rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
33158,SRR29791088,SRX25290435,SRS21969151,SRP519440,PRJNA1134759,Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2],GSE272064,Transcriptome Analysis,The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.,,,,Dr thymus foxn1 /  rep3,GSM8392364,,source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1 / |geo loc name:missing|collection date:missing,Dr thymus foxn1 /  rep3,Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample,thymus,,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,tissue:thymus|cell type:thymus cells|genotype:foxn1 / ,GSM8392364,GSM8392364: Dr thymus foxn1 /  rep3; Danio rerio; RNA Seq,GSM8392364 r1,GSM8392364,1,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP519440,,,BK6_R1.fastq.gz BK6_R2.fastq.gz,fastq fastq,40416715568.0,133830184.0,GSM8392364 r1,0:151 1:151,A:11536946706;C:8490306261;G:9295609599;T:11092005423;N:1847579,151,151,,,11536946706,8490306261,9295609599,11092005423,1847579,SRX25290435,SRS21969151,SRA1922343,"Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics","Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics",2,0.89276,0.89283,0.11419,0.11482,0.73306,0.73409,0.46305,0.46571,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,Germany,2024-07-11,Undetermined,Undetermined,Thymus,Hematopoietic System
33159,SRR29791089,SRX25290434,SRS21969152,SRP519440,PRJNA1134759,Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2],GSE272064,Transcriptome Analysis,The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.,,,,Dr thymus foxn1 /  rep2,GSM8392363,,source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1 / |geo loc name:missing|collection date:missing,Dr thymus foxn1 /  rep2,Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample,thymus,,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,tissue:thymus|cell type:thymus cells|genotype:foxn1 / ,GSM8392363,GSM8392363: Dr thymus foxn1 /  rep2; Danio rerio; RNA Seq,GSM8392363 r1,GSM8392363,1,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP519440,,,BK5_R1.fastq.gz BK5_R2.fastq.gz,fastq fastq,41734368446.0,138193273.0,GSM8392363 r1,0:151 1:151,A:12015023285;C:8850050726;G:9485443497;T:11381944831;N:1906107,151,151,,,12015023285,8850050726,9485443497,11381944831,1906107,SRX25290434,SRS21969152,SRA1922343,"Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics","Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics",2,0.88856,0.88918,0.11978,0.11946,0.73003,0.732,0.44244,0.43125,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,Germany,2024-07-11,Undetermined,Undetermined,Thymus,Hematopoietic System
33160,SRR29791090,SRX25290433,SRS21969150,SRP519440,PRJNA1134759,Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2],GSE272064,Transcriptome Analysis,The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.,,,,Dr thymus foxn1 /  rep1,GSM8392362,,source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1 / |geo loc name:missing|collection date:missing,Dr thymus foxn1 /  rep1,Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample,thymus,,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,tissue:thymus|cell type:thymus cells|genotype:foxn1 / ,GSM8392362,GSM8392362: Dr thymus foxn1 /  rep1; Danio rerio; RNA Seq,GSM8392362 r1,GSM8392362,1,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP519440,,,BK4_R2.fastq.gz BK4_R1.fastq.gz,fastq fastq,39302001858.0,130139079.0,GSM8392362 r1,0:151 1:151,A:11220466966;C:8305776940;G:9105878447;T:10668104948;N:1774557,151,151,,,11220466966,8305776940,9105878447,10668104948,1774557,SRX25290433,SRS21969150,SRA1922343,"Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics","Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics",2,0.89299,0.89318,0.11306,0.1139,0.74123,0.74345,0.45102,0.46093,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,Germany,2024-07-11,Undetermined,Undetermined,Thymus,Hematopoietic System
33161,SRR29791091,SRX25290432,SRS21969149,SRP519440,PRJNA1134759,Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2],GSE272064,Transcriptome Analysis,The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.,,,,Dr thymus foxn1+/+ rep3,GSM8392361,,source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1+/+|geo loc name:missing|collection date:missing,Dr thymus foxn1+/+ rep3,Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample,thymus,,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,tissue:thymus|cell type:thymus cells|genotype:foxn1+/+,GSM8392361,GSM8392361: Dr thymus foxn1+/+ rep3; Danio rerio; RNA Seq,GSM8392361 r1,GSM8392361,1,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP519440,,,BK3_R1.fastq.gz BK3_R2.fastq.gz,fastq fastq,37243022634.0,123321267.0,GSM8392361 r1,0:151 1:151,A:10858514997;C:7805630226;G:8359994769;T:10217208022;N:1674620,151,151,,,10858514997,7805630226,8359994769,10217208022,1674620,SRX25290432,SRS21969149,SRA1922343,"Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics","Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics",2,0.87732,0.87686,0.20353,0.20336,0.73261,0.7343,0.49192,0.4924,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,Germany,2024-07-11,Undetermined,Undetermined,Thymus,Hematopoietic System
33162,SRR29791092,SRX25290431,SRS21969148,SRP519440,PRJNA1134759,Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2],GSE272064,Transcriptome Analysis,The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.,,,,Dr thymus foxn1+/+ rep2,GSM8392360,,source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1+/+|geo loc name:missing|collection date:missing,Dr thymus foxn1+/+ rep2,Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample,thymus,,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,tissue:thymus|cell type:thymus cells|genotype:foxn1+/+,GSM8392360,GSM8392360: Dr thymus foxn1+/+ rep2; Danio rerio; RNA Seq,GSM8392360 r1,GSM8392360,1,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP519440,,,BK2_R1.fastq.gz BK2_R2.fastq.gz,fastq fastq,34154139756.0,113093178.0,GSM8392360 r1,0:151 1:151,A:9754575779;C:7198913431;G:7834944597;T:9364172876;N:1533073,151,151,,,9754575779,7198913431,7834944597,9364172876,1533073,SRX25290431,SRS21969148,SRA1922343,"Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics","Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics",2,0.87955,0.88145,0.18817,0.18856,0.72707,0.72839,0.49921,0.49737,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,Germany,2024-07-11,Undetermined,Undetermined,Thymus,Hematopoietic System
33163,SRR29791093,SRX25290430,SRS21969147,SRP519440,PRJNA1134759,Developmental trajectory and evolutionary origin of thymic mimetic cells  [dataset 2],GSE272064,Transcriptome Analysis,The generation of self tolerant repertoires of T cells depends on the expression of peripheral self antigens in the thymic epithelium  and the presence of small populations of cells mimicking the diverse phenotypes of peripheral tissues. Whereas the molecular underpinnings of self antigen expression have been extensively studied  the developmental origins and differentiation pathways of thymic mimetic cells remain to be identified. Moreover  the histological identification of myoid and other peripheral cell types as components of the thymic microenvironment of many vertebrate species raises questions as to the evolutionary origin of this unique tolerance mechanism. Here  we show that during mouse development  mimetic cells appear in the microenvironment in two successive waves. Cells exhibiting transcriptional signatures characteristic of muscle  ionocyte  goblet and ciliated cells emerge before birth  whereas others  for instance those mimicking enterohepatic cells and skin keratinocytes appear postnatally. These two groups also respond differently to modulations of TEC progenitor pools caused by deletions of Foxn1 and Ascl1  expression of a hypomorphic Foxn1 transcription factor  and overexpression of Bmp4 and Fgf7 signalling molecules. Differences in mimetic cell populations were also observed in thymic microenvironments reconstructed by replacement of mouse Foxn1 with evolutionarily ancient Foxn1/4 gene family members  including the Foxn4 gene of the cephalochordate amphioxus  and the Foxn4 and Foxn1 genes of a cartilaginous fish. Whereas some cell types  such as ciliated cells  develop in the thymus in the absence of Foxn1  mimetic cells appearing postnatally  such as enterohepatic cells  require the activity of the vertebrate specific transcription factor Foxn1. The thymus of cartilaginous fishes and the thymoid of lampreys  a representative of jawless vertebrates that exhibit an alternative adaptive immune system  also harbour cells expressing genes encoding peripheral tissue components  such as the liver specific protein transthyretin. Our findings suggest an evolutionary model of successive changes of thymic epithelial genetic networks enabling the coordinated contribution of peripheral antigen expression and mimetic cell formation to achieve central tolerance for vertebrate specific innovations of certain tissues  such as the liver. Overall design: Cells from whole thymic tissue from zebrafish were prepared  and subjected to bulk RNAseq. Foxn1+/+  samples and foxn1 /  samples were sequenced.,,,,Dr thymus foxn1+/+ rep1,GSM8392359,,source name:thymus|tissue:thymus|cell type:thymus cells|genotype:foxn1+/+|geo loc name:missing|collection date:missing,Dr thymus foxn1+/+ rep1,Transcriptomes were analyzed on the Galaxy platform. Adapters were trimmed with TrimGalore! version 0.4.3.1. Reads were aligned to the reference genome with Hisat2  version 2.1.0. Counts were generated with featureCounts version 1.6.1.0. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files containing raw counts for each sample,thymus,,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,tissue:thymus|cell type:thymus cells|genotype:foxn1+/+,GSM8392359,GSM8392359: Dr thymus foxn1+/+ rep1; Danio rerio; RNA Seq,GSM8392359 r1,GSM8392359,1,Thymus tissue was explanted and placed into TRI reagent Sigma Aldrich. RNA was extracted following standard protocols. Each library consists of a pool of RNA from 3 animals. Libraries were constructed with the NEBNext Low Input RNA Library Preparation kit. Library preparation was carried out by the Deep Sequencing core facility at the Max Planck Institute for Immunobiology and Epigenetics according to their standard protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP519440,,,BK1_R2.fastq.gz BK1_R1.fastq.gz,fastq fastq,48045652026.0,159091563.0,GSM8392359 r1,0:151 1:151,A:13986882382;C:9969611893;G:10712447624;T:13374538759;N:2171368,151,151,,,13986882382,9969611893,10712447624,13374538759,2171368,SRX25290430,SRS21969147,SRA1922343,"Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics","Boehm, Developmental Immunology, Max Planck Institute for Immunobiology and Epigenetics",2,0.87379,0.87656,0.21786,0.2191,0.73815,0.73975,0.49869,0.49808,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,Germany,2024-07-11,Undetermined,Undetermined,Thymus,Hematopoietic System
47869,SRR6908743,SRX3856808,SRS3100400,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM9 eosinophils,GSM3070146,,tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM9 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM9 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070146,GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq,GSM3070146,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070146,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM9_eosinophils_L001_R1_001.fastq.gz WKM9_eosinophils_L001_R2_001.fastq.gz,fastq fastq,1378279915.0,9133302.0,GSM3070146 r1,0:75.43 1:75.48,A:398409215;C:214050926;G:243007260;T:522806293;N:6221,75,75,,,398409215,214050926,243007260,522806293,6221,SRX3856808,SRS3100400,SRA675960,GEO,Hubrecht Institute,2,0.32967,0.72245,0.27664,0.49284,0.96217,0.88688,0.44743,0.5676,76,73,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47870,SRR6908744,SRX3856808,SRS3100400,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM9 eosinophils,GSM3070146,,tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM9 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM9 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070146,GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq,GSM3070146,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070146,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM9_eosinophils_L002_R1_001.fastq.gz WKM9_eosinophils_L002_R2_001.fastq.gz,fastq fastq,1347027331.0,8926023.0,GSM3070146 r2,0:75.43 1:75.48,A:386373331;C:208319487;G:242442973;T:509887930;N:3610,75,75,,,386373331,208319487,242442973,509887930,3610,SRX3856808,SRS3100400,SRA675960,GEO,Hubrecht Institute,2,0.32008,0.72405,0.26859,0.48848,0.96512,0.88791,0.46692,0.55937,76,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47871,SRR6908745,SRX3856808,SRS3100400,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM9 eosinophils,GSM3070146,,tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM9 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM9 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070146,GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq,GSM3070146,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070146,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM9_eosinophils_L003_R1_001.fastq.gz WKM9_eosinophils_L003_R2_001.fastq.gz,fastq fastq,1241011911.0,8223327.0,GSM3070146 r3,0:75.44 1:75.48,A:356514159;C:192418351;G:221034567;T:471023588;N:21246,75,75,,,356514159,192418351,221034567,471023588,21246,SRX3856808,SRS3100400,SRA675960,GEO,Hubrecht Institute,2,0.31504,0.71934,0.26517,0.48722,0.96932,0.89499,0.47715,0.56814,76,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47872,SRR6908746,SRX3856808,SRS3100400,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM9 