rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 36712,SRR835167,SRX271963,SRS416259,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 116h 53,GSM1129625,,tissue:melanocytes|hpf,dm 116h 53,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129625,GSM1129625: dm 116h 53; Danio rerio; RNA Seq,GSM1129625 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129625,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_116h_53_440.fq.bz2,fastq,203842506.0,4853393.0,GSM1129625 r1,0:42,A:49784918;C:48871504;G:45835011;T:59338271;N:12802,42,,,,49784918,48871504,45835011,59338271,12802,SRX271963,SRS416259,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.82741,,0.14973,,0.84893,,0.53644,,42,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36713,SRR835166,SRX271962,SRS416258,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 97h 41 440,GSM1129624,,tissue:melanocytes|hpf,dm 97h 41 440,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129624,GSM1129624: dm 97h 41 440; Danio rerio; RNA Seq,GSM1129624 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129624,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_97h_41_440.fq.bz2,fastq,199638768.0,4753304.0,GSM1129624 r1,0:42,A:45958194;C:50367228;G:48451580;T:54849238;N:12528,42,,,,45958194,50367228,48451580,54849238,12528,SRX271962,SRS416258,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.85741,,0.09897,,0.84112,,0.53299,,42,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36714,SRR835165,SRX271961,SRS416257,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h FM 351,GSM1129623,,tissue:melanocytes|hpf,dm 77h FM 351,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129623,GSM1129623: dm 77h FM 351; Danio rerio; RNA Seq,GSM1129623 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129623,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_FM_351_ATT.fq.bz2,fastq,194385384.0,5399594.0,GSM1129623 r1,0:36,A:45805148;C:47931006;G:41165284;T:59482433;N:1513,36,,,,45805148,47931006,41165284,59482433,1513,SRX271961,SRS416257,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.77748,,0.07764,,0.87687,,0.51575,,36,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36715,SRR835164,SRX271960,SRS416256,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 52 440,GSM1129622,,tissue:melanocytes|hpf,dm 77h 52 440,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129622,GSM1129622: dm 77h 52 440; Danio rerio; RNA Seq,GSM1129622 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129622,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_52_440.fq.bz2,fastq,105047586.0,2501133.0,GSM1129622 r1,0:42,A:24711000;C:26459041;G:24869198;T:29001957;N:6390,42,,,,24711000,26459041,24869198,29001957,6390,SRX271960,SRS416256,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.88862,,0.09219,,0.83611,,0.55476,,42,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36716,SRR835163,SRX271959,SRS416255,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 43 440,GSM1129621,,tissue:melanocytes|hpf,dm 77h 43 440,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129621,GSM1129621: dm 77h 43 440; Danio rerio; RNA Seq,GSM1129621 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129621,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_43_440.fq.bz2,fastq,371553084.0,8846502.0,GSM1129621 r1,0:42,A:84994407;C:91269417;G:87188701;T:108077735;N:22824,42,,,,84994407,91269417,87188701,108077735,22824,SRX271959,SRS416255,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.86495,,0.09748,,0.83684,,0.52833,,42,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36717,SRR835162,SRX271958,SRS416254,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 28 399s62,GSM1129620,,tissue:melanocytes|hpf,dm 77h 28 399s62,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129620,GSM1129620: dm 77h 28 399s62; Danio rerio; RNA Seq,GSM1129620 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129620,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,,,731276158.0,3620179.0,GSM1129620 r1,0:101 1:101,A:173989639;C:199270484;G:188281318;T:169725601;N:9116,101,101,,,173989639,199270484,188281318,169725601,9116,SRX271958,SRS416254,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",2,0.84122,0.79964,0.02274,0.02168,0.89645,0.89073,0.63341,0.63015,101,101,B,B,biological fallback assumption,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36718,SRR835161,SRX271957,SRS416253,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 28 399s61,GSM1129619,,tissue:melanocytes|hpf,dm 77h 28 399s61,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129619,GSM1129619: dm 77h 28 399s61; Danio rerio; RNA Seq,GSM1129619 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129619,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_28_399s61_CACT.fq.bz2 dm_77h_28_399s62_CACT.fq.bz2,fastq fastq,731276158.0,3620179.0,GSM1129619 r1,0:101 1:101,A:173989639;C:199270484;G:188281318;T:169725601;N:9116,101,101,,,173989639,199270484,188281318,169725601,9116,SRX271957,SRS416253,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",2,0.84121,0.79968,0.02287,0.02141,0.89658,0.89051,0.63318,0.63061,101,101,B,B,biological fallback assumption,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36719,SRR835160,SRX271956,SRS416252,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 28 436,GSM1129618,,tissue:melanocytes|hpf,dm 77h 28 436,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129618,GSM1129618: dm 77h 28 436; Danio rerio; RNA Seq,GSM1129618 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129618,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_28_436_CACT.fq.bz2,fastq,214752678.0,5113159.0,GSM1129618 r1,0:42,A:50210098;C:62230664;G:49216487;T:52926929;N:168500,42,,,,50210098,62230664,49216487,52926929,168500,SRX271956,SRS416252,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.80956,,0.02412,,0.87024,,0.62475,,42,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36720,SRR835159,SRX271955,SRS416251,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 28 351,GSM1129617,,tissue:melanocytes|hpf,dm 77h 28 351,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129617,GSM1129617: dm 77h 28 351; Danio rerio; RNA Seq,GSM1129617 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129617,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_28_351_CACT.fq.bz2,fastq,84584556.0,2349571.0,GSM1129617 r1,0:36,A:19843286;C:24761303;G:18855233;T:21124051;N:683,36,,,,19843286,24761303,18855233,21124051,683,SRX271955,SRS416251,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.75246,,0.02663,,0.87054,,0.59024,,36,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36721,SRR835158,SRX271954,SRS416250,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 27 436,GSM1129616,,tissue:melanocytes|hpf,dm 77h 27 436,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129616,GSM1129616: dm 77h 27 436; Danio rerio; RNA Seq,GSM1129616 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129616,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_27_436_TTAT.fq.bz2,fastq,194114466.0,4621773.0,GSM1129616 r1,0:42,A:44579558;C:47759429;G:44539735;T:57080409;N:155335,42,,,,44579558,47759429,44539735,57080409,155335,SRX271954,SRS416250,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.80787,,0.04019,,0.86263,,0.57373,,42,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36722,SRR835157,SRX271953,SRS416249,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 27 351,GSM1129615,,tissue:melanocytes|hpf,dm 77h 27 351,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129615,GSM1129615: dm 77h 27 351; Danio rerio; RNA Seq,GSM1129615 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129615,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_27_351_TTAT.fq.bz2,fastq,113087304.0,3141314.0,GSM1129615 r1,0:36,A:26171623;C:27323878;G:24871328;T:34719586;N:889,36,,,,26171623,27323878,24871328,34719586,889,SRX271953,SRS416249,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.75375,,0.04337,,0.85878,,0.5311,,36,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36723,SRR835156,SRX271952,SRS416248,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 26 433,GSM1129614,,tissue:melanocytes|hpf,dm 77h 26 433,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129614,GSM1129614: dm 77h 26 433; Danio rerio; RNA Seq,GSM1129614 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129614,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_26_433_AGAT.fq.bz2,fastq,34005804.0,809662.0,GSM1129614 r1,0:42,A:8766789;C:8066807;G:8338043;T:8833768;N:397,42,,,,8766789,8066807,8338043,8833768,397,SRX271952,SRS416248,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.81802,,0.05684,,0.88787,,0.56756,,42,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36724,SRR835155,SRX271951,SRS416247,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 26 351,GSM1129613,,tissue:melanocytes|hpf,dm 77h 26 351,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129613,GSM1129613: dm 77h 26 351; Danio rerio; RNA Seq,GSM1129613 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129613,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_26_351_AGAT.fq.bz2,fastq,101340432.0,2815012.0,GSM1129613 r1,0:36,A:26592120;C:23518331;G:24503636;T:26725495;N:850,36,,,,26592120,23518331,24503636,26725495,850,SRX271951,SRS416247,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.75158,,0.05787,,0.88986,,0.57167,,36,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36725,SRR835154,SRX271950,SRS416245,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 