 1:44,A:640538932;C:732480084;G:812849999;T:739097218;N:62677,51,44,,,640538932,732480084,812849999,739097218,62677,SRX7615945,SRS6049203,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.91,0.37548,0.19179,0.07754,0.77849,0.8296,0.5771,0.54047,51,44,B,B,mate2-mate1 similar by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Blastula,Embryo,Embryo Imprecise,All anatomical structures
56346,SRR10948886,SRX7615944,SRS6049204,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,Dome Nuc CAGE,GSM4278492,,source name:Dome stage embryo|tissue:zebrafish embryos|Stage:Dome|fraction:Nuclear|molecule type:capped RNAs,Dome Nuc CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,Dome stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:Dome|fraction:Nuclear|molecule type:capped RNAs,GSM4278492,GSM4278492: Dome Nuc CAGE; Danio rerio; OTHER,GSM4278492,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278492,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Dome_Nuc_L006_R1_001.fastq.gz Dome_Nuc_L006_R2_001.fastq.gz,fastq fastq,1025349630.0,10793154.0,GSM4278492 r1,0:51 1:44,A:224542517;C:258091485;G:286132413;T:256561363;N:21852,51,44,,,224542517,258091485,286132413,256561363,21852,SRX7615944,SRS6049204,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.90004,0.35498,0.26716,0.1319,0.75256,0.84053,0.59032,0.58429,51,44,B,T,mate2 technical by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Blastula,Embryo,Embryo Imprecise,All anatomical structures
56347,SRR10948885,SRX7615943,SRS6049202,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,1000Cell Cyt CAGE,GSM4278491,,source name:1000Cell stage embryo|tissue:zebrafish embryos|Stage:1000Cell|fraction:Cytosolic|molecule type:capped RNAs,1000Cell Cyt CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,1000Cell stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:1000Cell|fraction:Cytosolic|molecule type:capped RNAs,GSM4278491,GSM4278491: 1000Cell Cyt CAGE; Danio rerio; OTHER,GSM4278491,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278491,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Cell1000_Cyt_L006_R2_001.fastq.gz Cell1000_Cyt_L006_R1_001.fastq.gz,fastq fastq,2221341870.0,23382546.0,GSM4278491 r1,0:51 1:44,A:463771517;C:578169553;G:636288303;T:543065256;N:47241,51,44,,,463771517,578169553,636288303,543065256,47241,SRX7615943,SRS6049202,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.95318,0.36797,0.24288,0.09383,0.78654,0.83493,0.6438,0.56785,51,44,B,T,mate2 technical by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Blastula,Embryo,Embryo Imprecise,All anatomical structures
56348,SRR10948884,SRX7615942,SRS6049201,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,1000Cell Nuc CAGE,GSM4278490,,source name:1000Cell stage embryo|tissue:zebrafish embryos|Stage:1000Cell|fraction:Nuclear|molecule type:capped RNAs,1000Cell Nuc CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,1000Cell stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:1000Cell|fraction:Nuclear|molecule type:capped RNAs,GSM4278490,GSM4278490: 1000Cell Nuc CAGE; Danio rerio; OTHER,GSM4278490,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278490,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Cell1000_Nuc_L006_R1_001.fastq.gz Cell1000_Nuc_L006_R2_001.fastq.gz,fastq fastq,1165749750.0,12271050.0,GSM4278490 r1,0:51 1:44,A:242410646;C:306083126;G:336746651;T:280484368;N:24959,51,44,,,242410646,306083126,336746651,280484368,24959,SRX7615942,SRS6049201,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.91201,0.3374,0.28385,0.1085,0.78031,0.84857,0.66929,0.60831,51,44,B,T,mate2 technical by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Blastula,Embryo,Embryo Imprecise,All anatomical structures
56349,SRR10948883,SRX7615941,SRS6049200,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,256Cell Cyt CAGE,GSM4278489,,source name:256Cell stage embryo|tissue:zebrafish embryos|Stage:256Cell|fraction:Cytosolic|molecule type:capped RNAs,256Cell Cyt CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,256Cell stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:256Cell|fraction:Cytosolic|molecule type:capped RNAs,GSM4278489,GSM4278489: 256Cell Cyt CAGE; Danio rerio; OTHER,GSM4278489,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278489,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Cell256_Cyt_L006_R1_001.fastq.gz Cell256_Cyt_L006_R2_001.fastq.gz,fastq fastq,730451200.0,7688960.0,GSM4278489 r1,0:51 1:44,A:149831122;C:187919862;G:214702408;T:177982361;N:15447,51,44,,,149831122,187919862,214702408,177982361,15447,SRX7615941,SRS6049200,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.9505,0.36535,0.23886,0.09179,0.80474,0.84695,0.67208,0.61294,51,44,B,T,mate2 technical by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Blastula,Embryo,Embryo Imprecise,All anatomical structures
56350,SRR10948882,SRX7615940,SRS6049199,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,256Cell Nuc CAGE,GSM4278488,,source name:256Cell stage embryo|tissue:zebrafish embryos|Stage:256Cell|fraction:Nuclear|molecule type:capped RNAs,256Cell Nuc CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,256Cell stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:256Cell|fraction:Nuclear|molecule type:capped RNAs,GSM4278488,GSM4278488: 256Cell Nuc CAGE; Danio rerio; OTHER,GSM4278488,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278488,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Cell256_Nuc_L006_R1_001.fastq.gz Cell256_Nuc_L006_R2_001.fastq.gz,fastq fastq,914411290.0,9625382.0,GSM4278488 r1,0:51 1:44,A:183085401;C:238593034;G:274558029;T:218155345;N:19481,51,44,,,183085401,238593034,274558029,218155345,19481,SRX7615940,SRS6049199,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.96805,0.36191,0.34605,0.11823,0.82351,0.86963,0.68965,0.64112,51,44,B,T,mate2 technical by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Blastula,Embryo,Embryo Imprecise,All anatomical structures