eosinophils,GSM3070146,,tissue:WKM9 eosinophils|FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM9 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM9 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM9|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070146,GSM3070146: WKM9 eosinophils; Danio rerio; RNA Seq,GSM3070146,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070146,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM9_eosinophils_L004_R1_001.fastq.gz WKM9_eosinophils_L004_R2_001.fastq.gz,fastq fastq,1199788386.0,7950347.0,GSM3070146 r4,0:75.44 1:75.47,A:343966384;C:184985849;G:216629920;T:454187010;N:19223,75,75,,,343966384,184985849,216629920,454187010,19223,SRX3856808,SRS3100400,SRA675960,GEO,Hubrecht Institute,2,0.32136,0.71802,0.27107,0.48741,0.97098,0.90057,0.4616,0.56009,76,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47917,SRR6908693,SRX3856796,SRS3100388,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM4 eosinophils,GSM3070134,,tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM4 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM4 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070134,GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq,GSM3070134,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070134,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM4_eosinophils_L001_R1_001.fastq.gz WKM4_eosinophils_L001_R2_001.fastq.gz,fastq fastq,1044383799.0,6918578.0,GSM3070134 r1,0:75.49 1:75.46,A:293266328;C:159927306;G:179144897;T:412003143;N:42125,75,75,,,293266328,159927306,179144897,412003143,42125,SRX3856796,SRS3100388,SRA675960,GEO,Hubrecht Institute,2,0.38953,0.76677,0.33438,0.55076,0.94775,0.83664,0.47684,0.51667,75,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47918,SRR6908694,SRX3856796,SRS3100388,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM4 eosinophils,GSM3070134,,tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM4 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM4 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070134,GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq,GSM3070134,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070134,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM4_eosinophils_L002_R1_001.fastq.gz WKM4_eosinophils_L002_R2_001.fastq.gz,fastq fastq,1065518294.0,7059081.0,GSM3070134 r2,0:75.49 1:75.45,A:299578147;C:162208243;G:185866185;T:417812882;N:52837,75,75,,,299578147,162208243,185866185,417812882,52837,SRX3856796,SRS3100388,SRA675960,GEO,Hubrecht Institute,2,0.36825,0.75817,0.3148,0.55624,0.95061,0.84794,0.47713,0.52081,76,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47919,SRR6908695,SRX3856796,SRS3100388,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM4 eosinophils,GSM3070134,,tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM4 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM4 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070134,GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq,GSM3070134,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070134,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM4_eosinophils_L003_R1_001.fastq.gz WKM4_eosinophils_L003_R2_001.fastq.gz,fastq fastq,1020526841.0,6760661.0,GSM3070134 r3,0:75.50 1:75.45,A:287644655;C:155831653;G:174910820;T:402133481;N:6232,75,75,,,287644655,155831653,174910820,402133481,6232,SRX3856796,SRS3100388,SRA675960,GEO,Hubrecht Institute,2,0.38266,0.76495,0.32861,0.55487,0.94909,0.84502,0.47881,0.50844,76,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47920,SRR6908696,SRX3856796,SRS3100388,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM4 eosinophils,GSM3070134,,tissue:WKM4 eosinophils|FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM4 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM4 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM4|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070134,GSM3070134: WKM4 eosinophils; Danio rerio; RNA Seq,GSM3070134,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070134,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM4_eosinophils_L004_R2_001.fastq.gz WKM4_eosinophils_L004_R1_001.fastq.gz,fastq fastq,1036249497.0,6864317.0,GSM3070134 r4,0:75.50 1:75.46,A:290241796;C:157806083;G:180760457;T:407436042;N:5119,75,75,,,290241796,157806083,180760457,407436042,5119,SRX3856796,SRS3100388,SRA675960,GEO,Hubrecht Institute,2,0.38456,0.76284,0.32829,0.54843,0.9497,0.84668,0.48302,0.51789,76,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47925,SRR6908685,SRX3856794,SRS3100386,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM3 eosinophils,GSM3070132,,tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM3 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM3 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070132,GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq,GSM3070132,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070132,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM3_eosinophils_L001_R1_001.fastq.gz WKM3_eosinophils_L001_R2_001.fastq.gz,fastq fastq,1288630538.0,8538558.0,GSM3070132 r1,0:75.44 1:75.48,A:384649233;C:189860338;G:186795029;T:527108032;N:217906,75,75,,,384649233,189860338,186795029,527108032,217906,SRX3856794,SRS3100386,SRA675960,GEO,Hubrecht Institute,2,0.38213,0.80648,0.32,0.39443,0.96749,0.92997,0.49763,0.55351,75,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47926,SRR6908686,SRX3856794,SRS3100386,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM3 eosinophils,GSM3070132,,tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM3 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM3 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070132,GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq,GSM3070132,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070132,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM3_eosinophils_L002_R1_001.fastq.gz WKM3_eosinophils_L002_R2_001.fastq.gz,fastq fastq,1176806695.0,7797829.0,GSM3070132 r2,0:75.44 1:75.48,A:349406324;C:172751257;G:173925861;T:480558924;N:164329,75,75,,,349406324,172751257,173925861,480558924,164329,SRX3856794,SRS3100386,SRA675960,GEO,Hubrecht Institute,2,0.3792,0.81293,0.31911,0.39312,0.96834,0.93176,0.52878,0.54431,75,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47927,SRR6908687,SRX3856794,SRS3100386,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM3 eosinophils,GSM3070132,,tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM3 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM3 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070132,GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq,GSM3070132,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070132,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM3_eosinophils_L003_R1_001.fastq.gz WKM3_eosinophils_L003_R2_001.fastq.gz,fastq fastq,1341470236.0,8888024.0,GSM3070132 r3,0:75.45 1:75.48,A:395746232;C:196893713;G:196590339;T:552105050;N:134902,75,75,,,395746232,196893713,196590339,552105050,134902,SRX3856794,SRS3100386,SRA675960,GEO,Hubrecht Institute,2,0.38231,0.81774,0.3205,0.39891,0.97279,0.92817,0.47656,0.53862,75,74,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47928,SRR6908688,SRX3856794,SRS3100386,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM3 eosinophils,GSM3070132,,tissue:WKM3 eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM3 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM3 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070132,GSM3070132: WKM3 eosinophils; Danio rerio; RNA Seq,GSM3070132,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070132,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM3_eosinophils_L004_R1_001.fastq.gz WKM3_eosinophils_L004_R2_001.fastq.gz,fastq fastq,1280409546.0,8484656.0,GSM3070132 r4,0:75.44 1:75.47,A:378449241;C:186686350;G:189951619;T:525218711;N:103625,75,75,,,378449241,186686350,189951619,525218711,103625,SRX3856794,SRS3100386,SRA675960,GEO,Hubrecht Institute,2,0.36531,0.80793,0.30661,0.38147,0.97492,0.94401,0.47223,0.55437,76,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47929,SRR6908681,SRX3856793,SRS3100385,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM3 classicalgate eosinophils,GSM3070131,,tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,WKM3 classicalgate eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM3 classicalgate eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,GSM3070131,GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq,GSM3070131,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070131,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM3_classicalgate-eosinophils_L001_R1_001.fastq.gz WKM3_classicalgate-eosinophils_L001_R2_001.fastq.gz,fastq fastq,1462702668.0,9694435.0,GSM3070131 r1,0:75.42 1:75.46,A:445709472;C:205316750;G:205641600;T:605784979;N:249867,75,75,,,445709472,205316750,205641600,605784979,249867,SRX3856793,SRS3100385,SRA675960,GEO,Hubrecht Institute,2,0.39724,0.82292,0.32577,0.36062,0.9713,0.9301,0.46129,0.54716,75,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47930,SRR6908682,SRX3856793,SRS3100385,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM3 classicalgate eosinophils,GSM3070131,,tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,WKM3 classicalgate eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM3 classicalgate eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,GSM3070131,GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq,GSM3070131,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070131,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM3_classicalgate-eosinophils_L002_R2_001.fastq.gz WKM3_classicalgate-eosinophils_L002_R1_001.fastq.gz,fastq fastq,1331127146.0,8822708.0,GSM3070131 r2,0:75.42 1:75.45,A:403738285;C:185977311;G:190160316;T:551055048;N:196186,75,75,,,403738285,185977311,190160316,551055048,196186,SRX3856793,SRS3100385,SRA675960,GEO,Hubrecht Institute,2,0.39004,0.81794,0.32291,0.35472,0.97228,0.93626,0.48683,0.54607,76,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47931,SRR6908683,SRX3856793,SRS3100385,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM3 classicalgate eosinophils,GSM3070131,,tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,WKM3 classicalgate eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM3 classicalgate eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,GSM3070131,GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq,GSM3070131,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070131,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM3_classicalgate-eosinophils_L003_R2_001.fastq.gz WKM3_classicalgate-eosinophils_L003_R1_001.fastq.gz,fastq fastq,1530092022.0,10140266.0,GSM3070131 r3,0:75.43 1:75.46,A:460384140;C:214158501;G:217473146;T:637914633;N:161602,75,75,,,460384140,214158501,217473146,637914633,161602,SRX3856793,SRS3100385,SRA675960,GEO,Hubrecht Institute,2,0.39487,0.82643,0.32278,0.35403,0.97555,0.92989,0.49836,0.55498,75,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47932,SRR6908684,SRX3856793,SRS3100385,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM3 classicalgate eosinophils,GSM3070131,,tissue:WKM3 classicalgate eosinophils|FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,WKM3 classicalgate eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM3 classicalgate eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM3|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,GSM3070131,GSM3070131: WKM3 classicalgate eosinophils; Danio rerio; RNA Seq,GSM3070131,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070131,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM3_classicalgate-eosinophils_L004_R1_001.fastq.gz WKM3_classicalgate-eosinophils_L004_R2_001.fastq.gz,fastq fastq,1434145773.0,9505626.0,GSM3070131 r4,0:75.43 1:75.45,A:431807112;C:200115802;G:205473991;T:596630601;N:118267,75,75,,,431807112,200115802,205473991,596630601,118267,SRX3856793,SRS3100385,SRA675960,GEO,Hubrecht Institute,2,0.38268,0.82073,0.31346,0.34043,0.97678,0.94172,0.45791,0.5661,75,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47937,SRR6908673,SRX3856790,SRS3100384,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM2 eosinophils,GSM3070129,,tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM2 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM2 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070129,GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq,GSM3070129,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070129,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM2_eosinophils_L001_R1_001.fastq.gz WKM2_eosinophils_L001_R2_001.fastq.gz,fastq fastq,1444176720.0,9566997.0,GSM3070129 r1,0:75.46 1:75.50,A:432764637;C:224282941;G:222436448;T:564444426;N:248268,75,75,,,432764637,224282941,222436448,564444426,248268,SRX3856790,SRS3100384,SRA675960,GEO,Hubrecht Institute,2,0.37168,0.75194,0.32262,0.52753,0.95915,0.94073,0.51621,0.55453,76,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47938,SRR6908674,SRX3856790,SRS3100384,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM2 eosinophils,GSM3070129,,tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM2 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM2 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070129,GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq,GSM3070129,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070129,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM2_eosinophils_L002_R1_001.fastq.gz WKM2_eosinophils_L002_R2_001.fastq.gz,fastq fastq,1320784826.0,8749678.0,GSM3070129 r2,0:75.45 1:75.50,A:392835077;C:204358703;G:208201633;T:515202839;N:186574,75,75,,,392835077,204358703,208201633,515202839,186574,SRX3856790,SRS3100384,SRA675960,GEO,Hubrecht