25 399s62,GSM1129612,,tissue:melanocytes|hpf,dm 77h 25 399s62,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129612,GSM1129612: dm 77h 25 399s62; Danio rerio; RNA Seq,GSM1129612 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129612,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,,,1715809008.0,8494104.0,GSM1129612 r1,0:101 1:101,A:405310561;C:444474389;G:467897835;T:398105078;N:21145,101,101,,,405310561,444474389,467897835,398105078,21145,SRX271950,SRS416245,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",2,0.66327,0.58026,0.07911,0.07288,0.91721,0.9083,0.56907,0.5363,101,101,B,B,biological fallback assumption,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36726,SRR835153,SRX271949,SRS416246,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 25 399s61,GSM1129611,,tissue:melanocytes|hpf,dm 77h 25 399s61,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129611,GSM1129611: dm 77h 25 399s61; Danio rerio; RNA Seq,GSM1129611 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129611,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_25_399s61_TCTT.fq.bz2 dm_77h_25_399s62_TCTT.fq.bz2,fastq fastq,1715809008.0,8494104.0,GSM1129611 r1,0:101 1:101,A:405310561;C:444474389;G:467897835;T:398105078;N:21145,101,101,,,405310561,444474389,467897835,398105078,21145,SRX271949,SRS416246,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",2,0.66325,0.58027,0.0792,0.07327,0.91741,0.90847,0.56374,0.53632,101,101,B,B,biological fallback assumption,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36727,SRR835152,SRX271948,SRS416244,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 25 433,GSM1129610,,tissue:melanocytes|hpf,dm 77h 25 433,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129610,GSM1129610: dm 77h 25 433; Danio rerio; RNA Seq,GSM1129610 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129610,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_25_433_TCTT.fq.bz2,fastq,489386604.0,11652062.0,GSM1129610 r1,0:42,A:99597908;C:134563195;G:119005661;T:136214210;N:5630,42,,,,99597908,134563195,119005661,136214210,5630,SRX271948,SRS416244,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.79072,,0.08396,,0.87497,,0.51318,,42,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36728,SRR835151,SRX271947,SRS416243,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 77h 25 351,GSM1129609,,tissue:melanocytes|hpf,dm 77h 25 351,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129609,GSM1129609: dm 77h 25 351; Danio rerio; RNA Seq,GSM1129609 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129609,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_77h_25_351_TCTT.fq.bz2,fastq,98765532.0,2743487.0,GSM1129609 r1,0:36,A:19387910;C:27338385;G:23220852;T:28817575;N:810,36,,,,19387910,27338385,23220852,28817575,810,SRX271947,SRS416243,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.75369,,0.08166,,0.87667,,0.51755,,36,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36729,SRR835150,SRX271946,SRS416242,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 58h 45 440,GSM1129608,,tissue:melanocytes|hpf,dm 58h 45 440,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129608,GSM1129608: dm 58h 45 440; Danio rerio; RNA Seq,GSM1129608 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129608,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_58h_45_440.fq.bz2,fastq,203660982.0,4849071.0,GSM1129608 r1,0:42,A:46576136;C:50204145;G:47522343;T:59345685;N:12673,42,,,,46576136,50204145,47522343,59345685,12673,SRX271946,SRS416242,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.86133,,0.0978,,0.84565,,0.53118,,42,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 36730,SRR835149,SRX271945,SRS416241,SRP021517,PRJNA198908,Gene Expression Analysis of Zebrafish Melanocytes Iridophores and Retinal Pigmented Epithelium Reveals Indicators of Biological Function and Developmental Origin,GSE46387,Transcriptome Analysis,In order to facilitate understanding of pigment cell biology we developed a method to concomitantly purify melanocytes iridophores and retinal pigmented epithelium from zebrafish and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co enrichment in melanocytes and retinal pigmented epithelium as well as in melanocytes and iridophores. We found 214 genes co enriched in melanocytes and retinal pigmented epithelium indicating the shared functions of melanin producing cells. We found 62 genes significantly co enriched in melanocytes and iridophores illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate limiting substrate for purine synthesis phosphoribosyl pyrophosphate thus constituting a guanine cycle. The purification procedure and expression analysis described here along with the accompanying transcriptome wide expression data provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types and will be a useful resource for further studies of pigment cell biology. Overall design: mRNA profiles of zebrafish pigment cells were generated using Illumina GAIIX sequencing,,pubmed:23874447,,dm 58h 23 351,GSM1129607,,tissue:melanocytes|hpf,dm 58h 23 351,Align sequences using Novoalign to cDNA database Calculate RPKMs from Novoalign output using Perl Genome build: Non redundant database of 25 102 cDNAs generated by Higdon et al 2013 based on NCBI's RefSeq build from 8/29/2012 current RefSeq available at ftp://ftp.ncbi.nlm.nih.gov/refseq/D rerio/mRNA Prot/zebrafish.rna.fna.gz Supplementary files format and content: Excell file containing RPKMs of each library,melanocytes,,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,,hpf,GSM1129607,GSM1129607: dm 58h 23 351; Danio rerio; RNA Seq,GSM1129607 1,,1,This study was carried out in accordance with the Washington University Animal Use Committee guidelines under approved protocol #20110236. Zebrafish were reared and bred according to standard protocols. The fish used in this study were homozygous for a temperature sensitive allele of micropthalmia transcription factor mitfavc7. This mutant facilitated the collection of RPE as mitfa is not required for RPE development in zebrafish. Melanocytes iridophores and RPE develop normally at 25°C in mitfavc7. When held at 32°C the neural crest derived melanocytes do not develop but RPE and iridophores develop normally. All melanocyte and iridophore samples were incubated at 25°C prior to collection. Fish were anesthetized with Tricaine rinsed with Ca Mg DPBS Sigma D8537 and immersed in 100mL TrypLE Express Invitrogen 12604039 per 1000 fish. Fish were incubated at 37°C and shaken at 100rpm for 15 20 minutes followed by trituration with a Pasteur pipette to remove eyes from larva. post separation of eyes and larva each group was placed in TrypLE Express and shaken at 100rpm at 37°C for 1 1.5 hr. Dissociated cells were filtered through a 120uM screen into 50 mL tubes. Remaining intact tissue was triturated 10 20 times and again filtered through a 120uM screen into the dissociated cells. Dissociated cells were pelleted in a swinging bucket rotor Eppendorf 5810 R at 500 relative centrifugal force rcf for 5 minutes at 4°C then resuspended in 1mL cold isotonic Percoll Sigma P1644 by gentle pipetting. Isotonic Percoll was prepared by mixing 1 part 10X PBS with 9 parts Percoll. Resuspended cells were transferred to 1.6mL Eppendorf tubes and spun at 2000rcf for 5 minutes at 4°C in a swinging bucket rotor for isopycnic separation. Pigment cells in the pellet were then resuspended in 400µL of ice cold DPBS with 2% fetal calf serum FCS and placed onto preformed Percoll density gradients. Preformed gradients were prepared via centrifugation of 1mL aliquots of isotonic Percoll in 1.6mL tubes at 10 000rcf for 15 minutes at 4°C in a fixed angle micro centrifuge Eppendorf 5415 R. Tubes containing preformed Percoll gradients with overlying cell suspensions were centrifuged in a swinging bucket rotor at 2000rcf for 10 minutes at 4°C. Following centrifugation overlying Percoll was aspirated leaving the final 100µL containing the pigment cell pellet. Cells were resuspended with 50µL of cold DPBS with 2% FCS and transferred to a clean 1.6mL tube containing 500µL of cold DPBS with 2% FCS and kept on ice until mRNA extraction or FACS. FACS We used the inherent properties of the pigmented cells to perform Fluorescence Activated Cell Sorting FACS. Following resuspension in 500µL cold DPBS with 2% FCS the enriched cell populations were screened through a 30uM cell filter Partec 04 0042 2316. Cells were analyzed and sorted with a Dako MoFlo cell sorter using a 120uM nozzle at a drop drive DD frequency of 22390Hz. Cells were illuminated using a 488 nm laser. Cells were gated on two attributes to separate cells from each other and from cellular debris. Cellular debris was detected using forward and side scatter selecting against the smallest particles 1µm or less. Cells were sorted based on detection using 510 530nm and 575 595nm filters corresponding to FL1 and FL2 in Figure 1D respectively. When excited by the 488 nm laser the autofluorescence of iridophores is clearly detectable in these channels as a group of cells extending at a 45 degree line in the upper right quadrant. Melanocytes and RPE do not autofluoresce with this intensity when excited by the 488nm laser and cluster at the lower left of the FACS plot. Cells were collected into ice cold DPBS with 2% FCS and kept on ice until mRNA