56351,SRR10948881,SRX7615939,SRS6049198,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,64Cell Cyt CAGE,GSM4278487,,source name:64Cell stage embryo|tissue:zebrafish embryos|Stage:64Cell|fraction:Cytosolic|molecule type:capped RNAs,64Cell Cyt CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,64Cell stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:64Cell|fraction:Cytosolic|molecule type:capped RNAs,GSM4278487,GSM4278487: 64Cell Cyt CAGE; Danio rerio; OTHER,GSM4278487,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278487,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Cell64_Cyt_L006_R1_001.fastq.gz Cell64_Cyt_L006_R2_001.fastq.gz,fastq fastq,166574140.0,1753412.0,GSM4278487 r1,0:51 1:44,A:34424987;C:43748779;G:47831884;T:40564939;N:3551,51,44,,,34424987,43748779,47831884,40564939,3551,SRX7615939,SRS6049198,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.94853,0.36859,0.20547,0.07164,0.80377,0.84845,0.66429,0.60646,51,44,B,B,mate2-mate1 similar by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
56352,SRR10948880,SRX7615938,SRS6049197,SRP243873,PRJNA602610,Global promoter usage in the differentfractions of the cell during early zebrafish development,GSE144040,Other,We employed transcriptomics methods to examine differences in promoter usage in the nuclear and cytosolic fractions of zebrafish embryonic cells at different stages of development. The analysis of the CAGE seq data revealed differences in promoter width within the same stage Post MZT in different compartments of the embryonic cell proposing a spatial and temporal regulation of gene expression. Overall design: Promoter organisation in the nuclear and cytosolic fractions of zebrafish embryonic cells in the 64 Cell  256 Cell  1000 Cell  Dome   Shield and Prim 5 stages of development.,,pubmed:33795334,,64Cell Nuc CAGE,GSM4278486,,source name:64Cell stage embryo|tissue:zebrafish embryos|Stage:64Cell|fraction:Nuclear|molecule type:capped RNAs,64Cell Nuc CAGE,Library strategy: LQ CAGE sequencing The raw tags from CAGE sequencing were mapped using STAR aligner and the resulting BAM files were used in the bioconductor package CAGEr for further downstream analysis. CAGEr starts from mapped reads and does quality filtering  normalization  removal of the additional 5’ end G nucleotide added during the CAGE protocol and the frequency of the usage of start sites Haberle et al.  2015. Genome build: Zv9 Supplementary files format and content: CTSS files in bedGraph format,64Cell stage embryo,Dechorionated embryos were then washed twice with 1 X PBS Phosphate buffer solution  ThermoFisher. RLN buffer was added to the tube containing embryos and the yolk sac disrupted releasing the cells in the buffer. This was then incubated on ice for 5 mins and centrifuged. The resulting supernatant was collected and labelled as the cytosolic fraction. The pellet was washed twice with 200 µL of RLN buffer and finally  collected and labelled as the nuclear fraction.,RNA was extracted using the Rneasy mini kit The conventional method used for 5’ cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the 5’ end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,Wild type male and female zebrafish AB strain were set up in breeding tanks overnight and the eggs were collected the next day as soon as 10 min they were laid important to get synchronised embryos. About 100 500 depending upon the stage embryos were collected for each developmental stage 64 cell  256 cell  1000 cell  shield  24hpf  50hpf. The embryos were treated with Pronase protease from Streptomyces griseus  Sigma Aldrich to remove the chorion  1mL of Pronase working solution 1mg/mL was added to 2 3 ml of fish water containing embryos.,tissue:zebrafish embryos|Stage:64Cell|fraction:Nuclear|molecule type:capped RNAs,GSM4278486,GSM4278486: 64Cell Nuc CAGE; Danio rerio; OTHER,GSM4278486,,1,RNA was extracted using the Rneasy mini kit The conventional method used for five prime cap analysis  also called cap trapping method Carninci et al.  1996  targets all capped mRNAs by chemical modification of the five prime end cap followed by its biotinylation and then a pulldown using streptavidin coated beads. We used a modified version of cap trapping called Low Quantity CAGE or LQ CAGE for our CAGE library preparation. This method allowed use of limited quantities of RNAs as is generally obtained in early stages of development.,GEO Accession:GSM4278486,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP243873,,,Cell64_Nuc_L006_R1_001.fastq.gz Cell64_Nuc_L006_R2_001.fastq.gz,fastq fastq,254581570.0,2679806.0,GSM4278486 r1,0:51 1:44,A:53351059;C:66480035;G:73184710;T:61560147;N:5619,51,44,,,53351059,66480035,73184710,61560147,5619,SRX7615938,SRS6049197,SRA1029879,GEO,"School of Biosciences, University of Birmingham",2,0.85142,0.32881,0.18708,0.06992,0.7864,0.84159,0.62224,0.57075,51,44,B,B,mate2-mate1 similar by mapping diff,illumina,hiseq_era,5prime,other,unknown,bulk,unknown,unknown,,United Kingdom,2020-01-22,Cleavage,Embryo,Embryo Imprecise,All anatomical structures
70582,SRR20001185,SRX16042033,SRS13721701,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species  through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org  an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse  human  frog  and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further  we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore  iCodon will benefit basic biological research  as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome  with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1  iCodon 2  iCodon 3  iCodon 4  and iCodon 5  from less to more stable mRNA predictions. Additionally  5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered  in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos  and the mRNA decay post 2  5  and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 8h 3,GSM6300339,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,zf library 8h 3,Paired end reads were merged with FLASH using default parameters  reads that could not be merged were discarded. Next  using Cutadapt  the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then  reads were separated by length read length = 297  expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then  the reads that were not mapped read length = 297  nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297  insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle  injection mix  and breeding. 25 embryos were collected at 2  5  and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer’s protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300339,GSM6300339: zf library 8h 3; Danio rerio; OTHER,GSM6300339 r1,GSM6300339,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer's protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_8h_3_1.fastq.gz zf_library_8h_3_2.fastq.gz,fastq fastq,885299088.0,1763544.0,GSM6300339 r1,0:251 1:251,A:222214043;C:219331579;G:228248922;T:215275916;N:228628,251,251,,,222214043,219331579,228248922,215275916,228628,SRX16042033,SRS13721701,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