Institute,2,0.36921,0.73955,0.32271,0.52168,0.96047,0.94643,0.49733,0.53116,76,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47939,SRR6908675,SRX3856790,SRS3100384,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM2 eosinophils,GSM3070129,,tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM2 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM2 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070129,GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq,GSM3070129,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070129,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM2_eosinophils_L003_R2_001.fastq.gz WKM2_eosinophils_L003_R1_001.fastq.gz,fastq fastq,1500143635.0,9937133.0,GSM3070129 r3,0:75.46 1:75.50,A:445152171;C:231621688;G:233127317;T:590090278;N:152181,75,75,,,445152171,231621688,233127317,590090278,152181,SRX3856790,SRS3100384,SRA675960,GEO,Hubrecht Institute,2,0.36533,0.75138,0.31769,0.52682,0.96731,0.94209,0.50569,0.54346,76,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47940,SRR6908676,SRX3856790,SRS3100384,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM2 eosinophils,GSM3070129,,tissue:WKM2 eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils,WKM2 eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM2 eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:eosinophils,GSM3070129,GSM3070129: WKM2 eosinophils; Danio rerio; RNA Seq,GSM3070129,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070129,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM2_eosinophils_L004_R1_001.fastq.gz WKM2_eosinophils_L004_R2_001.fastq.gz,fastq fastq,1428668507.0,9464755.0,GSM3070129 r4,0:75.46 1:75.49,A:423108347;C:219338398;G:226517917;T:559587502;N:116343,75,75,,,423108347,219338398,226517917,559587502,116343,SRX3856790,SRS3100384,SRA675960,GEO,Hubrecht Institute,2,0.35962,0.7405,0.31464,0.51805,0.96962,0.95747,0.48862,0.53364,76,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47941,SRR6908669,SRX3856789,SRS3100381,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM2 classicalgate eosinophils,GSM3070128,,tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,WKM2 classicalgate eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM2 classicalgate eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,GSM3070128,GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq,GSM3070128,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070128,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM2_classicalgate-eosinophils_L001_R2_001.fastq.gz WKM2_classicalgate-eosinophils_L001_R1_001.fastq.gz,fastq fastq,880478792.0,5834816.0,GSM3070128 r1,0:75.43 1:75.47,A:267072322;C:127440559;G:126304290;T:359512123;N:149498,75,75,,,267072322,127440559,126304290,359512123,149498,SRX3856789,SRS3100381,SRA675960,GEO,Hubrecht Institute,2,0.3788,0.812,0.28918,0.38972,0.96595,0.92904,0.5376,0.55651,75,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47942,SRR6908670,SRX3856789,SRS3100381,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM2 classicalgate eosinophils,GSM3070128,,tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,WKM2 classicalgate eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM2 classicalgate eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,GSM3070128,GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq,GSM3070128,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070128,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM2_classicalgate-eosinophils_L002_R1_001.fastq.gz WKM2_classicalgate-eosinophils_L002_R2_001.fastq.gz,fastq fastq,806110283.0,5342262.0,GSM3070128 r2,0:75.42 1:75.47,A:243426891;C:116100169;G:117840212;T:328625621;N:117390,75,75,,,243426891,116100169,117840212,328625621,117390,SRX3856789,SRS3100381,SRA675960,GEO,Hubrecht Institute,2,0.38141,0.80952,0.29221,0.37995,0.96546,0.93381,0.54149,0.55378,75,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47943,SRR6908671,SRX3856789,SRS3100381,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM2 classicalgate eosinophils,GSM3070128,,tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,WKM2 classicalgate eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM2 classicalgate eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,GSM3070128,GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq,GSM3070128,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070128,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM2_classicalgate-eosinophils_L003_R1_001.fastq.gz WKM2_classicalgate-eosinophils_L003_R2_001.fastq.gz,fastq fastq,924045470.0,6123105.0,GSM3070128 r3,0:75.44 1:75.47,A:276824263;C:133108077;G:134012420;T:380008370;N:92340,75,75,,,276824263,133108077,134012420,380008370,92340,SRX3856789,SRS3100381,SRA675960,GEO,Hubrecht Institute,2,0.3819,0.81801,0.29161,0.38224,0.97124,0.92809,0.53982,0.54629,76,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
47944,SRR6908672,SRX3856789,SRS3100381,SRP136633,PRJNA446034,Cell type purification by single cell transcriptome trained sorting,GSE112438,Other,Traditional cell type enrichment using fluorescence activated cell sorting FACS relies on methods that specifically label the cell type of interest. Here we propose GateID  a computational method that combines single cell transcriptomics  for unbiased cell type identification  with FACS index sorting  to purify cell types of choice. We validate GateID by purifying various cell types from the zebrafish kidney marrow and the human pancreas without xxx to specific antibodies or transgenes. Overall design: Single cell mRNA sequencing data of unenriched and enriched cells from zebrafish whole kidney marrow and human pancreas using GateID. For each cell  we provide libraries with transcriptome information. An unenriched sample is transcriptome data from a live single cell FACS sort  while an enriched library has transcriptome data for GateID enriched single cells for a given cell type.,,pubmed:31585086,,WKM2 classicalgate eosinophils,GSM3070128,,tissue:WKM2 classicalgate eosinophils|FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,WKM2 classicalgate eosinophils,In transcriptome libraries  first read contains UMI 6 first nucleotides and cell barcode from 7 to 14 nucleotides and second reads contains biological information. Second reads with a valid cell barcode in corresponding first read are mapped to the reference transcriptome. Multimappers are not considered as valid. The cell specific barcode file is added as a part of processed data files. Genome build: All transcriptome libraries were mapped to Danio rerio assembly Zv9  ensemble 74  extended with ERCC92 Supplementary files format and content: Tabular separated files  with transcript count rows per cell columns. Cells in each file are labeled according to barcode ID. The cell specific barcode file is provided in the celseq2 bc.csv.gz  1st column represents index of the cell specific barcode  and the second column is the barcode,WKM2 classicalgate eosinophils,,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,,FISHid:WKM2|cell type:whole kidney marrow single cells|cell subtype:classicalgate eosinophils,GSM3070128,GSM3070128: WKM2 classicalgate eosinophils; Danio rerio; RNA Seq,GSM3070128,,1,post organ isolation  live single cells are sorted into 384 well plates containing mineral oil  uniquely barcoded cell specific primers for mRNA detection  Spike in controls and and RNAse inhibitor. cellseq2 Illumina TruSeq adapaters,GEO Accession:GSM3070128,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP136633,,,WKM2_classicalgate-eosinophils_L004_R1_001.fastq.gz WKM2_classicalgate-eosinophils_L004_R2_001.fastq.gz,fastq fastq,867397884.0,5748519.0,GSM3070128 r4,0:75.43 1:75.46,A:260294749;C:124376674;G:127341359;T:355314902;N:70200,75,75,,,260294749,124376674,127341359,355314902,70200,SRX3856789,SRS3100381,SRA675960,GEO,Hubrecht Institute,2,0.37148,0.80708,0.28632,0.3846,0.97299,0.94474,0.5375,0.54419,76,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,random_priming,trueseq,sc,single_cell_plate,celseq,,Netherlands,2018-03-28,Undetermined,Undetermined,Blood,Hematopoietic System
59515,SRR11926689,SRX8472335,SRS6772936,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,WT5,GSM4591370,,tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,WT5,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy sorted  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,GSM4591370,GSM4591370: WT5; Danio rerio; RNA Seq,GSM4591370,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591370,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,FWTsample_5.fastq.gz FWTsample_5_R2.fastq.gz,fastq fastq,4633582858.0,22938529.0,GSM4591370 r1,0:101 1:101,A:1263929939;C:1047240206;G:1052800791;T:1263574247;N:6037675,101,101,,,1263929939,1047240206,1052800791,1263574247,6037675,SRX8472335,SRS6772936,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.91347,0.91728,0.27187,0.27409,0.76585,0.76859,0.45662,0.48071,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59516,SRR11926688,SRX8472334,SRS6772935,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,WT4,GSM4591369,,tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,WT4,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy sorted  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,GSM4591369,GSM4591369: WT4; Danio rerio; RNA Seq,GSM4591369,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591369,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,FWTsample_4.fastq.gz FWTsample_4_R2.fastq.gz,fastq fastq,4113149600.0,20565748.0,GSM4591369 r1,0:100 1:100,A:1084628064;C:963840734;G:985823964;T:1078691018;N:165820,100,100,,,1084628064,963840734,985823964,1078691018,165820,SRX8472334,SRS6772935,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.9336,0.93539,0.11919,0.11989,0.76368,0.76757,0.4904,0.47498,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59517,SRR11926687,SRX8472333,SRS6772934,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,WT3,GSM4591368,,tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,WT3,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy sorted  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,GSM4591368,GSM4591368: WT3; Danio rerio; RNA Seq,GSM4591368,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591368,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,FWTsample_3_R2.fastq.gz FWTsample_3.fastq.gz,fastq fastq,3966667200.0,19833336.0,GSM4591368 r1,0:100 1:100,A:1125938234;C:857622800;G:856236104;T:1122434590;N:4435472,100,100,,,1125938234,857622800,856236104,1122434590,4435472,SRX8472333,SRS6772934,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.93918,0.92495,0.16292,0.15907,0.75866,0.76883,0.51794,0.51278,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59518,SRR11926686,SRX8472332,SRS6772933,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,WT2,GSM4591367,,tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,WT2,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy sorted  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,GSM4591367,GSM4591367: WT2; Danio rerio; RNA Seq,GSM4591367,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591367,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,FWTsample_2_R2.fastq.gz FWTsample_2.fastq.gz,fastq fastq,3598961400.0,17994807.0,GSM4591367 r1,0:100 1:100,A:982353707;C:818188790;G:810911943;T:983465623;N:4041337,100,100,,,982353707,818188790,810911943,983465623,4041337,SRX8472332,SRS6772933,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.93426,0.9195,0.12591,0.12501,0.76763,0.77621,0.49491,0.50063,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59519,SRR11926685,SRX8472331,SRS6772932,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,WT1,GSM4591366,,tissue:Healthy sorted thymus|cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,WT1,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy sorted  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tglck:GFP|tumor stg:healthy|lab of sample collection and sequencing:Frazer lab,GSM4591366,GSM4591366: WT1; Danio rerio; RNA Seq,GSM4591366,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591366,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,FWTsample_1_R2.fastq.gz FWTsample_1.fastq.gz,fastq fastq,3686706000.0,18433530.0,GSM4591366 r1,0:100 1:100,A:1004954280;C:838347690;G:833756041;T:1005493425;N:4154564,100,100,,,1004954280,838347690,833756041,1005493425,4154564,SRX8472331,SRS6772932,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.93171,0.91783,0.13677,0.13606,0.76723,0.7752,0.51062,0.50949,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59520,SRR11926684,SRX8472330,SRS6772931,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,SPL002,GSM4591365,,tissue:shrek preleukemic thymocytes|cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,SPL002,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,shrek preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591365,GSM4591365: SPL002; Danio rerio; RNA Seq,GSM4591365,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591365,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_48.fastq.gz Fsample_48_R2.fastq.gz,fastq fastq,23525993582.0,77900641.0,GSM4591365 r1,0:151 1:151,A:6365057472;C:5454588670;G:5620997543;T:6082859005;N:2490892,151,151,,,6365057472,5454588670,5620997543,6082859005,2490892,SRX8472330,SRS6772931,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.96011,0.96113,0.23076,0.22681,0.80858,0.81221,0.52577,0.51928,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59521,SRR11926683,SRX8472329,SRS6772930,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,SPL001,GSM4591364,,tissue:shrek preleukemic thymocytes|cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,SPL001,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,shrek preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:shrek;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591364,GSM4591364: SPL001; Danio rerio; RNA Seq,GSM4591364,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591364,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_47.fastq.gz Fsample_47_R2.fastq.gz,fastq fastq,26795594770.0,88727135.0,GSM4591364 r1,0:151 1:151,A:7305822132;C:6082789601;G:6442162847;T:6961938191;N:2881999,151,151,,,7305822132,6082789601,6442162847,6961938191,2881999,SRX8472329,SRS6772930,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.96139,0.96343,0.22215,0.2185,0.81296,0.81647,0.50868,0.51446,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59532,SRR11926672,SRX8472318,SRS6772919,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,OPL4,GSM4591353,,tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,OPL4,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,otg preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591353,GSM4591353: OPL4; Danio rerio; RNA Seq,GSM4591353,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591353,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_36.fastq.gz Fsample_36_R2.fastq.gz,fastq fastq,4686865610.0,23202305.0,GSM4591353 r1,0:101 1:101,A:1290395271;C:1046629683;G:1049444449;T:1294288823;N:6107384,101,101,,,1290395271,1046629683,1049444449,1294288823,6107384,SRX8472318,SRS6772919,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.92236,0.92454,0.31359,0.31617,0.76625,0.76779,0.48273,0.47205,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59533,SRR11926671,SRX8472317,SRS6772918,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,OPL3,GSM4591352,,tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,OPL3,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,otg preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591352,GSM4591352: OPL3; Danio rerio; RNA Seq,GSM4591352,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591352,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_35_R2.fastq.gz Fsample_35.fastq.gz,fastq fastq,6253893538.0,30959869.0,GSM4591352 r1,0:101 1:101,A:1720308233;C:1397371474;G:1404797248;T:1723210472;N:8206111,101,101,,,1720308233,1397371474,1404797248,1723210472,8206111,SRX8472317,SRS6772918,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.93192,0.93318,0.35833,0.3632,0.78518,0.78788,0.48278,0.48009,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59534,SRR11926670,SRX8472316,SRS6772917,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,OPL2,GSM4591351,,tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,OPL2,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,otg preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591351,GSM4591351: OPL2; Danio rerio; RNA Seq,GSM4591351,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591351,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_34_R2.fastq.gz Fsample_34.fastq.gz,fastq fastq,5351903948.0,26494574.0,GSM4591351 r1,0:101 1:101,A:1442793834;C:1227325750;G:1233975738;T:1440891564;N:6917062,101,101,,,1442793834,1227325750,1233975738,1440891564,6917062,SRX8472316,SRS6772917,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.92964,0.93101,0.21706,0.2185,0.76497,0.76848,0.47634,0.48247,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59535,SRR11926669,SRX8472315,SRS6772916,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,OPL1,GSM4591350,,tissue:otg preleukemic thymocytes|cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,OPL1,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,otg preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:otg;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591350,GSM4591350: OPL1; Danio rerio; RNA Seq,GSM4591350,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591350,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_33.fastq.gz Fsample_33_R2.fastq.gz,fastq fastq,5499039536.0,27222968.0,GSM4591350 r1,0:101 1:101,A:1515036859;C:1226882670;G:1229198085;T:1520688016;N:7233906,101,101,,,1515036859,1226882670,1229198085,1520688016,7233906,SRX8472315,SRS6772916,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.92637,0.92762,0.31857,0.32243,0.76769,0.77116,0.46456,0.46584,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59546,SRR11926658,SRX8472304,SRS6772905,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,MPL3,GSM4591339,,tissue:hMYC preleukemic thymocytes|cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,MPL3,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,hMYC preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591339,GSM4591339: MPL3; Danio rerio; RNA Seq,GSM4591339,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591339,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_21.fastq.gz Fsample_21_R2.fastq.gz,fastq fastq,8876009218.0,29390759.0,GSM4591339 r1,0:151 1:151,A:2397445782;C:2052027740;G:2018874313;T:2405562242;N:2099141,151,151,,,2397445782,2052027740,2018874313,2405562242,2099141,SRX8472304,SRS6772905,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.92414,0.9227,0.2461,0.23997,0.78841,0.79506,0.50203,0.5018,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59547,SRR11926657,SRX8472303,SRS6772904,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,MPL2,GSM4591338,,tissue:hMYC preleukemic thymocytes|cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,MPL2,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,hMYC preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591338,GSM4591338: MPL2; Danio rerio; RNA Seq,GSM4591338,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591338,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_20.fastq.gz Fsample_20_R2.fastq.gz,fastq fastq,8942441970.0,29610735.0,GSM4591338 r1,0:151 1:151,A:2434196467;C:2047066969;G:2021293350;T:2437752994;N:2132190,151,151,,,2434196467,2047066969,2021293350,2437752994,2132190,SRX8472303,SRS6772904,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.9147,0.91499,0.22028,0.2117,0.77713,0.78334,0.50243,0.49838,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59548,SRR11926656,SRX8472302,SRS6772903,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,MPL1,GSM4591337,,tissue:hMYC preleukemic thymocytes|cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,MPL1,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,hMYC preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tgrag2:hMYC  Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591337,GSM4591337: MPL1; Danio rerio; RNA Seq,GSM4591337,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591337,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_19.fastq.gz Fsample_19_R2.fastq.gz,fastq fastq,9778540144.0,32379272.0,GSM4591337 r1,0:151 1:151,A:2676504038;C:2223347787;G:2177506547;T:2698864055;N:2317717,151,151,,,2676504038,2223347787,2177506547,2698864055,2317717,SRX8472302,SRS6772903,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.91346,0.91413,0.29555,0.28893,0.79078,0.79825,0.49875,0.50518,151,151,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59549,SRR11926655,SRX8472301,SRS6772902,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,HPL3,GSM4591336,,tissue:hulk mutant preleukemic thymocytes|cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,HPL3,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,hulk mutant preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591336,GSM4591336: HPL3; Danio rerio; RNA Seq,GSM4591336,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591336,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_12.fastq.gz Fsample_12_R2.fastq.gz,fastq fastq,3378760800.0,16893804.0,GSM4591336 r1,0:100 1:100,A:869653801;C:820588210;G:823025653;T:861750769;N:3742367,100,100,,,869653801,820588210,823025653,861750769,3742367,SRX8472301,SRS6772902,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.93754,0.92151,0.17513,0.16969,0.79922,0.8071,0.63894,0.61913,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59550,SRR11926654,SRX8472300,SRS6772901,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,HPL2,GSM4591335,,tissue:hulk mutant preleukemic thymocytes|cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,HPL2,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,hulk mutant preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591335,GSM4591335: HPL2; Danio rerio; RNA Seq,GSM4591335,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591335,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_11.fastq.gz Fsample_11_R2.fastq.gz,fastq fastq,3276290400.0,16381452.0,GSM4591335 r1,0:100 1:100,A:909076954;C:730010076;G:728583319;T:904911154;N:3708897,100,100,,,909076954,730010076,728583319,904911154,3708897,SRX8472300,SRS6772901,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.93409,0.92023,0.18134,0.18141,0.78108,0.78981,0.53659,0.52431,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59551,SRR11926653,SRX8472299,SRS6772900,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,HPL1,GSM4591334,,tissue:hulk mutant preleukemic thymocytes|cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,HPL1,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,hulk mutant preleukemic thymocytes,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:hulk;Tglck:GFP|tumor stg:preleukemic|lab of sample collection and sequencing:Frazer lab,GSM4591334,GSM4591334: HPL1; Danio rerio; RNA Seq,GSM4591334,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591334,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 3000,,SRP265974,,,Fsample_10.fastq.gz Fsample_10_R2.fastq.gz,fastq fastq,3700727800.0,18503639.0,GSM4591334 r1,0:100 1:100,A:1028412839;C:821049620;G:815741395;T:1031399520;N:4124426,100,100,,,1028412839,821049620,815741395,1031399520,4124426,SRX8472299,SRS6772900,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",2,0.93381,0.92058,0.22321,0.22223,0.73655,0.74732,0.4822,0.48829,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59579,SRR11926625,SRX8472271,SRS6772872,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,AB thymus 9,GSM4591306,,tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,AB thymus 9,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy dissected  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,GSM4591306,GSM4591306: AB thymus 9; Danio rerio; RNA Seq,GSM4591306,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591306,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP265974,,,sample_6.fastq.gz,fastq,2786385619.0,36888152.0,GSM4591306 r1,0:75.54 1:0,A:663089588;C:692060734;G:651825670;T:779197417;N:212210,75,0,,,663089588,692060734,651825670,779197417,212210,SRX8472271,SRS6772872,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",1,0.94942,,0.05717,,0.73018,,0.49009,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59580,SRR11926624,SRX8472270,SRS6772871,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,AB thymus 8,GSM4591305,,tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,AB thymus 8,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy dissected  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,GSM4591305,GSM4591305: AB thymus 8; Danio rerio; RNA Seq,GSM4591305,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591305,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP265974,,,sample_5.fastq.gz,fastq,2456067469.0,32519095.0,GSM4591305 r1,0:75.53 1:0,A:606304745;C:594426559;G:556316196;T:698842180;N:177789,75,0,,,606304745,594426559,556316196,698842180,177789,SRX8472270,SRS6772871,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",1,0.94282,,0.08874,,0.70851,,0.49253,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59581,SRR11926623,SRX8472269,SRS6772870,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,AB thymus 7,GSM4591304,,tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,AB thymus 7,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy dissected  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,GSM4591304,GSM4591304: AB thymus 7; Danio rerio; RNA Seq,GSM4591304,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591304,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP265974,,,sample_4.fastq.gz,fastq,2889915115.0,38259114.0,GSM4591304 r1,0:75.54 1:0,A:694082728;C:713330573;G:669832103;T:812454853;N:214858,75,0,,,694082728,713330573,669832103,812454853,214858,SRX8472269,SRS6772870,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",1,0.94794,,0.06446,,0.72697,,0.49962,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59582,SRR11926622,SRX8472268,SRS6772869,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,AB thymus 2 3 5 6,GSM4591303,,tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,AB thymus 2 3 5 6,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy dissected  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,GSM4591303,GSM4591303: AB thymus 2 3 5 6; Danio rerio; RNA Seq,GSM4591303,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591303,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP265974,,,sample_3.fastq.gz,fastq,2338535479.0,30955998.0,GSM4591303 r1,0:75.54 1:0,A:540165709;C:595429439;G:553807340;T:648952381;N:180610,75,0,,,540165709,595429439,553807340,648952381,180610,SRX8472268,SRS6772869,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",1,0.94992,,0.04962,,0.73032,,0.4837,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59583,SRR11926621,SRX8472267,SRS6772868,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,AB thymus 11,GSM4591302,,tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,AB thymus 11,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy dissected  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,GSM4591302,GSM4591302: AB thymus 11; Danio rerio; RNA Seq,GSM4591302,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591302,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP265974,,,sample_2.fastq.gz,fastq,2942053849.0,38949737.0,GSM4591302 r1,0:75.53 1:0,A:688398915;C:734856328;G:694653408;T:823920342;N:224856,75,0,,,688398915,734856328,694653408,823920342,224856,SRX8472267,SRS6772868,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",1,0.94862,,0.06975,,0.72224,,0.49305,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