extraction. Pigment cell cDNA library construction was as follows. For mRNA extraction the Dynabeads® mRNA DIRECT Kit Invitrogen was used per manufacturer's instructions. Following mRNA elution from the Dynabeads first strand cDNA synthesis was performed using MMLV reverse transcriptase Clontech using an anchored polyT primer tailed with a universal primer sequence See Table S3 for primer sequences and Figure 2 for pigment cell cDNA library construction overview. A universal primer sequence was also added to the three prime end of the first strand by template switching allowing for PCR amplification of the resultant cDNA [43 44]. Following PCR amplification using the high fidelity polymerase LA Taq TaKaRa PCR cycle: 95C for 1 minute followed by 20 cycles of 98C for 25 seconds 60C for 1 minute 68C for 20 minutes cDNA was digested with AluI and RsaI restriction enzymes NEB. Blunt end enzymatic fragmentation of cDNA was used instead of sonication and gel extraction to minimize loss of sample material and eliminate the end repair step of Illumina library preparation. Since this reduced representation strategy might miss short cDNAs that lack both restriction sites we sought to avoid this by including enzyme recognition sites within the cDNA amplification primers. This allows for the inclusion of short cDNAs in our libraries. Standard Illumina library preparations followed performed by the Genome Technology Access Center GTAC at Washington University in St. Louis http://gtac.wustl.edu. In brief a single A was added to the 3’ end of each strand Y adapters ligated and library enrichment PCR performed followed by gel extraction size selection for fragments ranging from 200 400 base pairs in length. Illumina library construction of pooled 3dpf embryos was performed by GTAC from total RNA extracted with Trizol reagent as previously described [45]. No PCR amplification of whole embryo cDNA was performed prior to Illumina adapter ligation and library enrichment. Sequencing was performed on the GAIIX Illumina platform.,GEO Accession:GSM1129607,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP021517,,,dm_58h_23_351_GAAT.fq.bz2,fastq,106123464.0,2947874.0,GSM1129607 r1,0:36,A:26495114;C:26882652;G:25518440;T:27226454;N:804,36,,,,26495114,26882652,25518440,27226454,804,SRX271945,SRS416241,SRA074390,GEO,"Rob Mitra, Genetics, Washington University",1,0.78561,,0.06331,,0.85107,,0.46073,,36,,B,,usable mapping rate,illumina,hiseq_era,3prime,poly_a,unknown,bulk,unknown,unknown,,United States,2013-04-25,Larval,Larval,Skin,Surface Structure 38116,SRR1551799,SRX681419,SRS685080,SRP045504,PRJNA258223,Danio rerio strain:TL Transcriptome or Gene expression,PRJNA258223,Other,Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos,,,,keratocytes from 4dpf embryos,keratocytes from 4dpf embryos,,breed:TL|strain:TL|age:4dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:4dpf|BioSampleModel:Model organism or animal,,,,,,,,,transcriptome from 4dpf keratocytes replicate 3,4dpf 3,4dpf 3,RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,400Application ReadForward1,SRP045504,,,lane4_4dpf707.fastq,fastq,1001179200.0,25029480.0,4dpf 3,0:40,A:253770714;C:242097985;G:244642013;T:260557997;N:110491,40,,,,253770714,242097985,244642013,260557997,110491,SRX681419,SRS685080,SRA179326,Stanford University|Julie Theriot,Stanford University,1,0.90546,,0.2101,,0.75185,,0.49242,,40,,B,,usable mapping rate,illumina,early_illumina,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2015-04-07,Larval,Larval,Skin,Surface Structure 38117,SRR1551798,SRX681418,SRS685080,SRP045504,PRJNA258223,Danio rerio strain:TL Transcriptome or Gene expression,PRJNA258223,Other,Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos,,,,keratocytes from 4dpf embryos,keratocytes from 4dpf embryos,,breed:TL|strain:TL|age:4dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:4dpf|BioSampleModel:Model organism or animal,,,,,,,,,Transcriptome from 4dpf keratocytes replicate 2,4dpf 2,4dpf 2,RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,400Application ReadForward1,SRP045504,,,lane7_4col.fastq,fastq,1700157430.0,44740985.0,4dpf 2,0:38,A:394789834;C:418821057;G:504852317;T:369111176;N:12583046,38,,,,394789834,418821057,504852317,369111176,12583046,SRX681418,SRS685080,SRA179326,Stanford University|Julie Theriot,Stanford University,1,0.68441,,0.12529,,0.8338,,0.45494,,38,,B,,usable mapping rate,illumina,early_illumina,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-08-14,Larval,Larval,Skin,Surface Structure 38118,SRR1551797,SRX681417,SRS685080,SRP045504,PRJNA258223,Danio rerio strain:TL Transcriptome or Gene expression,PRJNA258223,Other,Transcriptome profiling of keratocytes derived from 2dpf and 4dpf embryos,,,,keratocytes from 4dpf embryos,keratocytes from 4dpf embryos,,breed:TL|strain:TL|age:4dpf|biomaterial provider:Julie Theriot Stanford University|sex:not collected|tissue:keratocytes skin|cell type:keratocyte|dev stage:4dpf|BioSampleModel:Model organism or animal,,,,,,,,,4dpf keratocyte transcriptome replicate 1,4dpf 1,4dpf 1,RNA was extracted from approximately 1 x 105 keratocytes per sample using Trizol Invitrogen. Three biological replicates were collected for each developmental stage. Ribosomal RNA was depleted using the Ribo Zero magnetic kit Epicentre. The remaining mRNA was then fragmented with 8 minutes incubation in 50mM sodium carbonate/bicarbonate 1mM EDTA pH 9.2 at 95 degrees. To prepare cDNA first strand synthesis was performed with Superscript III Invitrogen using random hexamer priming and second strand synthesis was performed with DNA Polymerase I NEB. Illumina libraries were prepared from the cDNA in an automated fashion using the Illumina TruSeq sample prep kit with TruSeq adapters on a SPRIworks System I Beckman Coulter. Sequencing reactions were performed on an Illumina Genome Analyzer IIX according to manufacturer’s instructions to generate 40nt single ended reads.,,,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,470Application ReadForward1,SRP045504,,,lane7_1_4dpf.fastq,fastq,762138229.0,16215707.0,4dpf 1,0:47,A:183899711;C:180347476;G:190086042;T:189460942;N:18344058,47,,,,183899711,180347476,190086042,189460942,18344058,SRX681417,SRS685080,SRA179326,Stanford University|Julie Theriot,Stanford University,1,0.85884,,0.2135,,0.80077,,0.50539,,47,,B,,usable mapping rate,illumina,early_illumina,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2014-08-15,Larval,Larval,Skin,Surface Structure 51261,SRR8632324,SRX5431025,SRS4411020,SRP186864,PRJNA524286,The miR 199 CDK2 axis modulates neutrophil migration and systemic inflammation,GSE127174,Transcriptome Analysis,We performed RNAseq to identify miRNAs that were specifically down regulated in neutrophils and RNAseq for identification of mRNA targets of miRNA 199 in neutrophils Overall design: for miRNA profiles we compared the miRNA present in zebrafish neutrophils and keratinocytes to the whole embryo. for miR 199 target identification we sequenced messenger RNAs in zebrafish neutrophils over expressing miR199 or vector control,,pubmed:31451657,,Krt4+,GSM3629719,,source name:keratinocytes|strain background:AB|gentoype/variation:wild type|tissue:keratinocytes,Krt4+,"Base calling and quality scoreing were performed by Real Time Analysis RTA v2 in Illumina HiSeq 2500 for Samples 1 5 in Illumina HiSeq 4000 for Samples 6 11. The bcl2fastq2 Conversion software were used to convert base call bcl files to FASTQ files and trim adapter sequence at the same time. The reads were mapped to the zebrafish genome using STAR v2.5 RNA seq aligner with the following parameter: for Samples 1 5: “ alignEndsType EndToEnd outFilterMismatchNmax 1 outFilterMultimapScoreRange 0 outFilterMultimapNmax 10 outSAMunmapped Within outFilterScoreMinOverLread 0 outFilterMatchNminOverLread 0 outFilterMatchNmin 16 alignSJDBoverhangMin 1000” for Samples 6 11: “ outSAMmapqUnique 60”. Uniquely mapped sequencing reads were assigned to genes using featureCounts from subread v1.5.1 with the following parameters: for Samples 1 5: “ s 1 –Q 10” for Samples 6 11 "" p Q 10"". The data was filtered: for Samples 1 5 using read count > 10 in more than 1 of the samples; for Samples 6 11 using read count per million CPM > 0.5 in more than 3 of the samples normalized using TMM trimmed mean of M values method and subjected to differential expression analysis using edgeR v3.20.8. Genome build: GRCz11 Supplementary files format and content: Raw counts",keratinocytes,transgenic zebrafish lines were used to produce embryos. For miRNA profiling transgenic lines expressing GFP in either neutrophils or apical keratincyes were used. For miR 199 target discovery transgenic lines expressing miR 199 or a vector control together with a GFP reporter were used.,tissue specific isolation: cells were labeled with fluorescent reporters and isolated from 3dpf zebrafish embryos using FACS. mRNA was extracted using Qiagen RNeasy Mini Kit and total RNA was extracted using Invirtogen mirVANA kit for miRNA sequencing. miRNA sequencing library were constructed using Illumina TruSeq Small RNA Preparation and 145 160bp band are excised for sequencing. mRNA sequencing library were constructed withSMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara Clontech Laboratories Inc..,zebrafish embryos were grown to 3 dpf in embryonic media,strain background:AB|gentoype/variation:wild type|tissue:keratinocytes,GSM3629719,GSM3629719: Krt4+; Danio rerio; RNA Seq,GSM3629719,,1,tissue specific isolation: cells were labeled with fluorescent reporters and isolated from 3dpf zebrafish embryos using FACS. mRNA was extracted using Qiagen RNeasy Mini Kit and total RNA was extracted using Invirtogen mirVANA kit for miRNA sequencing. miRNA sequencing library were constructed using Illumina TruSeq Small RNA Preparation and 145 160bp band are excised for sequencing. mRNA sequencing library were constructed withSMART Seq v4 Ultra Low Input RNA Kit for Sequencing Takara Clontech Laboratories Inc..,GEO Accession:GSM3629719,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP186864,,,krt4.fastq.gz,fastq,101078150.0,2021563.0,GSM3629719 r1,0:50,A:18002613;C:22778088;G:30701792;T:29589610;N:6047,50,,,,18002613,22778088,30701792,29589610,6047,SRX5431025,SRS4411020,SRA852308,GEO,"Department of Biological Sciences, Purdue University",1,0.05911,,0.00807,,0.97461,,0.77586,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,trueseq,sc,single_cell_plate,smartseq,,United States,2019-02-26,Larval,Larval,Skin,Surface Structure 52249,SRR9050626,SRX5827017,SRS4754831,SRP198298,PRJNA542704,Thyroid hormone regulates distinct paths to maturation in pigment cell lineages,GSE131136,Transcriptome Analysis,Early and post embryonic neural crest derived lineages in the zebrafish trunk in response to thyroid hormone modulation Overall design: Single cell RNA seq experiments were performed on the 10X Genomics platform from FAC sorted Sox10:CRE positive cells from 5dpf and post embryonic zebrafish trunks with and without xxx hormone.,,pubmed:31140974;pubmed:33933422,,Neural crest derived cells from hypothyroid post embryonic zebrafish skins biological replicate 2,GSM3764573,,tissue:sox10:Cre+ cells from post embryonic zebrafish skin tissue|cell type:3033 cells from Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB FAC sorted mCherry+ cells from trunks. Fish range in stage from 7.2 10.4 SSL stage zebrafish. Thyroid ablation was performed at 4 dpf with metronidazole treatment.|treatment:Hypothyroid,Neural crest derived cells from hypothyroid post embryonic zebrafish skins biological replicate 2,Expression matrix files and BAM files were generated using cellranger 10X genomics version 2.0.2 as described by the manufacturer using the commands cellranger demux and cellranger count. UMI count matrices representing the filtered set of barcodes representing cells were used as determined by cellranger. All samples were aggregated using the aggregate option in cellranger to normalize mean number of reads per cell across 10X libraries. Genome build: GRCz11 Supplementary files format and content: Expression matrix files and BAM files were generated using cellranger 10X genomics version 2.0.2 as described by the manufacturer using the commands cellranger demux and cellranger count. UMI count matrices representing the filtered set of barcodes representing cells were used as determined by cellranger. Expression matrices are output by cellranger and are in Matrix Market Exchange format and the gene and cell barcode name files that accompany these file are provided as TSV files.,sox10:Cre+ cells from post embryonic zebrafish skin tissue,Transgenic zebrafish Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB were treated either metronidazole 10mM or a vehicle control DMSO at 4dpf. Trunks or skins were collected at a stage range of 7.2 10.4 SSL or 5 dpf as indicated in the sample name. Tissue was dissociated into a single cell suspension and FAC sorted for the presence of mCherry. Then cells were washed and loaded into the 10X chromium chip according to manufacturer recommendations.,10X genomics single cell gene expression V2 protocol following manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations.,Zebrafish were maintained at 28.5 °C under 14:10 light:dark cycles. All thyroid ablated Mtz treated and control DMSO treated Tgtg:nVenus v2a nfnB fish were kept under TH free conditions and were fed only Artemia rotifers enriched with TH free Algamac Aquafauna and bloodworms.,cell type:3033 cells from Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB FAC sorted mCherry+ cells from trunks. Fish range in stage from 7.2 10.4 SSL stage zebrafish. Thyroid ablation was performed at 4 dpf with metronidazole treatment.|treatment:Hypothyroid,GSM3764573,GSM3764573: Neural crest derived cells from hypothyroid post embryonic zebrafish skins biological replicate 2; Danio rerio; RNA Seq,GSM3764573,,1,10X genomics single cell gene expression V2 protocol following manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP198298,,dangling references:treat as unmapped,hypo6_possorted_genome_bam.bam,10X Genomics bam file,7642585251.0,134080443.0,GSM3764573 r1,0:57,A:2330102138;C:1530481079;G:1741129436;T:2036914417;N:3958181,57,,,,2330102138,1530481079,1741129436,2036914417,3958181,SRX5827017,SRS4754831,SRA886020,GEO,"Biology, University of Virginia",1,0.92859,,0.20322,,0.83019,,0.51386,,57,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,United States,2019-05-13,Larval,Larval,Skin,Surface Structure 52255,SRR9050620,SRX5827011,SRS4754825,SRP198298,PRJNA542704,Thyroid hormone regulates distinct paths to maturation in pigment cell lineages,GSE131136,Transcriptome Analysis,Early and post embryonic neural crest derived lineages in the zebrafish trunk in response to thyroid hormone modulation Overall design: Single cell RNA seq experiments were performed on the 10X Genomics platform from FAC sorted Sox10:CRE positive cells from 5dpf and post embryonic zebrafish trunks with and without xxx hormone.,,pubmed:31140974;pubmed:33933422,,Neural crest derived cells from euthyroid post embryonic zebrafish skins biological replicate 2,GSM3764567,,tissue:sox10:Cre+ cells from post embryonic zebrafish skin tissue|cell type:3008 cells from Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB FAC sorted mCherry+ cells from skins. Zebrafish range in stage from 7.2 10.4 SSL.|treatment:Euthyroid,Neural crest derived cells from euthyroid post embryonic zebrafish skins biological replicate 2,Expression matrix files and BAM files were generated using cellranger 10X genomics version 2.0.2 as described by the manufacturer using the commands cellranger demux and cellranger count. UMI count matrices representing the filtered set of barcodes representing cells were used as determined by cellranger. All samples were aggregated using the aggregate option in cellranger to normalize mean number of reads per cell across 10X libraries. Genome build: GRCz11 Supplementary files format and content: Expression matrix files and BAM files were generated using cellranger 10X genomics version 2.0.2 as described by the manufacturer using the commands cellranger demux and cellranger count. UMI count matrices representing the filtered set of barcodes representing cells were used as determined by cellranger. Expression matrices are output by cellranger and are in Matrix Market Exchange format and the gene and cell barcode name files that accompany these file are provided as TSV files.,sox10:Cre+ cells from post embryonic zebrafish skin tissue,Transgenic zebrafish Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB were treated either metronidazole 10mM or a vehicle control DMSO at 4dpf. Trunks or skins were collected at a stage range of 7.2 10.4 SSL or 5 dpf as indicated in the sample name. Tissue was dissociated into a single cell suspension and FAC sorted for the presence of mCherry. Then cells were washed and loaded into the 10X chromium chip according to manufacturer recommendations.,10X genomics single cell gene expression V2 protocol following manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations.,Zebrafish were maintained at 28.5 °C under 14:10 light:dark cycles. All thyroid ablated Mtz treated and control DMSO treated Tgtg:nVenus v2a nfnB fish were kept under TH free conditions and were fed only Artemia rotifers enriched with TH free Algamac Aquafauna and bloodworms.,cell type:3008 cells from Tgsox10:Cre; ubi:switch; tg:nVenus 2a nfnB FAC sorted mCherry+ cells from skins. Zebrafish range in stage from 7.2 10.4 SSL.|treatment:Euthyroid,GSM3764567,GSM3764567: Neural crest derived cells from euthyroid post embryonic zebrafish skins biological replicate 2; Danio rerio; RNA Seq,GSM3764567,,1,10X genomics single cell gene expression V2 protocol following manufacturer recommendations. 10X genomics single cell gene expression V2 protocol following manufacturer recommendations.