70583,SRR20001186,SRX16042032,SRS13721700,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species  through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org  an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse  human  frog  and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further  we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore  iCodon will benefit basic biological research  as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome  with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1  iCodon 2  iCodon 3  iCodon 4  and iCodon 5  from less to more stable mRNA predictions. Additionally  5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered  in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos  and the mRNA decay post 2  5  and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 8h 2,GSM6300338,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,zf library 8h 2,Paired end reads were merged with FLASH using default parameters  reads that could not be merged were discarded. Next  using Cutadapt  the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then  reads were separated by length read length = 297  expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then  the reads that were not mapped read length = 297  nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297  insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle  injection mix  and breeding. 25 embryos were collected at 2  5  and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer’s protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300338,GSM6300338: zf library 8h 2; Danio rerio; OTHER,GSM6300338 r1,GSM6300338,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer's protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_8h_2_1.fastq.gz zf_library_8h_2_2.fastq.gz,fastq fastq,869922828.0,1732914.0,GSM6300338 r1,0:251 1:251,A:218951651;C:214394584;G:224473321;T:211879293;N:223979,251,251,,,218951651,214394584,224473321,211879293,223979,SRX16042032,SRS13721700,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
70584,SRR20001187,SRX16042031,SRS13721699,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species  through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org  an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse  human  frog  and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further  we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore  iCodon will benefit basic biological research  as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome  with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1  iCodon 2  iCodon 3  iCodon 4  and iCodon 5  from less to more stable mRNA predictions. Additionally  5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered  in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos  and the mRNA decay post 2  5  and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 8h 1,GSM6300337,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,zf library 8h 1,Paired end reads were merged with FLASH using default parameters  reads that could not be merged were discarded. Next  using Cutadapt  the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then  reads were separated by length read length = 297  expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then  the reads that were not mapped read length = 297  nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297  insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle  injection mix  and breeding. 25 embryos were collected at 2  5  and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer’s protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300337,GSM6300337: zf library 8h 1; Danio rerio; OTHER,GSM6300337 r1,GSM6300337,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer's protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_8h_1_1.fastq.gz zf_library_8h_1_2.fastq.gz,fastq fastq,895219612.0,1783306.0,GSM6300337 r1,0:251 1:251,A:224849175;C:221105420;G:230877700;T:218157114;N:230203,251,251,,,224849175,221105420,230877700,218157114,230203,SRX16042031,SRS13721699,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
70585,SRR20001188,SRX16042030,SRS13721698,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species  through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org  an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse  human  frog  and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further  we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore  iCodon will benefit basic biological research  as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome  with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1  iCodon 2  iCodon 3  iCodon 4  and iCodon 5  from less to more stable mRNA predictions. Additionally  5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered  in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos  and the mRNA decay post 2  5  and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 5h 3,GSM6300336,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,zf library 5h 3,Paired end reads were merged with FLASH using default parameters  reads that could not be merged were discarded. Next  using Cutadapt  the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then  reads were separated by length read length = 297  expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then  the reads that were not mapped read length = 297  nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297  insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle  injection mix  and breeding. 25 embryos were collected at 2  5  and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer’s protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300336,GSM6300336: zf library 5h 3; Danio rerio; OTHER,GSM6300336 r1,GSM6300336,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer's protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_5h_3_1.fastq.gz zf_library_5h_3_2.fastq.gz,fastq fastq,872893162.0,1738831.0,GSM6300336 r1,0:251 1:251,A:220087290;C:215314493;G:223004894;T:214259861;N:226624,251,251,,,220087290,215314493,223004894,214259861,226624,SRX16042030,SRS13721698,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