59584,SRR11926620,SRX8472266,SRS6772867,SRP265974,PRJNA637328,A novel TLX1 driven T ALL zebrafish model: comparative genomic analysis with other leukemia models,GSE151816,Transcriptome Analysis,We generated a new rag2 TLX1 driven T ALL model in zebrafish. RNA sequencing was preformed on the developed TLX1 T ALLs sequencing performed in the Speleman lab. In addition  RNA sequencing was performed on various additional zebrafish T ALL models shrek  hulk  otg  hMYC  sequenced in the Frazer lab to look at the molecular differences between the various existing T ALL models. Overall design: RNA sequencing data from TLX1  shrek  hulk  otg T ALL samples  wild type thymocytes sequenced in the Speleman lab  wild type thymocytes sequenced in the Frazer lab. Shrek  otg  hulk  hMYC preleukemic thymocytes,,pubmed:32591643,,AB thymus 10,GSM4591301,,tissue:Healthy dissected thymus|cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,AB thymus 10,First read of Fastq files were aligned to GRCz10 using STARv2.4.2a with esembl GRCz10.91.gtf as guide Counts to GRCz10.91.gtf were generated on the fly by STAR Genome build: GRCz10 Supplementary files format and content: txt file with raw counts,Healthy dissected  thymus,,Truseq stranded mRNA library prep illumina  #20020594,,cell type:thymocytes|genotype:Tgrag2:GFP|tumor stg:healthy|lab of sample collection and sequencing:Speleman lab,GSM4591301,GSM4591301: AB thymus 10; Danio rerio; RNA Seq,GSM4591301,,1,Truseq stranded mRNA library prep illumina  #20020594,GEO Accession:GSM4591301,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP265974,,,sample_1.fastq.gz,fastq,2923525817.0,38707354.0,GSM4591301 r1,0:75.53 1:0,A:697204107;C:721945575;G:689048693;T:815100976;N:226466,75,0,,,697204107,721945575,689048693,815100976,226466,SRX8472266,SRS6772867,SRA1083220,GEO,"Center for Medical Genetics, Ghent University",1,0.94964,,0.05377,,0.71904,,0.4902,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Belgium,2020-06-04,Undetermined,Undetermined,Thymus,Hematopoietic System
63895,SRR14213371,SRX10579916,SRS8684384,SRP314470,PRJNA721381,RNA Seq from zebrafish adult tissues,GSE171906,Transcriptome Analysis,The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.,,pubmed:34556579,,Spleen3,GSM5237140,,source name:zebrafish spleen|genotype:wild type|tissue:spleen|strain:TLAB,Spleen3,Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 102. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM,zebrafish spleen,,Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle,genotype:wild type|tissue:spleen|strain:TLAB,GSM5237140,GSM5237140: Spleen3; Danio rerio; RNA Seq,GSM5237140,,1,Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina,GEO Accession:GSM5237140,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP314470,,,Spleen3.fastq,fastq,2469245600.0,24692456.0,GSM5237140 r1,0:100,A:595265067;C:649103304;G:625399353;T:599383209;N:94667,100,,,,595265067,649103304,625399353,599383209,94667,SRX10579916,SRS8684384,SRA1217576,GEO,"Pauli lab, Research Institute of Molecular Pathology",1,0.9388,,0.16508,,0.75205,,0.59719,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,Austria,2021-04-12,Undetermined,Undetermined,Spleen,Hematopoietic System
63896,SRR14213370,SRX10579915,SRS8684383,SRP314470,PRJNA721381,RNA Seq from zebrafish adult tissues,GSE171906,Transcriptome Analysis,The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.,,pubmed:34556579,,Spleen2,GSM5237139,,source name:zebrafish spleen|genotype:wild type|tissue:spleen|strain:TLAB,Spleen2,Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 102. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM,zebrafish spleen,,Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle,genotype:wild type|tissue:spleen|strain:TLAB,GSM5237139,GSM5237139: Spleen2; Danio rerio; RNA Seq,GSM5237139,,1,Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina,GEO Accession:GSM5237139,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP314470,,,Spleen2.fastq,fastq,1372663100.0,13726631.0,GSM5237139 r1,0:100,A:303080845;C:392345861;G:369765807;T:307418421;N:52166,100,,,,303080845,392345861,369765807,307418421,52166,SRX10579915,SRS8684383,SRA1217576,GEO,"Pauli lab, Research Institute of Molecular Pathology",1,0.96541,,0.18478,,0.78565,,0.60522,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,Austria,2021-04-12,Undetermined,Undetermined,Spleen,Hematopoietic System
63897,SRR14213369,SRX10579914,SRS8684382,SRP314470,PRJNA721381,RNA Seq from zebrafish adult tissues,GSE171906,Transcriptome Analysis,The goal of this study was to profile transcript expression levels across zebrafish adult tissues. Overall design: Transcriptome profiles of nine zebrafish adult tissues. Every tissue contains triplicates.,,pubmed:34556579,,Spleen1,GSM5237138,,source name:zebrafish spleen|genotype:wild type|tissue:spleen|strain:TLAB,Spleen1,Libraries were  sequenced on a Illumina Hiseq 2500 on SR100 mode BAM files containing sequencing reads were converted to fastq files using samtools v1.9 Barcoded libraries were demultiplexed using fastx toolkit v0.0.14 Sequencing adapters were trimmed with cutadapt v1.18 and only reads longer than 25 bases were kept Reads were aligned to GRCz11 with Hisat2 v2.1.0  using the Ensembl transcriptome release 102. The following parameters were used: hisat2  q   dta   rna strandness R  k 12   no unal Quantification at the gene level to obtain transcript per million TPM was perfomed using Kallisto v0.43.0 Genome build: GRCz11 Supplementary files format and content: Tab delimited files containing TPM,zebrafish spleen,,Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle,genotype:wild type|tissue:spleen|strain:TLAB,GSM5237138,GSM5237138: Spleen1; Danio rerio; RNA Seq,GSM5237138,,1,Total RNA was extracted using the standard TRIzol Invitrogen protocol. To obtain polyA+ RNA  the polyA selection kit from LEXOGEN was used. Strand specific cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina and indexed with NEBNext Multiplex Oligos for Illumina,GEO Accession:GSM5237138,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP314470,,,Spleen1.fastq,fastq,2268815600.0,22688156.0,GSM5237138 r1,0:100,A:570901318;C:562128594;G:552921437;T:582778510;N:85741,100,,,,570901318,562128594,552921437,582778510,85741,SRX10579914,SRS8684382,SRA1217576,GEO,"Pauli lab, Research Institute of Molecular Pathology",1,0.93633,,0.14981,,0.72825,,0.52073,,100,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,Austria,2021-04-12,Undetermined,Undetermined,Spleen,Hematopoietic System
67908,SRR017341,SRX003632,SRS002067,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish N,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishN,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,N_fish.tar,fastq,40231384.0,173756.0,Zebrafish IgH cDNA FishN,0:4 1:227.54,A:10436935;C:8800020;G:9512025;T:11471941;N:10463,4,227,,,10436935,8800020,9512025,11471941,10463,SRX003632,SRS002067,SRA008134,Stanford University|Quake,Stanford University,1,0.26487,,0.0663,,0.99304,,0.01389,,229,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67909,SRR017340,SRX003631,SRS002066,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish M,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishM,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,M_fish.tar,fastq,37492198.0,161639.0,Zebrafish IgH cDNA FishM,0:4 1:227.95,A:9527141;C:8129088;G:9025760;T:10804127;N:6082,4,227,,,9527141,8129088,9025760,10804127,6082,SRX003631,SRS002066,SRA008134,Stanford University|Quake,Stanford University,1,0.31521,,0.11394,,0.99823,,0.00291,,208,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67910,SRR017339,SRX003630,SRS002065,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish L,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishL,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,L_fish.tar,fastq,37971443.0,163701.0,Zebrafish IgH cDNA FishL,0:4 1:227.96,A:9544875;C:8363123;G:9094601;T:10963684;N:5160,4,227,,,9544875,8363123,9094601,10963684,5160,SRX003630,SRS002065,SRA008134,Stanford University|Quake,Stanford University,1,0.29057,,0.07862,,0.99636,,0.00534,,245,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67911,SRR017338,SRX003629,SRS002064,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish K,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishK,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,K_fish.tar,fastq,54201403.0,234266.0,Zebrafish IgH cDNA FishK,0:4 1:227.37,A:13608677;C:11652239;G:12945164;T:15975205;N:20118,4,227,,,13608677,11652239,12945164,15975205,20118,SRX003629,SRS002064,SRA008134,Stanford University|Quake,Stanford University,1,0.27218,,0.07987,,0.99275,,0.01242,,244,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67912,SRR017337,SRX003628,SRS002063,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish J,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishJ,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,J_fish.tar,fastq,51915342.0,224027.0,Zebrafish IgH cDNA FishJ,0:4 1:227.74,A:12664582;C:12040983;G:12609762;T:14589770;N:10245,4,227,,,12664582,12040983,12609762,14589770,10245,SRX003628,SRS002063,SRA008134,Stanford University|Quake,Stanford University,1,0.29028,,0.10039,,0.9964,,0.00625,,97,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67913,SRR017336,SRX003627,SRS002062,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish I,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishI,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,I_fish.tar,fastq,23436268.0,100120.0,Zebrafish IgH cDNA FishI,0:4 1:230.08,A:5801823;C:5246438;G:5587169;T:6797624;N:3214,4,230,,,5801823,5246438,5587169,6797624,3214,SRX003627,SRS002062,SRA008134,Stanford University|Quake,Stanford University,1,0.34362,,0.0757,,0.99241,,0.02647,,232,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67914,SRR017335,SRX003626,SRS002061,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish H,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishH,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,H_fish.tar,fastq,48443452.0,213531.0,Zebrafish IgH cDNA FishH,0:4 1:222.87,A:12720681;C:10490855;G:11923926;T:13303989;N:4001,4,222,,,12720681,10490855,11923926,13303989,4001,SRX003626,SRS002061,SRA008134,Stanford University|Quake,Stanford University,1,0.45847,,0.04709,,0.98754,,0.0161,,56,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67915,SRR017334,SRX003625,SRS002060,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish G,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishG,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,G_fish.tar,fastq,50095821.0,217866.0,Zebrafish IgH cDNA FishG,0:4 1:225.94,A:13182103;C:11299206;G:11909574;T:13700817;N:4121,4,225,,,13182103,11299206,11909574,13700817,4121,SRX003625,SRS002060,SRA008134,Stanford University|Quake,Stanford University,1,0.37294,,0.09947,,0.99034,,0.02245,,230,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67916,SRR017333,SRX003624,SRS002059,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish F,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishF,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,F_fish.tar,fastq,16577798.0,83387.0,Zebrafish IgH cDNA FishF,0:4 1:194.81,A:4215316;C:3618457;G:4002690;T:4736893;N:4442,4,194,,,4215316,3618457,4002690,4736893,4442,SRX003624,SRS002059,SRA008134,Stanford University|Quake,Stanford University,1,0.57361,,0.0727,,0.99965,,0.00026,,62,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67917,SRR017332,SRX003623,SRS002058,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish E,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishE,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,E_fish.tar,fastq,29705006.0,131553.0,Zebrafish IgH cDNA FishE,0:4 1:221.80,A:7474430;C:6417563;G:7115572;T:8693543;N:3898,4,221,,,7474430,6417563,7115572,8693543,3898,SRX003623,SRS002058,SRA008134,Stanford University|Quake,Stanford University,1,0.3099,,0.09802,,0.99904,,0.00099,,45,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67918,SRR017331,SRX003622,SRS002057,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish D,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishD,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,D_fish.tar,fastq,27611909.0,123468.0,Zebrafish IgH cDNA FishD,0:4 1:219.64,A:6809564;C:6219469;G:6636933;T:7943112;N:2831,4,219,,,6809564,6219469,6636933,7943112,2831,SRX003622,SRS002057,SRA008134,Stanford University|Quake,Stanford University,1,0.45962,,0.09396,,0.99941,,0.00026,,218,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67919,SRR017330,SRX003621,SRS002056,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish C,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishC,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,C_fish.tar,fastq,21845405.0,95733.0,Zebrafish IgH cDNA FishC,0:4 1:224.19,A:5735195;C:4746747;G:5266352;T:6095066;N:2045,4,224,,,5735195,4746747,5266352,6095066,2045,SRX003621,SRS002056,SRA008134,Stanford University|Quake,Stanford University,1,0.38908,,0.20497,,0.99967,,0.00047,,145,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67920,SRR017329,SRX003620,SRS002055,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish B,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishB,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,B_fish.tar,fastq,26680294.0,118385.0,Zebrafish IgH cDNA FishB,0:4 1:221.37,A:6380496;C:6168810;G:6541530;T:7587018;N:2440,4,221,,,6380496,6168810,6541530,7587018,2440,SRX003620,SRS002055,SRA008134,Stanford University|Quake,Stanford University,1,0.35498,,0.14675,,0.99906,,0.00098,,228,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