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP198298,,dangling references:treat as unmapped,eu5_possorted_genome_bam.bam,10X Genomics bam file,7562050749.0,132667557.0,GSM3764567 r1,0:57,A:2291130941;C:1508834109;G:1752506997;T:2005478206;N:4100496,57,,,,2291130941,1508834109,1752506997,2005478206,4100496,SRX5827011,SRS4754825,SRA886020,GEO,"Biology, University of Virginia",1,0.92351,,0.19606,,0.82913,,0.5204,,57,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,United States,2019-05-13,Larval,Larval,Skin,Surface Structure 52806,SRR9211497,SRX5982387,SRS4887892,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,72 hpf all skin replicate A,GSM3855905,,source name:FACS isolated all skin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,72 hpf all skin replicate A,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated all skin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:72 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,GSM3855905,GSM3855905: 72 hpf all skin replicate A; Danio rerio; RNA Seq,GSM3855905,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855905,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP200656,,,ZFishSkin_Reads_c19_72hpf-allSkin-_repA_i07.CAGATCA.pf1_XA025L6.fastq.gz,fastq,1109562250.0,22191245.0,GSM3855905 r1,0:50,A:277535095;C:268480388;G:273593744;T:285667284;N:4285739,50,,,,277535095,268480388,273593744,285667284,4285739,SRX5982387,SRS4887892,SRA894819,GEO,UCLA,1,0.91322,,0.0619,,0.7763,,0.40372,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Larval,Larval,Skin,Surface Structure 52807,SRR9211496,SRX5982386,SRS4887891,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,72 hpf nonskin1 replicate B,GSM3855904,,source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,72 hpf nonskin1 replicate B,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated nonskin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,GSM3855904,GSM3855904: 72 hpf nonskin1 replicate B; Danio rerio; RNA Seq,GSM3855904,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855904,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP200656,,,ZFishSkin_Reads_c18_72hpf-nonskin1_repB_i12.CTTGTAA.pf1_XA027L8.fastq.gz,fastq,1251653750.0,25033075.0,GSM3855904 r1,0:50,A:332120369;C:300029575;G:291543941;T:327925643;N:34222,50,,,,332120369,300029575,291543941,327925643,34222,SRX5982386,SRS4887891,SRA894819,GEO,UCLA,1,0.9349,,0.0985,,0.67947,,0.48474,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Larval,Larval,Skin,Surface Structure 52808,SRR9211495,SRX5982385,SRS4887890,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,72 hpf nonskin1 replicate A,GSM3855903,,source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,72 hpf nonskin1 replicate A,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated nonskin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin1|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,GSM3855903,GSM3855903: 72 hpf nonskin1 replicate A; Danio rerio; RNA Seq,GSM3855903,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855903,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP200656,,,ZFishSkin_Reads_c17_72hpf-nonskin1_repA_i12.CTTGTAA.pf1_XA025L6.fastq.gz,fastq,1060666050.0,21213321.0,GSM3855903 r1,0:50,A:268147841;C:255427855;G:259996073;T:272974158;N:4120123,50,,,,268147841,255427855,259996073,272974158,4120123,SRX5982385,SRS4887890,SRA894819,GEO,UCLA,1,0.91743,,0.1009,,0.68972,,0.47802,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Larval,Larval,Skin,Surface Structure 52826,SRR9211500,SRX5982367,SRS4887872,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,72 hpf nonskin2 replicate B,GSM3855908,,source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP,72 hpf nonskin2 replicate B,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated nonskin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP,GSM3855908,GSM3855908: 72 hpf nonskin2 replicate B; Danio rerio; RNA Seq,GSM3855908,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855908,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP200656,,,ZFishSkin_Reads_c22_72hpf-nonskin2_repB_i02.CGATGTA.pf1_LB010L6.fastq.gz,fastq,1625988936.0,31882136.0,GSM3855908 r1,0:51,A:429321517;C:384417974;G:385248218;T:426975311;N:25916,51,,,,429321517,384417974,385248218,426975311,25916,SRX5982367,SRS4887872,SRA894819,GEO,UCLA,1,0.92588,,0.10534,,0.69252,,0.47138,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Larval,Larval,Skin,Surface Structure 52827,SRR9211499,SRX5982366,SRS4887871,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,72 hpf nonskin2 replicate A,GSM3855907,,source name:FACS isolated nonskin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP,72 hpf nonskin2 replicate A,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated nonskin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:72 hpf|tissue:FACS nonskin2|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed;krt5:GFP,GSM3855907,GSM3855907: 72 hpf nonskin2 replicate A; Danio rerio; RNA Seq,GSM3855907,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855907,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP200656,,,ZFishSkin_Reads_c21_72hpf-nonskin2_repA_i02.CGATGTA.pf1_VA061L6.fastq.gz,fastq,1389960069.0,27254119.0,GSM3855907 r1,0:51,A:367360698;C:329372505;G:329231934;T:363977069;N:17863,51,,,,367360698,329372505,329231934,363977069,17863,SRX5982366,SRS4887871,SRA894819,GEO,UCLA,1,0.92962,,0.10905,,0.68357,,0.47722,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Larval,Larval,Skin,Surface Structure 52828,SRR9211498,SRX5982365,SRS4887870,SRP200656,PRJNA547573,Tissue specific transcriptomes reveal gene expression trajectories in two maturing skin epithelial layers in zebrafish embryos,GSE132304,Transcriptome Analysis,We purified FACS and profiled RNA Seq zebrafish embryo skin cells vs. nonskin cells at three early developmental stages. At two of the stages we further purified and profiled two distinct epithelial layers of the skin: the periderm and basal cells. Our comprehensive expression analysis provides the first reported transcriptomes of these two cell types reveals gene expression dynamics in space and time and identifies common and distinct features of epithelial maturation in the two layers. Given the conserved nature of skin development we believe our study to be of interest to those studying skin in other vertebrates. Overall design: At each of 20 SS 52 hpf and 72 hpf we used krt4:dsRed transgenic zebrafish embryos and FACS to prepare and run two RNA Seq conditions: all skin vs. nonskin1 with two replicates for each condition. At each of 52 hpf and 72 hpf we used krt4:dsRed;krt5:GFP transenic zebrafish embryos and FACS to prepare and run three RNA Seq conditions: periderm vs. basal cells vs. nonskin2 with two replicates for each condition except 52 hpf nonskin2 has only one replicate.,,pubmed:31431477,,72 hpf all skin replicate B,GSM3855906,,source name:FACS isolated all skin cells from whole embryos|strain:AB+TU|developmental stage:72 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,72 hpf all skin replicate B,Demultiplexing: single mismatch to expected 7 mers only keeping PF=1 spots Adapter low quality base trimming: CutAdapt 1.8.1 m 21 trim n max n=2 q 10 10 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC then only keeping reads >=47 nt long and only keeping the first 47 nt of those reads Alignment: STAR 2.5.3a to genome and transcriptome single pass mode with known junctions retaining multiple locations for non uniquely aligning reads see paper or BAMs for parameters Quantification: Salmon patched 0.10.2 numGibbsSamples=1000 thinningFactor=25 useVBOpt libType=U fldMean=200 fldSD=200 rangeFactorizationBins=4 minAssignedFrags=1 seqBias noBiasLengthThreshold with 1 000 Gibbs samples per experiment Statistics: see paper; similar to R Bioconductor Sleuth with Wasabi as importer but elaborated and with some DESeq2 features incorporated Genome build: Ensembl release 92 top level reference Zebrafish genome GRCz11 chr1..25 + MT + 847/120 KN/KZ scaffolds + PhiX and associated Ensembl genebuild annotations/models Supplementary files format and content: GZIP TAR Salmon files: GZIP compressed TAR archives of Salmon transcript quantification output filesystem trees. Supplementary file: Microsoft Excel workbook in XLSX format with multiple worksheets containing a comprehensive collection of analysis input data intermediate steps and statistical outputs see column headers as well as Methods and Supplemental methods of the associated journal publication.,FACS isolated all skin cells from whole embryos,Transgenic embryos without xxx treatment,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer’s solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,Zebrafish were maintained in 28.5 C and pH 7.5 fish water. Adults were kept in a 14 hour light / 10 hour dark cycle.,strain:AB+TU|developmental stage:72 hpf|tissue:FACS all skin|Sex:pooled male and female|biomaterial provider:Fang Wang CSUDH|birth location:UCLA|genotype:krt4:DsRed,GSM3855906,GSM3855906: 72 hpf all skin replicate B; Danio rerio; RNA Seq,GSM3855906,,1,Dechorionated embryos were transferred into 1.5 ml tubes and rinsed with Ca2+ free Ringer's solution for 15 min. During this incubation yolk was removed by gently pipetting embryos through a 200 µl tip with the end cut off three to five times. Yolk free embryos were transferred into a 35 mm petri dish with 5 ml of 0.25% Trypsin EDTA. Embryos were incubated at 28.5 °C and homogenized with a 200 µl tip every 10 min until most cells were dissociated 20 to 50 min. 55 µl 100 mM CaCl2 and 550 µl FCS were added to stop digestion. Dissociated cells were transferred into a 15 ml tube and centrifuged at 300 g for 5 min at 15 °C. Cells were rinsed once with 10 ml suspension solution colorless Leibovitz medium L 15 with 0.3 g/L glutamine 0.8 mM CaCl2 Pen 50U/ml Strep 0.05 mg/ml and 1% FCS. Dissociated cells were resuspended in suspension solution to 10^7 cells/ml and immediately proceeded to cell sorting at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD FACS ARIA II SORP instruments sorted cells using a 488 nm laser for GFP detection and a 561 nm laser for RFP dsRed detection. Sorted cells in suspension solution were immediately lysed using the Qiagen RNeasy kit. Lysis was completed within two hours of dissociating cells. Total RNA was isolated following the