70586,SRR20001189,SRX16042029,SRS13721697,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species  through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org  an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse  human  frog  and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further  we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore  iCodon will benefit basic biological research  as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome  with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1  iCodon 2  iCodon 3  iCodon 4  and iCodon 5  from less to more stable mRNA predictions. Additionally  5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered  in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos  and the mRNA decay post 2  5  and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 5h 2,GSM6300335,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,zf library 5h 2,Paired end reads were merged with FLASH using default parameters  reads that could not be merged were discarded. Next  using Cutadapt  the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then  reads were separated by length read length = 297  expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then  the reads that were not mapped read length = 297  nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297  insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle  injection mix  and breeding. 25 embryos were collected at 2  5  and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer’s protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300335,GSM6300335: zf library 5h 2; Danio rerio; OTHER,GSM6300335 r1,GSM6300335,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer's protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_5h_2_1.fastq.gz zf_library_5h_2_2.fastq.gz,fastq fastq,842675272.0,1678636.0,GSM6300335 r1,0:251 1:251,A:212323691;C:207621938;G:216058999;T:206458094;N:212550,251,251,,,212323691,207621938,216058999,206458094,212550,SRX16042029,SRS13721697,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
70587,SRR20001190,SRX16042028,SRS13721696,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species  through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org  an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse  human  frog  and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further  we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore  iCodon will benefit basic biological research  as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome  with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1  iCodon 2  iCodon 3  iCodon 4  and iCodon 5  from less to more stable mRNA predictions. Additionally  5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered  in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos  and the mRNA decay post 2  5  and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 5h 1,GSM6300334,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,zf library 5h 1,Paired end reads were merged with FLASH using default parameters  reads that could not be merged were discarded. Next  using Cutadapt  the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then  reads were separated by length read length = 297  expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then  the reads that were not mapped read length = 297  nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297  insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle  injection mix  and breeding. 25 embryos were collected at 2  5  and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer’s protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300334,GSM6300334: zf library 5h 1; Danio rerio; OTHER,GSM6300334 r1,GSM6300334,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer's protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_5h_1_1.fastq.gz zf_library_5h_1_2.fastq.gz,fastq fastq,851971810.0,1697155.0,GSM6300334 r1,0:251 1:251,A:214612692;C:209910896;G:219013172;T:208215928;N:219122,251,251,,,214612692,209910896,219013172,208215928,219122,SRX16042028,SRS13721696,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
70588,SRR20001191,SRX16042027,SRS13721695,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species  through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org  an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse  human  frog  and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further  we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore  iCodon will benefit basic biological research  as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome  with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1  iCodon 2  iCodon 3  iCodon 4  and iCodon 5  from less to more stable mRNA predictions. Additionally  5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered  in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos  and the mRNA decay post 2  5  and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 2h 3,GSM6300333,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,zf library 2h 3,Paired end reads were merged with FLASH using default parameters  reads that could not be merged were discarded. Next  using Cutadapt  the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then  reads were separated by length read length = 297  expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then  the reads that were not mapped read length = 297  nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297  insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle  injection mix  and breeding. 25 embryos were collected at 2  5  and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer’s protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300333,GSM6300333: zf library 2h 3; Danio rerio; OTHER,GSM6300333 r1,GSM6300333,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer's protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_2h_3_1.fastq.gz zf_library_2h_3_2.fastq.gz,fastq fastq,1056027782.0,2103641.0,GSM6300333 r1,0:251 1:251,A:266201946;C:259901869;G:270474572;T:259174077;N:275318,251,251,,,266201946,259901869,270474572,259174077,275318,SRX16042027,SRS13721695,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