67921,SRR017328,SRX003619,SRS002054,SRP000652,PRJNA79415,Zebrafish IgH Sequencing,Zebrafish IgH,Other,14 zebrafish immunoglobulin heavy chain repertoires were sequenced. The first 190 bp of sequence  10 bp of MID barcodes were used to analyze the CDR3 region of the antibodies.,,pubmed:19423829,,Generic sample from Danio rerio,Fish A,,,,,,,,,,,Zebrafish IgH cDNA preparation,Zebrafish IgH cDNA FishA,Zebrafish IgH 454,"About 2µg of QIAquick cleaned PCR product for each fish was used to start the 454 library preparation process. AMPure SPRI beads Agencourt  Beverly  MA were used to concentrate PCR product and remove the remaining primers. 454 FLX DNA library construction protocol was followed for all samples. Briefly  double stranded DNA was end polished and ligated to sequencing adaptors which contained a molecular identifier MID  a nucleotide based barcode system. This allowed us to multiplex the sequencing plate and also served as an internal control. The rest of the Roche 454 protocol was followed which includes library immobilization  fill in reaction and single stranded template DNA sstDNA library isolation. The sstDNA was quantified using a digital PCR method developed in our lab White et al. ""Digital PCR provides sensitive and absolute calibration for high throughput sequencing"" BMC Genomics  2009  which gave the absolute count of DNA molecules in the library. This allowed us to eliminate the manufacturer’s suggested titration run. 16 emulsion PCR reactions were prepared for each fish with a ratio of 0.3 molecules per DNA capture bead. Two region masks were used on the sequencing plate.",,IgM primer:5 prime TGCACTGAGACAAACCGAAG 3 prime|IgZ primer:5 prime TCAGAGGCCAGACATCCAAT 3 prime,AMPLICON,TRANSCRIPTOMIC,PCR,SINGLE,LS454,454 GS FLX,<SPOT_DESCRIPTOR><SPOT_DECODE_SPEC><READ_SPEC><READ_INDEX>0</READ_INDEX><READ_CLASS>Technical Read</READ_CLASS><READ_TYPE>Adapter</READ_TYPE><BASE_COORD>1</BASE_COORD></READ_SPEC><READ_SPEC><READ_INDEX>1</READ_INDEX><READ_CLASS>Application Read</READ_CLASS><READ_TYPE>Forward</READ_TYPE><BASE_COORD>5</BASE_COORD></READ_SPEC></SPOT_DECODE_SPEC></SPOT_DESCRIPTOR>,SRP000652,,NonStandardReadNameUsed:true,A_fish.tar,fastq,13497752.0,61111.0,Zebrafish IgH cDNA FishA,0:4 1:216.87,A:3287411;C:3078068;G:3224467;T:3906026;N:1780,4,216,,,3287411,3078068,3224467,3906026,1780,SRX003619,SRS002054,SRA008134,Stanford University|Quake,Stanford University,1,0.32333,,0.14098,,0.99937,,0.00169,,52,,B,,usable mapping rate,legacy,early,unknown,random_priming,unknown,bulk,other_seq,454,,United States,2011-03-31,Undetermined,Undetermined,BCR TCR repertoire,Hematopoietic System
68889,SRR18218067,SRX14364507,SRS12177802,SRP362416,PRJNA812715,Mutant IL7R collaborates with MYC to induce  T cell Acute Lymphoblastic Leukemia,PRJNA812715,Other,T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations  10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha  encoded by IL7R  which occur in different molecular subtypes of this disease. However  it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also  which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here  we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally  we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways  harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover  limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.,,,,,Thy rag2 RFP 6,,strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 4|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio thymus Tu/AB,Thy rag2 RFP 6,Thy rag2 RFP 6,Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT  fragmented and converted to cDNA  size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP362416,,,FCHT5GHDSXX_L1_HKRDZEBmfpEAAPRABPEI-P86H2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAAPRABPEI-P86H2_2.fq.gz,fastq fastq,18061636200.0,60205454.0,FCHT5GHDSXX L1 HKRDZEBmfpEAAPRABPEI P86H2 1.fq.gz,0:150 1:150,A:4749806271;C:4292116510;G:4365562558;T:4654124713;N:26148,150,150,,,4749806271,4292116510,4365562558,4654124713,26148,SRX14364507,SRS12177802,SRA1380603,Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab,Instituto de Medicina Molecular Joao Lobo Antunes,2,0.9283,0.92884,0.11636,0.1154,0.77642,0.77697,0.48938,0.49117,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Portugal,2022-03-04,Undetermined,Undetermined,Thymus,Hematopoietic System
68890,SRR18218069,SRX14364506,SRS12177801,SRP362416,PRJNA812715,Mutant IL7R collaborates with MYC to induce  T cell Acute Lymphoblastic Leukemia,PRJNA812715,Other,T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations  10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha  encoded by IL7R  which occur in different molecular subtypes of this disease. However  it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also  which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here  we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally  we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways  harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover  limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.,,,,,Thy rag2 RFP 5,,strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio thymus Tu/AB,Thy rag2 RFP 5,Thy rag2 RFP 5,Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT  fragmented and converted to cDNA  size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP362416,,,FCHT5GHDSXX_L1_HKRDZEBmfpEAAORAAPEI-P74G2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAAORAAPEI-P74G2_2.fq.gz,fastq fastq,16916167800.0,56387226.0,FCHT5GHDSXX L1 HKRDZEBmfpEAAORAAPEI P74G2 1.fq.gz,0:150 1:150,A:4469149097;C:4004191756;G:4070955203;T:4371847041;N:24703,150,150,,,4469149097,4004191756,4070955203,4371847041,24703,SRX14364506,SRS12177801,SRA1380603,Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab,Instituto de Medicina Molecular Joao Lobo Antunes,2,0.92644,0.92786,0.13071,0.13011,0.77833,0.77792,0.47942,0.4816,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Portugal,2022-03-04,Undetermined,Undetermined,Thymus,Hematopoietic System
68891,SRR18218070,SRX14364505,SRS12177800,SRP362416,PRJNA812715,Mutant IL7R collaborates with MYC to induce  T cell Acute Lymphoblastic Leukemia,PRJNA812715,Other,T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations  10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha  encoded by IL7R  which occur in different molecular subtypes of this disease. However  it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also  which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here  we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally  we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways  harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover  limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.,,,,,Thy rag2 RFP 4,,strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio thymus Tu/AB,Thy rag2 RFP 4,Thy rag2 RFP 4,Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT  fragmented and converted to cDNA  size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP362416,,,FCHT5GHDSXX_L1_HKRDZEBmfpEAANRABPEI-P62F2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAANRABPEI-P62F2_2.fq.gz,fastq fastq,17996947500.0,59989825.0,FCHT5GHDSXX L1 HKRDZEBmfpEAANRABPEI P62F2 1.fq.gz,0:150 1:150,A:4882125302;C:4136332786;G:4194970590;T:4783492952;N:25870,150,150,,,4882125302,4136332786,4194970590,4783492952,25870,SRX14364505,SRS12177800,SRA1380603,Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab,Instituto de Medicina Molecular Joao Lobo Antunes,2,0.86095,0.86165,0.25113,0.2504,0.80204,0.80188,0.48309,0.48627,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Portugal,2022-03-04,Undetermined,Undetermined,Thymus,Hematopoietic System
68892,SRR18218071,SRX14364504,SRS12177799,SRP362416,PRJNA812715,Mutant IL7R collaborates with MYC to induce  T cell Acute Lymphoblastic Leukemia,PRJNA812715,Other,T cell acute lymphoblastic leukemia T ALL is an aggressive pediatric cancer. Amongst the wide array of driver mutations  10% of T ALL patients display gain of function mutations in the IL 7 receptor alpha chain IL 7Ralpha  encoded by IL7R  which occur in different molecular subtypes of this disease. However  it is still unclear whether IL 7R mutational activation is sufficient to transform T cell precursors. Also  which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here  we demonstrate that mutant IL7R alone is capable of inducing T ALL with long latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally  we find that mutant IL7R collaborates with Myc to induce early onset T ALL in transgenic zebrafish. T ALLs co expressing mutant IL7R and Myc show activation of STAT5 and AKT pathways  harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T ALLs expressing Myc alone. Moreover  limiting dilution cell transplantation experiments reveal that activated IL 7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.,,,,,Thy rag2 RFP 3,,strain:Tu/AB|age:not collected|sex:not collected|tissue:thymus|birth date: |death date:02 07 2019|genotype:rag2:RFP|biological replicate:Thy rag2 RFP biological replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio thymus Tu/AB,Thy rag2 RFP 3,Thy rag2 RFP 3,Tu/AB WT zebrafish were sacrificed to harvest the thymus visible through RFP staining for further analysis. The RNA was extracted from sorted thymic cells using the RNeasy Mini Kit according to the manufacturers instructions Qiagen. mRNA was enriched using magnetic beads with Oligo dT  fragmented and converted to cDNA  size selected and PCR amplified generating paired end 100 bp sequences using a Illumina NovaSeq 6000.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP362416,,,FCHT5GHDSXX_L1_HKRDZEBmfpEAAMRABPEI-P50E2_1.fq.gz FCHT5GHDSXX_L1_HKRDZEBmfpEAAMRABPEI-P50E2_2.fq.gz,fastq fastq,18041602200.0,60138674.0,FCHT5GHDSXX L1 HKRDZEBmfpEAAMRABPEI P50E2 1.fq.gz,0:150 1:150,A:4726391295;C:4303349397;G:4380843440;T:4630991494;N:26574,150,150,,,4726391295,4303349397,4380843440,4630991494,26574,SRX14364504,SRS12177799,SRA1380603,Instituto de Medicina Molecular Joao Lobo Antunes|JBarata lab,Instituto de Medicina Molecular Joao Lobo Antunes,2,0.93138,0.9316,0.11291,0.11196,0.78143,0.78261,0.4799,0.47958,150,150,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,Portugal,2022-03-04,Undetermined,Undetermined,Thymus,Hematopoietic System
71972,SRR22163682,SRX18142568,SRS15644032,SRP405990,PRJNA897077,Transcriptome of zebrafish Danio rerio,PRJNA897077,Other,Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.,,,,,C3,,strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:control|replicate:replicate3|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio,C3,C3,control group,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP405990,,,C3.R1.fastq.gz C3.R2.fastq.gz,fastq fastq,6777299176.0,22441388.0,C3.R1.fastq.gz,0:151 1:151,A:1869146927;C:1513142912;G:1565477798;T:1829395893;N:135646,151,151,,,1869146927,1513142912,1565477798,1829395893,135646,SRX18142568,SRS15644032,SRA1532870,Kunming University of Science and Technology|Faculty of Life Science and Technology,Kunming University of Science and Technology,2,0.91581,0.91452,0.09416,0.09344,0.71167,0.71338,0.50247,0.50311,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2022-11-02,Undetermined,Undetermined,Spleen,Hematopoietic System
71973,SRR22163683,SRX18142567,SRS15644031,SRP405990,PRJNA897077,Transcriptome of zebrafish Danio rerio,PRJNA897077,Other,Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.,,,,,C2,,strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:control|replicate:replicate2|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio,C2,C2,control group,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP405990,,,C2.R1.fastq.gz C2.R2.fastq.gz,fastq fastq,6956425644.0,23034522.0,C2.R1.fastq.gz,0:151 1:151,A:1847551873;C:1616308106;G:1662475314;T:1829952767;N:137584,151,151,,,1847551873,1616308106,1662475314,1829952767,137584,SRX18142567,SRS15644031,SRA1532870,Kunming University of Science and Technology|Faculty of Life Science and Technology,Kunming University of Science and Technology,2,0.93033,0.9312,0.056,0.05619,0.71261,0.71376,0.4668,0.47014,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2022-11-02,Undetermined,Undetermined,Spleen,Hematopoietic System
71974,SRR22163684,SRX18142566,SRS15644030,SRP405990,PRJNA897077,Transcriptome of zebrafish Danio rerio,PRJNA897077,Other,Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.,,,,,C1,,strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:control|replicate:replicate1|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio,C1,C1,control group,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP405990,,,C1.R1.fastq.gz C1.R2.fastq.gz,fastq fastq,6218689172.0,20591686.0,C1.R1.fastq.gz,0:151 1:151,A:1651743119;C:1444992966;G:1490934383;T:1630891482;N:127222,151,151,,,1651743119,1444992966,1490934383,1630891482,127222,SRX18142566,SRS15644030,SRA1532870,Kunming University of Science and Technology|Faculty of Life Science and Technology,Kunming University of Science and Technology,2,0.93571,0.93627,0.03427,0.0346,0.73336,0.73401,0.47064,0.47601,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2022-11-02,Undetermined,Undetermined,Spleen,Hematopoietic System