Qiagen RNeasy kit and stored at –80 °C. Quality of all samples was assayed with an Agilent Bioanalyzer and only samples with RNA Integrity Number > 8 were used for creating sequencing libraries. Poly A bead purified RNA Seq libraries were prepared with the Illumina TruSeq RNA Library Prep Kit.,GEO Accession:GSM3855906,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP200656,,,ZFishSkin_Reads_c20_72hpf-allSkin-_repB_i07.CAGATCA.pf1_XA027L8.fastq.gz,fastq,1297550200.0,25951004.0,GSM3855906 r1,0:50,A:336310605;C:318264536;G:308821981;T:334116972;N:36106,50,,,,336310605,318264536,308821981,334116972,36106,SRX5982365,SRS4887870,SRA894819,GEO,UCLA,1,0.93422,,0.06011,,0.76345,,0.40589,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United States,2019-06-06,Larval,Larval,Skin,Surface Structure 67681,SRR17247014,SRX13426037,SRS11327031,SRP351072,PRJNA789095,Danio rerio Raw sequence reads,PRJNA789095,Whole Genome Sequencing,normal of RNA seq of danio rerio,,,,,A2,,isolate:not collected|age:17dpf|sex:pooled male and female|tissue:scaly skin|replicate:replicate=biological replicate A2|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of danio rerio,S334,S334,normal RNA seq of danio rerio,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP351072,,,A2_S58_R1_001.fastq.gz A2_S58_R2_001.fastq.gz,fastq fastq,5616555000.0,18721850.0,A2 S58 R1 001.fastq.gz,0:150 1:150,A:1448598133;C:1350283389;G:1368707125;T:1446502716;N:2463637,150,150,,,1448598133,1350283389,1368707125,1446502716,2463637,SRX13426037,SRS11327031,SRA1344321,shanghai ocean university|college of marine sciences,shanghai ocean university,2,0.96958,0.97206,0.03246,0.03194,0.74659,0.74809,0.48122,0.48632,150,150,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2021-12-16,Larval,Larval,Skin,Surface Structure 67682,SRR17247015,SRX13426036,SRS11327029,SRP351072,PRJNA789095,Danio rerio Raw sequence reads,PRJNA789095,Whole Genome Sequencing,normal of RNA seq of danio rerio,,,,,A1,,isolate:not collected|age:17dpf|sex:pooled male and female|tissue:scaly skin|replicate:replicate=biological replicate A1|BioSampleModel:Model organism or animal,,,,,,,,,RNAseq of danio rerio,S333,S333,normal RNA seq of danio rerio,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 4000,,SRP351072,,,A1_S57_R1_001.fastq.gz A1_S57_R2_001.fastq.gz,fastq fastq,4007594400.0,13358648.0,A1 S57 R1 001.fastq.gz,0:150 1:150,A:1045509577;C:951632697;G:972694338;T:1035964441;N:1793347,150,150,,,1045509577,951632697,972694338,1035964441,1793347,SRX13426036,SRS11327029,SRA1344321,shanghai ocean university|college of marine sciences,shanghai ocean university,2,0.96027,0.96204,0.03269,0.03149,0.76686,0.76749,0.44581,0.46233,150,150,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,unknown,bulk,unknown,unknown,,China,2021-12-16,Larval,Larval,Skin,Surface Structure 71771,SRR22094615,SRX18074634,SRS15579669,SRP405171,PRJNA893397,RNA sequencing of the zebrafish superficial epithelial cells,PRJNA893397,Other,"We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it ""asynthetic fission"". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.",,,replicate,SEC 21dpf r,SEC 21dpf r,,strain:EK|age:21dpf|dev stage:21dpf|sex:NA|tissue:skin superficial epithelial cell|BioSampleModel:Model organism or animal,,,,,,,,,RNA sequencing of zebrafish:superficial epithelial cells 21dpf replicate,LTS21 YW06,LTS21 YW06,100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,NextSeq 2000,,SRP405171,,,LTS21_YW06_S8_L001_R1_001.fastq.gz LTS21_YW06_S8_L001_R2_001.fastq.gz,fastq fastq,18884108924.0,62530162.0,LTS21 YW06 S8 L001 R1 001.fastq.gz,0:151 1:151,A:4928408237;C:4582387963;G:4378535805;T:4978379185;N:16397734,151,151,,,4928408237,4582387963,4378535805,4978379185,16397734,SRX18074634,SRS15579669,SRA1530145,Academia Sinica|Institute of Cellular and Organismic Biology,Academia Sinica,2,0.78046,0.77311,0.03967,0.03852,0.76834,0.76962,0.48776,0.49055,151,151,B,B,biological fallback assumption,illumina,nextseq_v2,unknown,poly_a,unknown,bulk,unknown,unknown,,Taiwan,2022-10-29,Larval,Larval,Skin,Surface Structure 71772,SRR22094620,SRX18074633,SRS15579668,SRP405171,PRJNA893397,RNA sequencing of the zebrafish superficial epithelial cells,PRJNA893397,Other,"We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it ""asynthetic fission"". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.",,,,SEC 21dpf,Zebrafish SEC 21dpf,,strain:EK|age:21dpf|dev stage:21dpf|sex:NA|tissue:Skin|BioSampleModel:Model organism or animal,,,,,,,,,RNA sequencing of zebrafish:superficial epithelial cells 21dpf,LTS21 YW05,LTS21 YW05,100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,NextSeq 2000,,SRP405171,,,LTS21_YW05_S7_L001_R1_001.fastq.gz LTS21_YW05_S7_L001_R2_001.fastq.gz,fastq fastq,19711202968.0,65268884.0,LTS21 YW05 S7 L001 R1 001.fastq.gz,0:151 1:151,A:5117592567;C:4797244360;G:4551347423;T:5228007671;N:17010947,151,151,,,5117592567,4797244360,4551347423,5228007671,17010947,SRX18074633,SRS15579668,SRA1530145,Academia Sinica|Institute of Cellular and Organismic Biology,Academia Sinica,2,0.76712,0.76186,0.039,0.03769,0.76637,0.76692,0.45633,0.4647,151,151,B,B,biological fallback assumption,illumina,nextseq_v2,unknown,poly_a,unknown,bulk,unknown,unknown,,Taiwan,2022-10-29,Larval,Larval,Skin,Surface Structure 71773,SRR22094616,SRX18074632,SRS15579667,SRP405171,PRJNA893397,RNA sequencing of the zebrafish superficial epithelial cells,PRJNA893397,Other,"We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it ""asynthetic fission"". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.",,,replicate,SEC 14dpf r,SEC 14dpf r,,strain:EK|age:14dpf|dev stage:14dpf|sex:NA|tissue:skin superficial epithelial cell|BioSampleModel:Model organism or animal,,,,,,,,,RNA sequencing of zebrafish:superficial epithelial cells 14dpf replicate,LTS21 YW04,LTS21 YW04,100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,NextSeq 2000,,SRP405171,,,LTS21_YW04_S6_L001_R1_001.fastq.gz LTS21_YW04_S6_L001_R2_001.fastq.gz,fastq fastq,18505626216.0,61276908.0,LTS21 YW04 S6 L001 R1 001.fastq.gz,0:151 1:151,A:4873584588;C:4461374730;G:4234634486;T:4920008051;N:16024361,151,151,,,4873584588,4461374730,4234634486,4920008051,16024361,SRX18074632,SRS15579667,SRA1530145,Academia Sinica|Institute of Cellular and Organismic Biology,Academia Sinica,2,0.76819,0.76283,0.05352,0.05251,0.76765,0.76838,0.50479,0.49192,151,151,B,B,biological fallback assumption,illumina,nextseq_v2,unknown,poly_a,unknown,bulk,unknown,unknown,,Taiwan,2022-10-29,Larval,Larval,Skin,Surface Structure 71774,SRR22094619,SRX18074631,SRS15579666,SRP405171,PRJNA893397,RNA sequencing of the zebrafish superficial epithelial cells,PRJNA893397,Other,"We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it ""asynthetic fission"". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.",,,,SEC 14dpf,Zebrafish SEC 14dpf,,strain:EK|age:14dpf|dev stage:14dpf|sex:NA|tissue:Skin|BioSampleModel:Model organism or animal,,,,,,,,,RNA sequencing of zebrafish:superficial epithelial cells 14dpf,LTS21 YW03,LTS21 YW03,100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,NextSeq 2000,,SRP405171,,,LTS21_YW03_S5_L001_R1_001.fastq.gz LTS21_YW03_S5_L001_R2_001.fastq.gz,fastq fastq,20010150956.0,66258778.0,LTS21 YW03 S5 L001 R1 001.fastq.gz,0:151 1:151,A:5185539519;C:4876294580;G:4677668447;T:5253656025;N:16992385,151,151,,,5185539519,4876294580,4677668447,5253656025,16992385,SRX18074631,SRS15579666,SRA1530145,Academia Sinica|Institute of Cellular and Organismic Biology,Academia Sinica,2,0.78205,0.77596,0.04076,0.03939,0.78248,0.78293,0.4586,0.46807,151,151,B,B,biological fallback assumption,illumina,nextseq_v2,unknown,poly_a,unknown,bulk,unknown,unknown,,Taiwan,2022-10-29,Larval,Larval,Skin,Surface Structure 71775,SRR22094617,SRX18074630,SRS15579665,SRP405171,PRJNA893397,RNA sequencing of the zebrafish superficial epithelial cells,PRJNA893397,Other,"We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it ""asynthetic fission"". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.",,,replicate,SEC 6dpf r,SEC 6dpf r,,strain:EK|age:6dpf|dev stage:6dpf|sex:NA|tissue:skin superficial epithelial cell|BioSampleModel:Model organism or animal,,,,,,,,,RNA sequencing of zebrafish:superficial epithelial cells 6dpf replicate,LTS21 YW02,LTS21 YW02,100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,NextSeq 2000,,SRP405171,,,LTS21_YW02_S4_L001_R1_001.fastq.gz LTS21_YW02_S4_L001_R2_001.fastq.gz,fastq fastq,20220291918.0,66954609.0,LTS21 YW02 S4 L001 R1 001.fastq.gz,0:151 1:151,A:5407749316;C:4807063001;G:4510753168;T:5477213837;N:17512596,151,151,,,5407749316,4807063001,4510753168,5477213837,17512596,SRX18074630,SRS15579665,SRA1530145,Academia Sinica|Institute of Cellular and Organismic Biology,Academia Sinica,2,0.74742,0.74156,0.05378,0.05283,0.75118,0.75183,0.49329,0.49679,151,151,B,B,biological fallback assumption,illumina,nextseq_v2,unknown,poly_a,unknown,bulk,unknown,unknown,,Taiwan,2022-10-29,Larval,Larval,Skin,Surface Structure 71776,SRR22094618,SRX18074629,SRS15579664,SRP405171,PRJNA893397,RNA sequencing of the zebrafish superficial epithelial cells,PRJNA893397,Other,"We discovered that the superficial epithelial cells SECs of zebrafish larvae could adapt a unique kind of cell division during rapid growth conditions. We termed it ""asynthetic fission"". We determined that asynthetic fission occurs in the absence of DNA replication generating progeny cells with reduced genome size. Here we