70589,SRR20001192,SRX16042026,SRS13721694,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species  through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org  an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse  human  frog  and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further  we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore  iCodon will benefit basic biological research  as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome  with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1  iCodon 2  iCodon 3  iCodon 4  and iCodon 5  from less to more stable mRNA predictions. Additionally  5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered  in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos  and the mRNA decay post 2  5  and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 2h 2,GSM6300332,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,zf library 2h 2,Paired end reads were merged with FLASH using default parameters  reads that could not be merged were discarded. Next  using Cutadapt  the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then  reads were separated by length read length = 297  expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then  the reads that were not mapped read length = 297  nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297  insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle  injection mix  and breeding. 25 embryos were collected at 2  5  and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer’s protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300332,GSM6300332: zf library 2h 2; Danio rerio; OTHER,GSM6300332 r1,GSM6300332,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer's protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_2h_2_1.fastq.gz zf_library_2h_2_2.fastq.gz,fastq fastq,947154022.0,1886761.0,GSM6300332 r1,0:251 1:251,A:238912401;C:233180719;G:242163235;T:232651663;N:246004,251,251,,,238912401,233180719,242163235,232651663,246004,SRX16042026,SRS13721694,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,1e-05,0.0,0.0,0.0,0.99997,1.0,1.0,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
70590,SRR20001193,SRX16042025,SRS13721693,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species  through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org  an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse  human  frog  and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further  we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore  iCodon will benefit basic biological research  as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome  with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1  iCodon 2  iCodon 3  iCodon 4  and iCodon 5  from less to more stable mRNA predictions. Additionally  5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered  in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos  and the mRNA decay post 2  5  and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 2h 1,GSM6300331,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,zf library 2h 1,Paired end reads were merged with FLASH using default parameters  reads that could not be merged were discarded. Next  using Cutadapt  the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then  reads were separated by length read length = 297  expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then  the reads that were not mapped read length = 297  nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297  insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle  injection mix  and breeding. 25 embryos were collected at 2  5  and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer’s protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300331,GSM6300331: zf library 2h 1; Danio rerio; OTHER,GSM6300331 r1,GSM6300331,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit  followed by vortexing for 1 min and stored at  70°C until extraction. RNA was thawed at 37°C  extracted following the manufacturer's protocol  and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl  pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit  utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi  and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_2h_1_1.fastq.gz zf_library_2h_1_2.fastq.gz,fastq fastq,896725612.0,1786306.0,GSM6300331 r1,0:251 1:251,A:225772798;C:221066817;G:229953803;T:219699756;N:232438,251,251,,,225772798,221066817,229953803,219699756,232438,SRX16042025,SRS13721693,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