71975,SRR22163685,SRX18142565,SRS15644029,SRP405990,PRJNA897077,Transcriptome of zebrafish Danio rerio,PRJNA897077,Other,Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.,,,,,B3,,strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:challenge|replicate:replicate3|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio,B3,B3,challenge group,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP405990,,,B3.R1.fastq.gz B3.R2.fastq.gz,fastq fastq,7958268062.0,26351881.0,B3.R1.fastq.gz,0:151 1:151,A:2067039750;C:1894612680;G:1943559820;T:2052891379;N:164433,151,151,,,2067039750,1894612680,1943559820,2052891379,164433,SRX18142565,SRS15644029,SRA1532870,Kunming University of Science and Technology|Faculty of Life Science and Technology,Kunming University of Science and Technology,2,0.93754,0.93809,0.03309,0.03347,0.71762,0.71731,0.49012,0.4888,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2022-11-02,Undetermined,Undetermined,Spleen,Hematopoietic System
71976,SRR22163686,SRX18142564,SRS15644028,SRP405990,PRJNA897077,Transcriptome of zebrafish Danio rerio,PRJNA897077,Other,Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.,,,,,B2,,strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:challenge|replicate:replicate2|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio,B2,B2,challenge group,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP405990,,,B2.R1.fastq.gz B2.R2.fastq.gz,fastq fastq,7071097158.0,23414229.0,B2.R1.fastq.gz,0:151 1:151,A:1862299896;C:1658740196;G:1713471478;T:1836444697;N:140891,151,151,,,1862299896,1658740196,1713471478,1836444697,140891,SRX18142564,SRS15644028,SRA1532870,Kunming University of Science and Technology|Faculty of Life Science and Technology,Kunming University of Science and Technology,2,0.94335,0.94369,0.04139,0.04172,0.80405,0.80415,0.39649,0.39674,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2022-11-02,Undetermined,Undetermined,Spleen,Hematopoietic System
71977,SRR22163687,SRX18142563,SRS15644027,SRP405990,PRJNA897077,Transcriptome of zebrafish Danio rerio,PRJNA897077,Other,Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.,,,,,B1,,strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:challenge|replicate:replicate1|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio,B1,B1,challenge group,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP405990,,,B1.R1.fastq.gz B1.R2.fastq.gz,fastq fastq,7597788178.0,25158239.0,B1.R1.fastq.gz,0:151 1:151,A:1986638730;C:1797302173;G:1839273564;T:1974418679;N:155032,151,151,,,1986638730,1797302173,1839273564,1974418679,155032,SRX18142563,SRS15644027,SRA1532870,Kunming University of Science and Technology|Faculty of Life Science and Technology,Kunming University of Science and Technology,2,0.93891,0.93921,0.04922,0.04888,0.74552,0.74501,0.48725,0.49058,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2022-11-02,Undetermined,Undetermined,Spleen,Hematopoietic System
71978,SRR22163688,SRX18142562,SRS15644026,SRP405990,PRJNA897077,Transcriptome of zebrafish Danio rerio,PRJNA897077,Other,Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.,,,,,A3,,strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:treatment|replicate:replicate3|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio,A3,A3,treatment group,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP405990,,,A3.R1.fastq.gz A3.R2.fastq.gz,fastq fastq,8674550152.0,28723676.0,A3.R1.fastq.gz,0:151 1:151,A:2234032232;C:2083164440;G:2128058461;T:2229111717;N:183302,151,151,,,2234032232,2083164440,2128058461,2229111717,183302,SRX18142562,SRS15644026,SRA1532870,Kunming University of Science and Technology|Faculty of Life Science and Technology,Kunming University of Science and Technology,2,0.93839,0.93828,0.01889,0.01887,0.73639,0.73724,0.48841,0.47397,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2022-11-02,Undetermined,Undetermined,Spleen,Hematopoietic System
71979,SRR22163689,SRX18142561,SRS15644025,SRP405990,PRJNA897077,Transcriptome of zebrafish Danio rerio,PRJNA897077,Other,Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.,,,,,A2,,strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:treatment|replicate:replicate2|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio,A2,A2,treatment group,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP405990,,,A2.R1.fastq.gz A2.R2.fastq.gz,fastq fastq,7383660816.0,24449208.0,A2.R1.fastq.gz,0:151 1:151,A:1917884453;C:1759507724;G:1796259178;T:1909857526;N:151935,151,151,,,1917884453,1759507724,1796259178,1909857526,151935,SRX18142561,SRS15644025,SRA1532870,Kunming University of Science and Technology|Faculty of Life Science and Technology,Kunming University of Science and Technology,2,0.93853,0.93854,0.02662,0.02663,0.71435,0.7149,0.49509,0.49212,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2022-11-02,Undetermined,Undetermined,Spleen,Hematopoietic System
71980,SRR22163690,SRX18142560,SRS15644024,SRP405990,PRJNA897077,Transcriptome of zebrafish Danio rerio,PRJNA897077,Other,Zebrafish Danio rerio have been used as a model organism to study innate immune system and hostpathogen interactions. Until now  the information related to the immune system against A. hydrophila of zebrafish and the treatment by probiotics is incomplete. To increase knowledge of the molecular mechanisms of the host defense against A. hydrophila and provide evidence that antibiotics can replace by probiotics  we conducted transcriptome analysis of spleen in zebrafish 48 h post infection and treatment by Lactococcus lactis post 4h post infection via sequencing.,,,,,A1,,strain:not applicable|age:not collected|sex:not collected|tissue:spleen|treatment:treatment|replicate:replicate1|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of Danio rerio,A1,A1,treatment group,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP405990,,,A1.R1.fastq.gz A1.R2.fastq.gz,fastq fastq,7734454352.0,25610776.0,A1.R1.fastq.gz,0:151 1:151,A:2031967267;C:1817027018;G:1866115793;T:2019187811;N:156463,151,151,,,2031967267,1817027018,1866115793,2019187811,156463,SRX18142560,SRS15644024,SRA1532870,Kunming University of Science and Technology|Faculty of Life Science and Technology,Kunming University of Science and Technology,2,0.93755,0.93728,0.03692,0.03688,0.71664,0.71693,0.48577,0.48719,151,151,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2022-11-02,Undetermined,Undetermined,Spleen,Hematopoietic System
76641,SRR25247899,SRX20994109,SRS18268516,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  lckmCherry cd79aGFP  Population T4  Sample 53,GSM7595974,,source name:Thymus|tissue:Thymus|cell type:Thymic B|genotype:lckmCherry cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  lckmCherry cd79aGFP  Population T4  Sample 53,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:Thymic B|genotype:lckmCherry cd79aGFP|treatment:NA,GSM7595974,GSM7595974: Thymus  lckmCherry cd79aGFP  Population T4  Sample 53; Danio rerio; RNA Seq,GSM7595974 r1,GSM7595974,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,53_S65_R2_001.fastq.gz 53_S65_R1_001.fastq.gz,fastq fastq,10257924978.0,33966639.0,GSM7595974 r1,0:151 1:151,A:3041876002;C:1856778277;G:2077467609;T:3281762421;N:40669,151,151,,,3041876002,1856778277,2077467609,3281762421,40669,SRX20994109,SRS18268516,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.74686,0.55687,0.09361,0.09952,0.88538,0.94302,0.6544,0.6924,151,151,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76642,SRR25247900,SRX20994108,SRS18268515,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  lckmCherry cd79aGFP  Population T4  Sample 52,GSM7595973,,source name:Thymus|tissue:Thymus|cell type:Thymic B|genotype:lckmCherry cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  lckmCherry cd79aGFP  Population T4  Sample 52,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:Thymic B|genotype:lckmCherry cd79aGFP|treatment:NA,GSM7595973,GSM7595973: Thymus  lckmCherry cd79aGFP  Population T4  Sample 52; Danio rerio; RNA Seq,GSM7595973 r1,GSM7595973,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,52_S64_R1_001.fastq.gz 52_S64_R2_001.fastq.gz,fastq fastq,10369663770.0,34336635.0,GSM7595973 r1,0:151 1:151,A:3082270824;C:1842032766;G:2098848870;T:3346470075;N:41235,151,151,,,3082270824,1842032766,2098848870,3346470075,41235,SRX20994108,SRS18268515,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.7463,0.55849,0.12388,0.14088,0.88028,0.94369,0.6854,0.70968,151,151,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76643,SRR25247901,SRX20994107,SRS18268513,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  lckmCherry cd79aGFP  Population T4  Sample 51,GSM7595972,,source name:Thymus|tissue:Thymus|cell type:Thymic B|genotype:lckmCherry cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  lckmCherry cd79aGFP  Population T4  Sample 51,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:Thymic B|genotype:lckmCherry cd79aGFP|treatment:NA,GSM7595972,GSM7595972: Thymus  lckmCherry cd79aGFP  Population T4  Sample 51; Danio rerio; RNA Seq,GSM7595972 r1,GSM7595972,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,51_S63_R2_001.fastq.gz 51_S63_R1_001.fastq.gz,fastq fastq,10986483972.0,36379086.0,GSM7595972 r1,0:151 1:151,A:3203989538;C:2032991258;G:2291606935;T:3457852653;N:43588,151,151,,,3203989538,2032991258,2291606935,3457852653,43588,SRX20994107,SRS18268513,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.75607,0.57028,0.09825,0.09786,0.87992,0.93795,0.66505,0.68991,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76644,SRR25247905,SRX20994106,SRS18268514,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  lckmCherry cd79aGFP  Population T2  Sample 50,GSM7595971,,source name:Thymus|tissue:Thymus|cell type:T Stage IV|genotype:lckmCherry cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  lckmCherry cd79aGFP  Population T2  Sample 50,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T Stage IV|genotype:lckmCherry cd79aGFP|treatment:NA,GSM7595971,GSM7595971: Thymus  lckmCherry cd79aGFP  Population T2  Sample 50; Danio rerio; RNA Seq,GSM7595971 r1,GSM7595971,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,50_S62_R1_001.fastq.gz 50_S62_R2_001.fastq.gz,fastq fastq,11149582998.0,36919149.0,GSM7595971 r1,0:151 1:151,A:3234571276;C:2073976116;G:2356352649;T:3484638408;N:44549,151,151,,,3234571276,2073976116,2356352649,3484638408,44549,SRX20994106,SRS18268514,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.7664,0.58289,0.1324,0.11697,0.89181,0.94119,0.60945,0.65676,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76645,SRR25247902,SRX20994105,SRS18268512,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  lckmCherry cd79aGFP  Population T2  Sample 49,GSM7595970,,source name:Thymus|tissue:Thymus|cell type:T Stage IV|genotype:lckmCherry cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  lckmCherry cd79aGFP  Population T2  Sample 49,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T Stage IV|genotype:lckmCherry cd79aGFP|treatment:NA,GSM7595970,GSM7595970: Thymus  lckmCherry cd79aGFP  Population T2  Sample 49; Danio rerio; RNA Seq,GSM7595970 r1,GSM7595970,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,49_S61_R1_001.fastq.gz 49_S61_R2_001.fastq.gz,fastq fastq,9322695908.0,30869854.0,GSM7595970 r1,0:151 1:151,A:2726922200;C:1719173931;G:1967587692;T:2908975055;N:37030,151,151,,,2726922200,1719173931,1967587692,2908975055,37030,SRX20994105,SRS18268512,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.7069,0.50745,0.13643,0.11444,0.88562,0.93415,0.61812,0.62999,151,151,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76646,SRR25247903,SRX20994104,SRS18268510,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  lckmCherry cd79aGFP  Population T2  Sample 48,GSM7595969,,source name:Thymus|tissue:Thymus|cell type:T Stage IV|genotype:lckmCherry cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  lckmCherry cd79aGFP  Population T2  Sample 48,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T Stage IV|genotype:lckmCherry cd79aGFP|treatment:NA,GSM7595969,GSM7595969: Thymus  lckmCherry cd79aGFP  Population T2  Sample 48; Danio rerio; RNA Seq,GSM7595969 r1,GSM7595969,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,48_S60_R1_001.fastq.gz 48_S60_R2_001.fastq.gz,fastq fastq,7830804432.0,25929816.0,GSM7595969 r1,0:151 1:151,A:2320164600;C:1418924520;G:1593915842;T:2497768242;N:31228,151,151,,,2320164600,1418924520,1593915842,2497768242,31228,SRX20994104,SRS18268510,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.74989,0.56664,0.13383,0.11897,0.86947,0.92626,0.63359,0.63884,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76647,SRR25247904,SRX20994103,SRS18268511,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  lckmCherry cd79aGFP  Population T1  Sample 47,GSM7595968,,source name:Thymus|tissue:Thymus|cell type:T State III|genotype:lckmCherry cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  lckmCherry cd79aGFP  Population T1  Sample 47,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T State III|genotype:lckmCherry cd79aGFP|treatment:NA,GSM7595968,GSM7595968: Thymus  lckmCherry cd79aGFP  Population T1  Sample 47; Danio rerio; RNA Seq,GSM7595968 r1,GSM7595968,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,47_S59_R1_001.fastq.gz 47_S59_R2_001.fastq.gz,fastq fastq,8746939552.0,28963376.0,GSM7595968 r1,0:151 1:151,A:2581719668;C:1603400764;G:1776556616;T:2785228356;N:34148,151,151,,,2581719668,1603400764,1776556616,2785228356,34148,SRX20994103,SRS18268511,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.74197,0.56047,0.10187,0.099,0.88481,0.93701,0.67376,0.69505,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76648,SRR25247906,SRX20994102,SRS18268509,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  lckmCherry cd79aGFP  Population T1  Sample 46,GSM7595967,,source name:Thymus|tissue:Thymus|cell type:T State III|genotype:lckmCherry cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  lckmCherry cd79aGFP  Population T1  Sample 46,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T State III|genotype:lckmCherry cd79aGFP|treatment:NA,GSM7595967,GSM7595967: Thymus  lckmCherry cd79aGFP  