aim to define the transcriptional landscape of the SECs during asynthetic fission by applying RNA sequencing.",,,,SEC 6dpf,Zebrafish SEC 6dpf,,strain:EK|age:6dpf|dev stage:6dpf|sex:NA|tissue:Skin|BioSampleModel:Model organism or animal,,,,,,,,,RNA sequencing of zebrafish:superficial epithelial cells 6dpf,LTS21 YG02,LTS21 YG02,100 150 larvae at 2 dpf 6 dpf 14 dpf and 21 dpf were first rinsed with 1x DPBS Gibco 14190 144 then digested with collagenase Sigma C9891 and 0.25% trypsin EDTA Sigma T4049. Digestion was stopped with DMEM Gibco 11995 065 with 10% NCS and rinsed with 1 x DPBS. Then cells were suspended in DMEM 10% NCS and filtered with a 35 m cell strainer tube. Dissociated cells were stained with PI 1 g/ml for 106 cells per mL for 5 min in the dark. All EGFP+ and PI cells were sorted by FACSAria IIIu BD Biosciences. Cells were directly sorted in buffer RLT supplemented with 1% mercapto ethanol provided in RNeasy Micro kit Qiagen and stored in 80 C until RNA extraction was performed. Total 2 replicates for each timepoint were collected. RNA extraction was carried out using RNeasy Micro kit according to manufacturers instructions. Sequencing was performed by the NGS High Throughput Genomics Core in Biodiversity Research Center Academia Sinica Taiwan using Illumina NextSeq2000 with paired end 2 x 150 bp chemistry and a library selection of low input stranded RNA library preparation Poly A.,,,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,PAIRED,ILLUMINA,NextSeq 2000,,SRP405171,,,LTS21_YG02_S2_L001_R1_001.fastq.gz LTS21_YG02_S2_L001_R2_001.fastq.gz,fastq fastq,20584419962.0,68160331.0,LTS21 YG02 S2 L001 R1 001.fastq.gz,0:151 1:151,A:5411222042;C:4935924238;G:4703040707;T:5516534305;N:17698670,151,151,,,5411222042,4935924238,4703040707,5516534305,17698670,SRX18074629,SRS15579664,SRA1530145,Academia Sinica|Institute of Cellular and Organismic Biology,Academia Sinica,2,0.76895,0.7633,0.03985,0.03893,0.76481,0.76607,0.46945,0.46388,151,151,B,B,biological fallback assumption,illumina,nextseq_v2,unknown,poly_a,unknown,bulk,unknown,unknown,,Taiwan,2022-10-29,Larval,Larval,Skin,Surface Structure 74043,SRR23360139,SRX19301395,SRS16701439,SRP421311,PRJNA932229,Transcriptomic profiling of tissue environments critical for post embryonic patterning and morphogenesis of zebrafish skin,GSE224695,Other,Pigment patterns and skin appendages are prominent features of vertebrate skin. In zebrafish regularly patterned pigment stripes and an array of calcified scales form simultaneously in the skin during post embryonic development. Understanding mechanisms that regulate stripe patterning and scale morphogenesis may lead to discovery of fundamental mechanisms that govern development of animal form. To learn about cell types and potential signaling interactions that govern skin patterning and morphogenesis we generated and analyzed single cell transcriptomes of skin with genetic or induced defects in pigmentation and squamation. These data reveal a previously undescribed population of epidermal cells that express transcripts encoding enamel matrix proteins suggest hormonal control of epithelial mesenchymal signaling clarify the signaling network that governs scale papillae development and identify a critical role for the hypodermis in supporting pigment cell development. Additionally this comprehensive single cell transcriptome data from biomedically relevant skin conditions provide a useful resource to accelerate discovery of mechanisms governing skin development. Overall design: Dissected skin tissue from post embryonic zebrafish 9.6 SSL from four genetic backgrounds wild type eda mutant bnc2 mutant and hypothyroid were profiled with with sci RNA seq2.,,pubmed:37695017,,Multi genotype zebrafish skin snRNAseq,GSM7029635,,tissue:Whole skin tissue|cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid|geo loc name:missing|collection date:missing,Multi genotype zebrafish skin snRNAseq,The demultiplexing barcoded processing gene counting and aggregation were performed using the processing pipeline from Cao et al. 2017 doi: 10.1126/science.aam8940. Count matrix was loaded into Monocle3 for further analysis Assembly: GRCz11 Supplementary files format and content: Count Matrix RDS file Cell Metadata comma separated values .csv Gene Metadata comma separated values .csv Supplementary files format and content: zskin wildtype cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin wildtype raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin wildtype cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin wildtype gene metadata.csv: gene metadata table comma separated Supplementary files format and content: zskin all genotypes cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin all genotypes raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin all genotypes cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin all genotypes gene metadata.csv: gene metadata table comma separated,Whole skin tissue,Hypothyroid zebrafish Tgtg:nVenus v2a nfnBwprt8Tg underwent a metronidazole treatment to ablate the thyroid gland at 5 dpf.,Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.,Zebrafish were raised at 28.5℃ and selected for dissection based on staging landmarks Parichy et al. 2009.,cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid,GSM7029635,GSM7029635: Multi genotype zebrafish skin snRNAseq; Danio rerio; RNA Seq,GSM7029635 r1,GSM7029635,1,Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP421311,,loader:fastq load.py,zskin_sciRNA_seq1_R2_merge.fastq.gz zskin_sciRNA_seq1_R1_merge.fastq.gz,fastq fastq,11447467220.0,163535246.0,GSM7029635 r1,0:18 1:52,A:3502484926;C:2381891741;G:2327139583;T:3234563798;N:1387172,18,52,,,3502484926,2381891741,2327139583,3234563798,1387172,SRX19301395,SRS16701439,SRA1657186,"Genome Sciences, University of Washington","Genome Sciences, University of Washington",2,0.0,0.82847,0.0,0.51633,1.0,0.82692,,0.58473,18,52,T,B,sc-like readlen,illumina,nextseq,3prime,random_priming,unknown,sc,single_cell_plate,scirnaseq,,United States,2023-02-07,Larval,Larval,Skin,Surface Structure 74044,SRR23360140,SRX19301395,SRS16701439,SRP421311,PRJNA932229,Transcriptomic profiling of tissue environments critical for post embryonic patterning and morphogenesis of zebrafish skin,GSE224695,Other,Pigment patterns and skin appendages are prominent features of vertebrate skin. In zebrafish regularly patterned pigment stripes and an array of calcified scales form simultaneously in the skin during post embryonic development. Understanding mechanisms that regulate stripe patterning and scale morphogenesis may lead to discovery of fundamental mechanisms that govern development of animal form. To learn about cell types and potential signaling interactions that govern skin patterning and morphogenesis we generated and analyzed single cell transcriptomes of skin with genetic or induced defects in pigmentation and squamation. These data reveal a previously undescribed population of epidermal cells that express transcripts encoding enamel matrix proteins suggest hormonal control of epithelial mesenchymal signaling clarify the signaling network that governs scale papillae development and identify a critical role for the hypodermis in supporting pigment cell development. Additionally this comprehensive single cell transcriptome data from biomedically relevant skin conditions provide a useful resource to accelerate discovery of mechanisms governing skin development. Overall design: Dissected skin tissue from post embryonic zebrafish 9.6 SSL from four genetic backgrounds wild type eda mutant bnc2 mutant and hypothyroid were profiled with with sci RNA seq2.,,pubmed:37695017,,Multi genotype zebrafish skin snRNAseq,GSM7029635,,tissue:Whole skin tissue|cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid|geo loc name:missing|collection date:missing,Multi genotype zebrafish skin snRNAseq,The demultiplexing barcoded processing gene counting and aggregation were performed using the processing pipeline from Cao et al. 2017 doi: 10.1126/science.aam8940. Count matrix was loaded into Monocle3 for further analysis Assembly: GRCz11 Supplementary files format and content: Count Matrix RDS file Cell Metadata comma separated values .csv Gene Metadata comma separated values .csv Supplementary files format and content: zskin wildtype cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin wildtype raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin wildtype cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin wildtype gene metadata.csv: gene metadata table comma separated Supplementary files format and content: zskin all genotypes cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin all genotypes raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin all genotypes cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin all genotypes gene metadata.csv: gene metadata table comma separated,Whole skin tissue,Hypothyroid zebrafish Tgtg:nVenus v2a nfnBwprt8Tg underwent a metronidazole treatment to ablate the thyroid gland at 5 dpf.,Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.,Zebrafish were raised at 28.5℃ and selected for dissection based on staging landmarks Parichy et al. 2009.,cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid,GSM7029635,GSM7029635: Multi genotype zebrafish skin snRNAseq; Danio rerio; RNA Seq,GSM7029635 r1,GSM7029635,1,Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP421311,,loader:fastq