71044,SRR21140654,SRX17152943,SRS14724788,SRP393052,PRJNA871254,Mycn regulates intestinal development through ribosomal biogenesis in a zebrafish model of Feingold syndrome 1 RNA seq and Ribo seq,GSE211652,Other,Purpose: To systematically investigate the molecular mechanisms resulting from Mycn loss of function. Methods:  Approximately 30 mycn mutant or WT zebrafish embryos at 72 hpf were harvested . Libraries were prepared using Chromium Controller and Chromium Single Cell three primeLibrary & Gel Bead Kit v3 10x Genomics  PN 1000074 according to the manufacturer's protocol for 10000 cells recovery. Results: More than 3 000 genes showed reduced tranlation efficiency in Mycn mutant. Conclusions: mTOR signaling was reduced in Mycn mutant. Overall design: wild type or mycn zebrafish embryos at 72 hpf were harvested for RNA seq and Ribo seq.,,,,Mycn mutant zebrafish embryos Ribo seq 72 hpf replicate 2,GSM6482085,,source name:zebrafish cells|strain:Mycn mutant|tissue:embryonic cells|age:72 hpf,Mycn mutant  zebrafish embryos Ribo seq 72 hpf replicate 2,The sequencing reads were aligned to the zebrafish GRCz11 genome using STAR  and reads mapped to multiple genomic location were removed. Gene expression counts of each sample were calculated by featureCounts. Differential expression analysis was performed by limma package. Assembly: GRCz11,zebrafish cells,WT and Mycn mutant zebrafish embryos were collected for RNA sequencing or Ribo seq at 72 hpf,For bulk RNA seq  RNA libraries were prepared for sequencing using standard Illumina protocols. For Ribo seq  WT and mycn mutant embryos were collected at 3 dpf  digested with cold 0.5% trypsin to a single cell suspension  and homogenized in lysis buffer for 20–50 times. The homogenate centrifuged at 12 000 g for 15 min at 4°C  and the supernatants were digested with RNase for 30 mins and aborted by 1M EGTA followed by layering on top of a 10%–50% sucrose gradient solution. Ultracentrifugation was performed at 36 000 rpm for 2 hrs hours at 4°C. post centrifugation  the fractions were collected according to the absorbance at optical density OD260 by a TRAIX detector. Then the RNA was purified and used to construct the library for sequencing.,embryos were cultured in a Petri dish filled with 0.3X Danieau buffer,strain:Mycn mutant|tissue:embryonic cells|age:72 hpf,GSM6482085,GSM6482085: Mycn mutant  zebrafish embryos Ribo seq 72 hpf replicate 2; Danio rerio; OTHER,GSM6482085 r1,GSM6482085,1,For bulk RNA seq  RNA libraries were prepared for sequencing using standard Illumina protocols. For Ribo seq  WT and mycn mutant embryos were collected at 3 dpf  digested with cold 0.5% trypsin to a single cell suspension  and homogenized in lysis buffer for 20–50 times. The homogenate centrifuged at 12 000 g for 15 min at 4°C  and the supernatants were digested with RNase for 30 mins and aborted by 1M EGTA followed by layering on top of a 10%–50% sucrose gradient solution. Ultracentrifugation was performed at 36 000 rpm for 2 hrs hours at 4°C. post centrifugation  the fractions were collected according to the absorbance at optical density OD260 by a TRAIX detector. Then the RNA was purified and used to construct the library for sequencing.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP393052,,,mut2-riboseq_1.clean.fq.gz mut2-riboseq_2.clean.fq.gz,fastq fastq,405742417.0,6982873.0,GSM6482085 r1,0:29.04 1:29.07,A:98515642;C:104430844;G:104419248;T:98371492;N:5191,29,29,,,98515642,104430844,104419248,98371492,5191,SRX17152943,SRS14724788,SRA1479247,"Institute of genetics, Zhejiang University","Institute of genetics, Zhejiang University",2,0.4308,0.42905,0.15957,0.1591,0.74292,0.74302,0.56011,0.55773,40,40,B,B,biological fallback assumption,illumina,novaseq_era,unknown,other,unknown,sc,bulk,bulk,,China,2022-08-19,Larval,Larval,Embryo Imprecise,All anatomical structures
71045,SRR21140655,SRX17152942,SRS14724787,SRP393052,PRJNA871254,Mycn regulates intestinal development through ribosomal biogenesis in a zebrafish model of Feingold syndrome 1 RNA seq and Ribo seq,GSE211652,Other,Purpose: To systematically investigate the molecular mechanisms resulting from Mycn loss of function. Methods:  Approximately 30 mycn mutant or WT zebrafish embryos at 72 hpf were harvested . Libraries were prepared using Chromium Controller and Chromium Single Cell three primeLibrary & Gel Bead Kit v3 10x Genomics  PN 1000074 according to the manufacturer's protocol for 10000 cells recovery. Results: More than 3 000 genes showed reduced tranlation efficiency in Mycn mutant. Conclusions: mTOR signaling was reduced in Mycn mutant. Overall design: wild type or mycn zebrafish embryos at 72 hpf were harvested for RNA seq and Ribo seq.,,,,Mycn mutant zebrafish embryos Ribo seq 72 hpf replicate 1,GSM6482084,,source name:zebrafish cells|strain:Mycn mutant|tissue:embryonic cells|age:72 hpf,Mycn mutant  zebrafish embryos Ribo seq 72 hpf replicate 1,The sequencing reads were aligned to the zebrafish GRCz11 genome using STAR  and reads mapped to multiple genomic location were removed. Gene expression counts of each sample were calculated by featureCounts. Differential expression analysis was performed by limma package. Assembly: GRCz11,zebrafish cells,WT and Mycn mutant zebrafish embryos were collected for RNA sequencing or Ribo seq at 72 hpf,For bulk RNA seq  RNA libraries were prepared for sequencing using standard Illumina protocols. For Ribo seq  WT and mycn mutant embryos were collected at 3 dpf  digested with cold 0.5% trypsin to a single cell suspension  and homogenized in lysis buffer for 20–50 times. The homogenate centrifuged at 12 000 g for 15 min at 4°C  and the supernatants were digested with RNase for 30 mins and aborted by 1M EGTA followed by layering on top of a 10%–50% sucrose gradient solution. Ultracentrifugation was performed at 36 000 rpm for 2 hrs hours at 4°C. post centrifugation  the fractions were collected according to the absorbance at optical density OD260 by a TRAIX detector. Then the RNA was purified and used to construct the library for sequencing.,embryos were cultured in a Petri dish filled with 0.3X Danieau buffer,strain:Mycn mutant|tissue:embryonic cells|age:72 hpf,GSM6482084,GSM6482084: Mycn mutant  zebrafish embryos Ribo seq 72 hpf replicate 1; Danio rerio; OTHER,GSM6482084 r1,GSM6482084,1,For bulk RNA seq  RNA libraries were prepared for sequencing using standard Illumina protocols. For Ribo seq  WT and mycn mutant embryos were collected at 3 dpf  digested with cold 0.5% trypsin to a single cell suspension  and homogenized in lysis buffer for 20–50 times. The homogenate centrifuged at 12 000 g for 15 min at 4°C  and the supernatants were digested with RNase for 30 mins and aborted by 1M EGTA followed by layering on top of a 10%–50% sucrose gradient solution. Ultracentrifugation was performed at 36 000 rpm for 2 hrs hours at 4°C. post centrifugation  the fractions were collected according to the absorbance at optical density OD260 by a TRAIX detector. Then the RNA was purified and used to construct the library for sequencing.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP393052,,,mut1-riboseq_1.clean.fq.gz mut1-riboseq_2.clean.fq.gz,fastq fastq,491622744.0,8480542.0,GSM6482084 r1,0:28.97 1:29.01,A:119352696;C:126567605;G:126525090;T:119169287;N:8066,28,29,,,119352696,126567605,126525090,119169287,8066,SRX17152942,SRS14724787,SRA1479247,"Institute of genetics, Zhejiang University","Institute of genetics, Zhejiang University",2,0.43508,0.4326,0.15983,0.15894,0.7388,0.73939,0.55997,0.56089,30,30,B,B,biological fallback assumption,illumina,novaseq_era,unknown,other,unknown,sc,bulk,bulk,,China,2022-08-19,Larval,Larval,Embryo Imprecise,All anatomical structures