Population T1  Sample 46; Danio rerio; RNA Seq,GSM7595967 r1,GSM7595967,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,46_S58_R2_001.fastq.gz 46_S58_R1_001.fastq.gz,fastq fastq,11602233886.0,38417993.0,GSM7595967 r1,0:151 1:151,A:3413897763;C:2146046716;G:2373195191;T:3669047894;N:46322,151,151,,,3413897763,2146046716,2373195191,3669047894,46322,SRX20994102,SRS18268509,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.72323,0.53899,0.12972,0.13114,0.88458,0.93959,0.69874,0.72809,151,151,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76649,SRR25247907,SRX20994101,SRS18268508,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  lckmCherry cd79aGFP  Population T1  Sample 45,GSM7595966,,source name:Thymus|tissue:Thymus|cell type:T State III|genotype:lckmCherry cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  lckmCherry cd79aGFP  Population T1  Sample 45,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T State III|genotype:lckmCherry cd79aGFP|treatment:NA,GSM7595966,GSM7595966: Thymus  lckmCherry cd79aGFP  Population T1  Sample 45; Danio rerio; RNA Seq,GSM7595966 r1,GSM7595966,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,45_S57_R1_001.fastq.gz 45_S57_R2_001.fastq.gz,fastq fastq,8407299480.0,27838740.0,GSM7595966 r1,0:151 1:151,A:2458010874;C:1568377940;G:1764963889;T:2615913460;N:33317,151,151,,,2458010874,1568377940,1764963889,2615913460,33317,SRX20994101,SRS18268508,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.73863,0.56362,0.11999,0.10773,0.89501,0.94418,0.66398,0.67575,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76657,SRR25247915,SRX20994093,SRS18268500,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  rag2RFP cd79aGFP  Population T4  Sample 35,GSM7595958,,source name:Thymus|tissue:Thymus|cell type:Thymic B|genotype:rag2RFP cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  rag2RFP cd79aGFP  Population T4  Sample 35,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:Thymic B|genotype:rag2RFP cd79aGFP|treatment:NA,GSM7595958,GSM7595958: Thymus  rag2RFP cd79aGFP  Population T4  Sample 35; Danio rerio; RNA Seq,GSM7595958 r1,GSM7595958,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,35_S47_R2_001.fastq.gz 35_S47_R1_001.fastq.gz,fastq fastq,7950117082.0,26324891.0,GSM7595958 r1,0:151 1:151,A:2332817459;C:1484005026;G:1661277987;T:2471985200;N:31410,151,151,,,2332817459,1484005026,1661277987,2471985200,31410,SRX20994093,SRS18268500,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.70931,0.52058,0.10349,0.10014,0.90481,0.94809,0.71184,0.74817,151,151,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76658,SRR25247916,SRX20994092,SRS18268498,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  rag2RFP cd79aGFP  Population T4  Sample 34,GSM7595957,,source name:Thymus|tissue:Thymus|cell type:Thymic B|genotype:rag2RFP cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  rag2RFP cd79aGFP  Population T4  Sample 34,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:Thymic B|genotype:rag2RFP cd79aGFP|treatment:NA,GSM7595957,GSM7595957: Thymus  rag2RFP cd79aGFP  Population T4  Sample 34; Danio rerio; RNA Seq,GSM7595957 r1,GSM7595957,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,34_S46_R2_001.fastq.gz 34_S46_R1_001.fastq.gz,fastq fastq,7966171704.0,26378052.0,GSM7595957 r1,0:151 1:151,A:2329420986;C:1477961313;G:1664561539;T:2494196526;N:31340,151,151,,,2329420986,1477961313,1664561539,2494196526,31340,SRX20994092,SRS18268498,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.71845,0.50928,0.0957,0.09999,0.90384,0.95312,0.74113,0.75866,151,151,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76659,SRR25247917,SRX20994091,SRS18268499,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  rag2RFP cd79aGFP  Population T4  Sample 33,GSM7595956,,source name:Thymus|tissue:Thymus|cell type:Thymic B|genotype:rag2RFP cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  rag2RFP cd79aGFP  Population T4  Sample 33,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:Thymic B|genotype:rag2RFP cd79aGFP|treatment:NA,GSM7595956,GSM7595956: Thymus  rag2RFP cd79aGFP  Population T4  Sample 33; Danio rerio; RNA Seq,GSM7595956 r1,GSM7595956,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,33_S45_R1_001.fastq.gz 33_S45_R2_001.fastq.gz,fastq fastq,8314572796.0,27531698.0,GSM7595956 r1,0:151 1:151,A:2452587590;C:1535172003;G:1743148608;T:2583631469;N:33126,151,151,,,2452587590,1535172003,1743148608,2583631469,33126,SRX20994091,SRS18268499,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.62571,0.44431,0.112,0.09476,0.91405,0.9487,0.71132,0.74047,151,151,B,B,mate2-mate1 similar by mapping diff,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76660,SRR25247918,SRX20994090,SRS18268497,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  rag2RFP cd79aGFP  Population T3  Sample 32,GSM7595955,,source name:Thymus|tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  rag2RFP cd79aGFP  Population T3  Sample 32,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA,GSM7595955,GSM7595955: Thymus  rag2RFP cd79aGFP  Population T3  Sample 32; Danio rerio; RNA Seq,GSM7595955 r1,GSM7595955,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,32_S44_R1_001.fastq.gz 32_S44_R2_001.fastq.gz,fastq fastq,10270435026.0,34008063.0,GSM7595955 r1,0:151 1:151,A:3072285253;C:1829169076;G:2174184861;T:3194754612;N:41224,151,151,,,3072285253,1829169076,2174184861,3194754612,41224,SRX20994090,SRS18268497,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.68076,0.52889,0.18916,0.16273,0.87144,0.9303,0.5977,0.60526,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76661,SRR25247919,SRX20994089,SRS18268496,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  rag2RFP cd79aGFP  Population T3  Sample 31,GSM7595954,,source name:Thymus|tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  rag2RFP cd79aGFP  Population T3  Sample 31,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA,GSM7595954,GSM7595954: Thymus  rag2RFP cd79aGFP  Population T3  Sample 31; Danio rerio; RNA Seq,GSM7595954 r1,GSM7595954,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,31_S43_R1_001.fastq.gz 31_S43_R2_001.fastq.gz,fastq fastq,8576339752.0,28398476.0,GSM7595954 r1,0:151 1:151,A:2575134911;C:1518644685;G:1746645548;T:2735880553;N:34055,151,151,,,2575134911,1518644685,1746645548,2735880553,34055,SRX20994089,SRS18268496,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.75636,0.6119,0.26758,0.23065,0.86801,0.92807,0.60587,0.61722,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76662,SRR25247920,SRX20994088,SRS18268495,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  rag2RFP cd79aGFP  Population T3  Sample 30,GSM7595953,,source name:Thymus|tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  rag2RFP cd79aGFP  Population T3  Sample 30,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA,GSM7595953,GSM7595953: Thymus  rag2RFP cd79aGFP  Population T3  Sample 30; Danio rerio; RNA Seq,GSM7595953 r1,GSM7595953,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,30_S42_R1_001.fastq.gz 30_S42_R2_001.fastq.gz,fastq fastq,10957925040.0,36284520.0,GSM7595953 r1,0:151 1:151,A:3260030485;C:1943181567;G:2272932117;T:3481737311;N:43560,151,151,,,3260030485,1943181567,2272932117,3481737311,43560,SRX20994088,SRS18268495,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.75404,0.62746,0.32062,0.27288,0.87588,0.93123,0.63498,0.66153,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76663,SRR25247921,SRX20994087,SRS18268494,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  rag2RFP cd79aGFP  Population T2  Sample 29,GSM7595952,,source name:Thymus|tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  rag2RFP cd79aGFP  Population T2  Sample 29,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA,GSM7595952,GSM7595952: Thymus  rag2RFP cd79aGFP  Population T2  Sample 29; Danio rerio; RNA Seq,GSM7595952 r1,GSM7595952,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,29_S41_R1_001.fastq.gz 29_S41_R2_001.fastq.gz,fastq fastq,10621822898.0,35171599.0,GSM7595952 r1,0:151 1:151,A:3115594114;C:1963383687;G:2242332489;T:3300470381;N:42227,151,151,,,3115594114,1963383687,2242332489,3300470381,42227,SRX20994087,SRS18268494,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.71819,0.58604,0.20876,0.18902,0.88554,0.93482,0.62188,0.63983,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System
76664,SRR25247922,SRX20994086,SRS18268492,SRP448831,PRJNA994052,Dynamic Changes in Lymphocyte Populations Establish Zebrafish as a Thymic Involution Model,GSE237139,Transcriptome Analysis,The thymus is the site of T lymphocyte development and T cell education to recognize foreign  but not self  antigens. B cells also reside and develop in the thymus  although their functions are less clear. During 'thymic involution ' a process of lymphoid atrophy and adipose replacement linked to sexual maturation  thymic cells decline. However  thymic B cells decrease far less than T cells  such that B cells comprise 1% of neonatal thymocytes  but up to 10% in maturity in humans. All jawed vertebrates possess a thymus  and we and others have shown that zebrafish Danio rerio also have thymic B cells. Here  we investigated the precise identities of zebrafish thymic T and B cells and how they change with involution. We assessed the timing and specific details of zebrafish thymic involution using multiple lymphocyte specific  fluorophore labeled transgenic lines  quantifying changes in thymic lymphocytes pre  vs. post involution. Our results prove that  as in humans  zebrafish thymic B cells increase relative to T cells post involution. We also performed RNA sequencing RNA seq on D. rerio thymic and marrow lymphocytes of four novel double transgenic lines  identifying distinct populations of immature T and B cells. Collectively  this is the first comprehensive analysis of zebrafish thymic involution  demonstrating its similarity to human involution  and establishing the highly genetically manipulatable zebrafish model as a template for involution studies. Overall design: This experimental study aimed to investigate the gene expression profiles of lymphocytes in zebrafish using bulk RNA sequencing RNA seq analysis. Specifically  four different double transgenic zebrafish lines were utilized  each expressing specific fluorescent markers to label distinct cell populations. The double transgenic lines included rag2:RFP × cd79a:GFP  rag2:RFP × cd79b:GFP  cd79a:GFP × lck:mCherry  and cd79b:GFP × lck:mCherry. These transgenic lines allowed for the identification and isolation of specific cell types for subsequent transcriptomic analysis.,,pubmed:38656392,,Thymus  rag2RFP cd79aGFP  Population T2  Sample 28,GSM7595951,,source name:Thymus|tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA|geo loc name:missing|collection date:missing,Thymus  rag2RFP cd79aGFP  Population T2  Sample 28,Raw read quality was first assessed using FastQC v.0.11.8. BBDuk from the BBMap suite v.38.22 was used for adapter trimming per manufacturer recommendations. rRNA mapping reads were also filtered at this step. Read quality was assessed post trimming as well. Trimmed reads were mapped to the GRCz11 genome using STAR using default settings. Note that due to the nature of three prime tagged RNA sequencing  the R2 files containg low quality reads that are not typically used during processing. Read counts per gene were generated with FeatureCounts from Rsubread  v.2.12.2 using the D.rerio Ensembl transcriptome release v.92 with a min. alignment quality threshold of 10. DESeq2 v.1.38.3 was used for downstream processing  library normalization and DE testing. Assembly: GRCz11 Supplementary files format and content: Tab delimited file containing raw gene counts for each Sample Supplementary files format and content: Tab delimited file containing normalized gene counts and variance stabilized gene counts separate files for each Sample,Thymus,,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq 3’ mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,For procedures  zebrafish subjects were anesthetized with 0.02% tricaine methanesulfonate. Thymi and marrow samples were dissected and placed in 500 ul cell media RPMI + 1% FBS + 1% Pen/Strep. Single cell suspensions were prepped by dissociating thymic and marrow tissue using a pestle and passed through 35 um filters. Various fluorescent populations were sorted from the lymphoid and precursor gates using a BD FACSJazz Instrument analysis performed in FlowJo softare.,tissue:Thymus|cell type:T Stage I|genotype:rag2RFP cd79aGFP|treatment:NA,GSM7595951,GSM7595951: Thymus  rag2RFP cd79aGFP  Population T2  Sample 28; Danio rerio; RNA Seq,GSM7595951 r1,GSM7595951,1,Total RNA extraction was performed using Promega Reliprep RNA extraction kit per manufacturer's protocol. RNA QC was checked by Bioanalyzer prior to sequencing. The average amount of RNA used to prepare each library of 2.5 ug/sample. RNA libraries for sequencing were prepared using the QuantSeq three prime mRNA Seq Library Prep Kit FWD following manufacturer's protocols.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP448831,,loader:fastq load.py,28_S40_R2_001.fastq.gz 28_S40_R1_001.fastq.gz,fastq fastq,8727889694.0,28900297.0,GSM7595951 r1,0:151 1:151,A:2547391532;C:1595452476;G:1834559014;T:2750452130;N:34542,151,151,,,2547391532,1595452476,1834559014,2750452130,34542,SRX20994086,SRS18268492,SRA1671790,"Pediatrics, University of Oklahoma Health Sciences Center","Pediatrics, University of Oklahoma Health Sciences Center",2,0.74557,0.58372,0.26466,0.23691,0.88623,0.93344,0.65795,0.66615,151,151,B,B,biological fallback assumption,illumina,novaseq_era,3prime,cdna_unspecified,lexogen,bulk,bulk,bulk,,United States,2023-07-12,Undetermined,Undetermined,Thymus,Hematopoietic System