load.py,zskin_sciRNA_seq2_R1_merge.fastq.gz zskin_sciRNA_seq2_R2_merge.fastq.gz,fastq fastq,36112843060.0,515897758.0,GSM7029635 r2,0:18 1:52,A:10807852102;C:7597254398;G:7380368668;T:10325233398;N:2134494,18,52,,,10807852102,7597254398,7380368668,10325233398,2134494,SRX19301395,SRS16701439,SRA1657186,"Genome Sciences, University of Washington","Genome Sciences, University of Washington",2,0.0,0.84202,0.0,0.54094,1.0,0.8411,,0.58834,18,52,T,B,sc-like readlen,illumina,nextseq,3prime,random_priming,unknown,sc,single_cell_plate,scirnaseq,,United States,2023-02-07,Larval,Larval,Skin,Surface Structure 74045,SRR23360141,SRX19301395,SRS16701439,SRP421311,PRJNA932229,Transcriptomic profiling of tissue environments critical for post embryonic patterning and morphogenesis of zebrafish skin,GSE224695,Other,Pigment patterns and skin appendages are prominent features of vertebrate skin. In zebrafish regularly patterned pigment stripes and an array of calcified scales form simultaneously in the skin during post embryonic development. Understanding mechanisms that regulate stripe patterning and scale morphogenesis may lead to discovery of fundamental mechanisms that govern development of animal form. To learn about cell types and potential signaling interactions that govern skin patterning and morphogenesis we generated and analyzed single cell transcriptomes of skin with genetic or induced defects in pigmentation and squamation. These data reveal a previously undescribed population of epidermal cells that express transcripts encoding enamel matrix proteins suggest hormonal control of epithelial mesenchymal signaling clarify the signaling network that governs scale papillae development and identify a critical role for the hypodermis in supporting pigment cell development. Additionally this comprehensive single cell transcriptome data from biomedically relevant skin conditions provide a useful resource to accelerate discovery of mechanisms governing skin development. Overall design: Dissected skin tissue from post embryonic zebrafish 9.6 SSL from four genetic backgrounds wild type eda mutant bnc2 mutant and hypothyroid were profiled with with sci RNA seq2.,,pubmed:37695017,,Multi genotype zebrafish skin snRNAseq,GSM7029635,,tissue:Whole skin tissue|cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid|geo loc name:missing|collection date:missing,Multi genotype zebrafish skin snRNAseq,The demultiplexing barcoded processing gene counting and aggregation were performed using the processing pipeline from Cao et al. 2017 doi: 10.1126/science.aam8940. Count matrix was loaded into Monocle3 for further analysis Assembly: GRCz11 Supplementary files format and content: Count Matrix RDS file Cell Metadata comma separated values .csv Gene Metadata comma separated values .csv Supplementary files format and content: zskin wildtype cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin wildtype raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin wildtype cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin wildtype gene metadata.csv: gene metadata table comma separated Supplementary files format and content: zskin all genotypes cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin all genotypes raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin all genotypes cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin all genotypes gene metadata.csv: gene metadata table comma separated,Whole skin tissue,Hypothyroid zebrafish Tgtg:nVenus v2a nfnBwprt8Tg underwent a metronidazole treatment to ablate the thyroid gland at 5 dpf.,Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.,Zebrafish were raised at 28.5℃ and selected for dissection based on staging landmarks Parichy et al. 2009.,cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid,GSM7029635,GSM7029635: Multi genotype zebrafish skin snRNAseq; Danio rerio; RNA Seq,GSM7029635 r1,GSM7029635,1,Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP421311,,loader:fastq load.py,zskin_sciRNA_seq3_R2_merge.fastq.gz zskin_sciRNA_seq3_R1_merge.fastq.gz,fastq fastq,23819946500.0,340284950.0,GSM7029635 r3,0:18 1:52,A:7652488300;C:4862634258;G:4789709798;T:6501533014;N:13581130,18,52,,,7652488300,4862634258,4789709798,6501533014,13581130,SRX19301395,SRS16701439,SRA1657186,"Genome Sciences, University of Washington","Genome Sciences, University of Washington",2,0.0,0.83093,0.0,0.53155,1.0,0.82986,,0.59518,18,52,T,B,sc-like readlen,illumina,nextseq,3prime,random_priming,unknown,sc,single_cell_plate,scirnaseq,,United States,2023-02-07,Larval,Larval,Skin,Surface Structure 74046,SRR23360142,SRX19301395,SRS16701439,SRP421311,PRJNA932229,Transcriptomic profiling of tissue environments critical for post embryonic patterning and morphogenesis of zebrafish skin,GSE224695,Other,Pigment patterns and skin appendages are prominent features of vertebrate skin. In zebrafish regularly patterned pigment stripes and an array of calcified scales form simultaneously in the skin during post embryonic development. Understanding mechanisms that regulate stripe patterning and scale morphogenesis may lead to discovery of fundamental mechanisms that govern development of animal form. To learn about cell types and potential signaling interactions that govern skin patterning and morphogenesis we generated and analyzed single cell transcriptomes of skin with genetic or induced defects in pigmentation and squamation. These data reveal a previously undescribed population of epidermal cells that express transcripts encoding enamel matrix proteins suggest hormonal control of epithelial mesenchymal signaling clarify the signaling network that governs scale papillae development and identify a critical role for the hypodermis in supporting pigment cell development. Additionally this comprehensive single cell transcriptome data from biomedically relevant skin conditions provide a useful resource to accelerate discovery of mechanisms governing skin development. Overall design: Dissected skin tissue from post embryonic zebrafish 9.6 SSL from four genetic backgrounds wild type eda mutant bnc2 mutant and hypothyroid were profiled with with sci RNA seq2.,,pubmed:37695017,,Multi genotype zebrafish skin snRNAseq,GSM7029635,,tissue:Whole skin tissue|cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid|geo loc name:missing|collection date:missing,Multi genotype zebrafish skin snRNAseq,The demultiplexing barcoded processing gene counting and aggregation were performed using the processing pipeline from Cao et al. 2017 doi: 10.1126/science.aam8940. Count matrix was loaded into Monocle3 for further analysis Assembly: GRCz11 Supplementary files format and content: Count Matrix RDS file Cell Metadata comma separated values .csv Gene Metadata comma separated values .csv Supplementary files format and content: zskin wildtype cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin wildtype raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin wildtype cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin wildtype gene metadata.csv: gene metadata table comma separated Supplementary files format and content: zskin all genotypes cds.RDS: monocle3 cell data set object Supplementary files format and content: zskin all genotypes raw counts.RDS: dgCMatrix with raw counts Supplementary files format and content: zskin all genotypes cell metadata.csv: cell metadata table comma separated Supplementary files format and content: zskin all genotypes gene metadata.csv: gene metadata table comma separated,Whole skin tissue,Hypothyroid zebrafish Tgtg:nVenus v2a nfnBwprt8Tg underwent a metronidazole treatment to ablate the thyroid gland at 5 dpf.,Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.,Zebrafish were raised at 28.5℃ and selected for dissection based on staging landmarks Parichy et al. 2009.,cell type:Whole skin tissue|developmental stage:9.6 SSL SP squamation onset posterior|strain:Tgsp7:EGFPb1212|genotype:wild type eda mutant homozygous bnc2 mutant homozygous hypothryoid,GSM7029635,GSM7029635: Multi genotype zebrafish skin snRNAseq; Danio rerio; RNA Seq,GSM7029635 r1,GSM7029635,1,Fish were staged and selected for dissection euthanized with MS 222 and processed immediately. Following removal of the head and fins skins were removed with forceps and immediately flash frozen in liquid nitrogen then stored at 80°C prior to isolation of nuclei. three prime end capture of polyAdenylated transcripts. In situ reverse transcription with barcoded RT primers followed by second strand synthesis tagmentation and index PCR gives each nucleus and all the RNA molecules contained within it a unique combination of barcode sequences. These barcodes are then demultiplexed to create single cells in silico.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP421311,,loader:fastq load.py,zskin_sciRNA_seq4_R1_merge.fastq.gz zskin_sciRNA_seq4_R2_merge.fastq.gz,fastq fastq,33417347600.0,477390680.0,GSM7029635 r4,0:18 1:52,A:10992313767;C:6719060839;G:6813342549;T:8874815927;N:17814518,18,52,,,10992313767,6719060839,6813342549,8874815927,17814518,SRX19301395,SRS16701439,SRA1657186,"Genome Sciences, University of Washington","Genome Sciences, University of Washington",2,0.0,0.7972,0.0,0.51142,1.0,0.84435,,0.56962,18,52,T,B,sc-like readlen,illumina,nextseq,3prime,random_priming,unknown,sc,single_cell_plate,scirnaseq,,United States,2023-02-07,Larval,Larval,Skin,Surface Structure