71046,SRR21140656,SRX17152941,SRS14724786,SRP393052,PRJNA871254,Mycn regulates intestinal development through ribosomal biogenesis in a zebrafish model of Feingold syndrome 1 RNA seq and Ribo seq,GSE211652,Other,Purpose: To systematically investigate the molecular mechanisms resulting from Mycn loss of function. Methods:  Approximately 30 mycn mutant or WT zebrafish embryos at 72 hpf were harvested . Libraries were prepared using Chromium Controller and Chromium Single Cell three primeLibrary & Gel Bead Kit v3 10x Genomics  PN 1000074 according to the manufacturer's protocol for 10000 cells recovery. Results: More than 3 000 genes showed reduced tranlation efficiency in Mycn mutant. Conclusions: mTOR signaling was reduced in Mycn mutant. Overall design: wild type or mycn zebrafish embryos at 72 hpf were harvested for RNA seq and Ribo seq.,,,,wild type zebrafish embryos Ribo seq 72 hpf replicate 2,GSM6482083,,source name:zebrafish cells|strain:AB|tissue:embryonic cells|age:72 hpf,wild type  zebrafish embryos Ribo seq 72 hpf replicate 2,The sequencing reads were aligned to the zebrafish GRCz11 genome using STAR  and reads mapped to multiple genomic location were removed. Gene expression counts of each sample were calculated by featureCounts. Differential expression analysis was performed by limma package. Assembly: GRCz11,zebrafish cells,WT and Mycn mutant zebrafish embryos were collected for RNA sequencing or Ribo seq at 72 hpf,For bulk RNA seq  RNA libraries were prepared for sequencing using standard Illumina protocols. For Ribo seq  WT and mycn mutant embryos were collected at 3 dpf  digested with cold 0.5% trypsin to a single cell suspension  and homogenized in lysis buffer for 20–50 times. The homogenate centrifuged at 12 000 g for 15 min at 4°C  and the supernatants were digested with RNase for 30 mins and aborted by 1M EGTA followed by layering on top of a 10%–50% sucrose gradient solution. Ultracentrifugation was performed at 36 000 rpm for 2 hrs hours at 4°C. post centrifugation  the fractions were collected according to the absorbance at optical density OD260 by a TRAIX detector. Then the RNA was purified and used to construct the library for sequencing.,embryos were cultured in a Petri dish filled with 0.3X Danieau buffer,strain:AB|tissue:embryonic cells|age:72 hpf,GSM6482083,GSM6482083: wild type  zebrafish embryos Ribo seq 72 hpf replicate 2; Danio rerio; OTHER,GSM6482083 r1,GSM6482083,1,For bulk RNA seq  RNA libraries were prepared for sequencing using standard Illumina protocols. For Ribo seq  WT and mycn mutant embryos were collected at 3 dpf  digested with cold 0.5% trypsin to a single cell suspension  and homogenized in lysis buffer for 20–50 times. The homogenate centrifuged at 12 000 g for 15 min at 4°C  and the supernatants were digested with RNase for 30 mins and aborted by 1M EGTA followed by layering on top of a 10%–50% sucrose gradient solution. Ultracentrifugation was performed at 36 000 rpm for 2 hrs hours at 4°C. post centrifugation  the fractions were collected according to the absorbance at optical density OD260 by a TRAIX detector. Then the RNA was purified and used to construct the library for sequencing.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP393052,,,wt2-riboseq_1.clean.fq.gz wt2-riboseq_2.clean.fq.gz,fastq fastq,509843192.0,8545402.0,GSM6482083 r1,0:29.81 1:29.85,A:121579451;C:133424275;G:133469726;T:121359509;N:10231,29,29,,,121579451,133424275,133469726,121359509,10231,SRX17152941,SRS14724786,SRA1479247,"Institute of genetics, Zhejiang University","Institute of genetics, Zhejiang University",2,0.47779,0.47724,0.17114,0.17128,0.73296,0.73208,0.5655,0.56416,23,23,B,B,biological fallback assumption,illumina,novaseq_era,unknown,other,unknown,sc,bulk,bulk,,China,2022-08-19,Larval,Larval,Embryo Imprecise,All anatomical structures
71047,SRR21140657,SRX17152940,SRS14724785,SRP393052,PRJNA871254,Mycn regulates intestinal development through ribosomal biogenesis in a zebrafish model of Feingold syndrome 1 RNA seq and Ribo seq,GSE211652,Other,Purpose: To systematically investigate the molecular mechanisms resulting from Mycn loss of function. Methods:  Approximately 30 mycn mutant or WT zebrafish embryos at 72 hpf were harvested . Libraries were prepared using Chromium Controller and Chromium Single Cell three primeLibrary & Gel Bead Kit v3 10x Genomics  PN 1000074 according to the manufacturer's protocol for 10000 cells recovery. Results: More than 3 000 genes showed reduced tranlation efficiency in Mycn mutant. Conclusions: mTOR signaling was reduced in Mycn mutant. Overall design: wild type or mycn zebrafish embryos at 72 hpf were harvested for RNA seq and Ribo seq.,,,,wild type zebrafish embryos Ribo seq 72 hpf replicate 1,GSM6482082,,source name:zebrafish cells|strain:AB|tissue:embryonic cells|age:72 hpf,wild type  zebrafish embryos Ribo seq 72 hpf replicate 1,The sequencing reads were aligned to the zebrafish GRCz11 genome using STAR  and reads mapped to multiple genomic location were removed. Gene expression counts of each sample were calculated by featureCounts. Differential expression analysis was performed by limma package. Assembly: GRCz11,zebrafish cells,WT and Mycn mutant zebrafish embryos were collected for RNA sequencing or Ribo seq at 72 hpf,For bulk RNA seq  RNA libraries were prepared for sequencing using standard Illumina protocols. For Ribo seq  WT and mycn mutant embryos were collected at 3 dpf  digested with cold 0.5% trypsin to a single cell suspension  and homogenized in lysis buffer for 20–50 times. The homogenate centrifuged at 12 000 g for 15 min at 4°C  and the supernatants were digested with RNase for 30 mins and aborted by 1M EGTA followed by layering on top of a 10%–50% sucrose gradient solution. Ultracentrifugation was performed at 36 000 rpm for 2 hrs hours at 4°C. post centrifugation  the fractions were collected according to the absorbance at optical density OD260 by a TRAIX detector. Then the RNA was purified and used to construct the library for sequencing.,embryos were cultured in a Petri dish filled with 0.3X Danieau buffer,strain:AB|tissue:embryonic cells|age:72 hpf,GSM6482082,GSM6482082: wild type  zebrafish embryos Ribo seq 72 hpf replicate 1; Danio rerio; OTHER,GSM6482082 r1,GSM6482082,1,For bulk RNA seq  RNA libraries were prepared for sequencing using standard Illumina protocols. For Ribo seq  WT and mycn mutant embryos were collected at 3 dpf  digested with cold 0.5% trypsin to a single cell suspension  and homogenized in lysis buffer for 20–50 times. The homogenate centrifuged at 12 000 g for 15 min at 4°C  and the supernatants were digested with RNase for 30 mins and aborted by 1M EGTA followed by layering on top of a 10%–50% sucrose gradient solution. Ultracentrifugation was performed at 36 000 rpm for 2 hrs hours at 4°C. post centrifugation  the fractions were collected according to the absorbance at optical density OD260 by a TRAIX detector. Then the RNA was purified and used to construct the library for sequencing.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP393052,,,wt1-riboseq_1.clean.fq.gz wt1-riboseq_2.clean.fq.gz,fastq fastq,704869055.0,11792221.0,GSM6482082 r1,0:29.87 1:29.90,A:168078449;C:184483903;G:184537174;T:167755786;N:13743,29,29,,,168078449,184483903,184537174,167755786,13743,SRX17152940,SRS14724785,SRA1479247,"Institute of genetics, Zhejiang University","Institute of genetics, Zhejiang University",2,0.4713,0.46871,0.16916,0.16911,0.73746,0.73843,0.56441,0.56008,22,22,B,B,biological fallback assumption,illumina,novaseq_era,unknown,other,unknown,sc,bulk,bulk,,China,2022-08-19,Larval,Larval,Embryo Imprecise,All anatomical structures
72833,SRR23210472,SRX19158411,SRS16570832,SRP418915,PRJNA927004,Differential Nodal level promotes mesendoderm cell fate segregation mediated by chromatin organization,GSE223636,Other,Purpose: To investigate the mechanism of prechordal plate and anterior endoderm separation . Methods:  Nodal injected explants injected with 10pg ndr2 mRNA constructed from lft1 mutants and ndr1 morphants were harvested at xxxhpf. Libraries were prepared using Chromium Controller and Chromium Single Cell three primeLibrary & Gel Bead Kit v3 10x Genomics  PN 1000075 according to the manufacturer's protocol for 10000 cells recovery. For single cell multiomics  zebrafish embryos at 6 hpf were harvested.  Libraries were prepared using Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle 10x Genomics  4 rxns PN 1000285 according to the manufacturer's protocol for 10000 cells recovery. Results: A total of 10 614 single cell transcriptomes and 4 335 multiomics were collected post stringent quality control measures. Conclusions: A slight bias in Nodal signaling promotes a differential chromatin structure between prechordal plate and endoderm  which drives a differential expression of those key regulators  such as gsc and ripply1 in these two cell lineages  and further regulates mesendoderm cell fate separation. Overall design: zebrafish Nodal explants constructed from lft1 mutants and ndr1 morphants were harvested at 6hpf for scRNA seq. Zebrafish embryos were harvested at 6hpf for single cell multiomics.,,,,zebrafish embryo multiomics expression,GSM6969677,,source name:zebrafish cells|strain:AB|tissue:embryonic cells|age:6hpf,zebrafish embryo multiomics expression,Illumina sequencing reads were aligned to the zebrafish mRNA reference genome GRCz11 using the 10x Genomics CellRanger pipeline version 6.1.2 and cellranger arc version 2.0.0 with default parameters. Assembly: GRCz11 Supplementary files format and content: tar archivr or  gzip compressed  files included filtered gene bc matrices and ATAC fragments  post running CellRanger or cellranger arc pipeline. Library strategy: scMultiome GEX,zebrafish cells,10pg of ndr2 mRNA was injected to one cell of embryonic animal pole at xxx cell stage. All embryos were incubated in 0.3x Danieau buffer until 1k stage  then  were transferred to Dulbecco's Modified Eagle Medium. Animal pole explants corresponding roughly to half of the blastula were incubated to 6hpf corresponding to embryonic developmental stage.,Libraries were prepared using Chromium Controller and Chromium Single Cell 3’Library & Gel Bead Kit v3 10x Genomics  PN 1000075 and Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle 10x Genomics  4 rxns PN 1000285 according to the manufacturer’s protocol for 10000 cells recovery.,Explants were cultured in a Petri dish coated with 1.5% agarose filled with Dulbecco's Modified Eagle Medium,strain:AB|tissue:embryonic cells|age:6hpf,GSM6969677,GSM6969677: zebrafish embryo multiomics expression; Danio rerio; OTHER,GSM6969677 r1,GSM6969677,1,Libraries were prepared using Chromium Controller and Chromium Single Cell three primeLibrary & Gel Bead Kit v3 10x Genomics  PN 1000075 and Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle 10x Genomics  4 rxns PN 1000285 according to the manufacturer's protocol for 10000 cells recovery.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP418915,,loader:fastq load.py,6-M-GEX-merge_S1_L001_R1_001.fastq.gz 6-M-GEX-merge_S1_L001_R2_001.fastq.gz,fastq fastq,67059456600.0,223531522.0,GSM6969677 r1,0:150 1:150,A:20681044309;C:12370348813;G:11664316954;T:22341885756;N:1860768,150,150,,,20681044309,12370348813,11664316954,22341885756,1860768,SRX19158411,SRS16570832,SRA1581154,"Institute of genetics, Zhejiang University","Institute of genetics, Zhejiang University",2,0.45314,0.8745,0.16489,0.2261,0.99072,0.82641,0.79221,0.75799,150,150,T,B,mate1 technical by mapping diff,illumina,novaseq_era,unknown,other,unknown,sc,single_cell_droplet,10x,,China,2023-01-24,Gastrula,Embryo,Embryo Imprecise,All anatomical structures