rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 3015,ERR1396841,ERX1468100,ERS1051448,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 C7,SAMEA3864314,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 2#24,15616955,Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 2. This submission includes reads tagged with the sequence ATTCCT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_2#24.cram,cram,252742350.0,5054847.0,SC RUN 18732 2#24,0:50,A:72444190;C:64568625;G:62796637;T:52911792;N:21106,50,,,,72444190,64568625,62796637,52911792,21106,ERX1468100,ERS1051448,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.61824,,0.09608,,0.8842,,0.56978,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Embryo Imprecise,All anatomical structures 3039,ERR1396817,ERX1468076,ERS1051448,ERP013615,PRJEB12173,Transcriptome profiling of zebrafish small RNA from drosha dgcr8 or dicer knockouts,Transcriptome_profiling_of_zebrafish_small_RNA_from_drosha__dgcr8_or_dicer_knockouts-sc-4011,Transcriptome Analysis,Small RNA data was generated from zebrafish embryos at 5 dpf and genotyped for drosha dicer or dgcr8b to identify wild type heterozygous and homozygous knockout embryos.,ArrayExpress:E ERAD 449,,,zmp ph230 dgcr8 C7,SAMEA3864314,Wellcome Sanger Institute,ArrayExpress DevelopmentalStage:ZFS:0000037|ArrayExpress Species:Danio rerio|ENA first public:2016 05 03|ENA last update:2016 02 03|External Id:SAMEA3864314|INSDC center alias:SC|INSDC center name:Wellcome Sanger Institute|INSDC first public:2016 05 03T14:21:56Z|INSDC last update:2016 02 03T09:48:35Z|INSDC status:public|Submitter Id:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|common name:zebrafish|sample description:Sample wild type for dgcr8 allele sa223. Total RNA from a 5 dpf zebrafish embryo treated with DNase.|sample name:2a85d100 99a3 11e5 bdcf 3c4a9275d6c6|strain:mixed,,,,,,,,,Illumina HiSeq 2500 sequencing,SC EXP 18732 1#24,15616955,Illumina sequencing of library 15616955 constructed from sample accession ERS1051448 for study accession ERP013615. This is part of an Illumina multiplexed sequencing run 18732 1. This submission includes reads tagged with the sequence ATTCCT.,Small RNA miRNA,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,ERP013615,Illumina HiSeq 2500 sequencing,ENA FIRST PUBLIC:2016 05 03|ENA LAST UPDATE:2018 11 16,18732_1#24.cram,cram,258624300.0,5172486.0,SC RUN 18732 1#24,0:50,A:74123846;C:66047722;G:64286422;T:54141623;N:24687,50,,,,74123846,66047722,64286422,54141623,24687,ERX1468076,ERS1051448,ERA612385,European Nucleotide Archive,Wellcome Sanger Institute,1,0.62009,,0.09612,,0.88434,,0.55718,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United Kingdom,2016-02-03,Larval,Larval,Embryo Imprecise,All anatomical structures 9361,ERR3011947,ERX3014407,ERS2994081,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Flutamide 2,SAMEA5186582,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186582|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 2|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Flutamide 2 s,Flutamide 2 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:flutamide|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Flutamide_2_R1.fastq.gz,fastq,1754963940.0,23552243.0,E MTAB 7283:Flutamide 2,0:74.51 1:0,A:455444321;C:410713896;G:385640226;T:503155736;N:9761,74,0,,,455444321,410713896,385640226,503155736,9761,ERX3014407,ERS2994081,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94351,,0.11595,,0.67483,,0.48762,,73,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9362,ERR3011946,ERX3014406,ERS2994080,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Flutamide 1,SAMEA5186581,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186581|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Flutamide 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Flutamide 1|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Flutamide 1 s,Flutamide 1 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:flutamide|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Flutamide_1_R1.fastq.gz,fastq,1631102863.0,21898245.0,E MTAB 7283:Flutamide 1,0:74.49 1:0,A:424378341;C:380806325;G:358128992;T:467779945;N:9260,74,0,,,424378341,380806325,358128992,467779945,9260,ERX3014406,ERS2994080,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94332,,0.11797,,0.67596,,0.48847,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9363,ERR3011945,ERX3014405,ERS2994079,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,DMSO 2,SAMEA5186580,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186580|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 2|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:DMSO 2 s,DMSO 2 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_DMSO_2_R1.fastq.gz,fastq,1811573293.0,24316929.0,E MTAB 7283:DMSO 2,0:74.50 1:0,A:470888315;C:423635861;G:396796840;T:520242179;N:10098,74,0,,,470888315,423635861,396796840,520242179,10098,ERX3014405,ERS2994079,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94219,,0.12305,,0.67184,,0.47704,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9364,ERR3011944,ERX3014404,ERS2994078,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,DMSO 1,SAMEA5186579,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186579|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:DMSO 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:DMSO 1|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:DMSO 1 s,DMSO 1 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:dimethyl sulfoxide|Experimental Factor: dose:1,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_DMSO_1_R1.fastq.gz,fastq,1609807409.0,21611475.0,E MTAB 7283:DMSO 1,0:74.49 1:0,A:420253680;C:374436301;G:352526427;T:462581933;N:9068,74,0,,,420253680,374436301,352526427,462581933,9068,ERX3014404,ERS2994078,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94094,,0.12292,,0.67006,,0.48442,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9365,ERR3011943,ERX3014403,ERS2994077,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Cyproter1 2,SAMEA5186578,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186578|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 2|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 2|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Cyproterone 2 s,Cyproterone 2 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:cyproter1|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Cyproterone_2_R1.fastq.gz,fastq,1823142918.0,24468337.0,E MTAB 7283:Cyproterone 2,0:74.51 1:0,A:469387174;C:428783310;G:403791044;T:521171021;N:10369,74,0,,,469387174,428783310,403791044,521171021,10369,ERX3014403,ERS2994077,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.9432,,0.11718,,0.67389,,0.4768,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9366,ERR3011942,ERX3014402,ERS2994076,ERP112907,PRJEB30451,Effects of anti androgenic compounds on zebrafish insulin mutants,E-MTAB-7283,Transcriptome Analysis,Aiming to identify insulin independent modulators of glucose homeostasis we performed a drug screen on zebrafish insulin ins mutants and identified androgen receptor AR antagonists. To investigate how AR antagonism mediates glucose level reduction in ins mutants we evaluated the effects of antagonist treatment using transcriptomic studies. RNA Seq analyses were performed on 120 hpf ins mutants treated with Flutamide or Cyproterone starting at 84 hpf compared to vehicle DMSO treated mutants.,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,,Protocols: insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Cyproter1 1,SAMEA5186577,Max Planck Institute for Heart and Lung Research,ENA FIRST PUBLIC:2018 12 21T17:03:09Z|ENA LAST UPDATE:2018 12 18T09:28:56Z|External Id:SAMEA5186577|INSDC center name:Max Planck Institute for Heart and Lung Research|INSDC first public:2018 12 21T17:03:09Z|INSDC last update:2018 12 18T09:28:56Z|INSDC status:public|Submitter Id:E MTAB 7283:Cyproter1 1|age:120|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:ins CRISPR/Cas9 mediated knockout|individual:mixed pool of 10 embryos|organism part:whole organism|sample name:E MTAB 7283:Cyproter1 1|scientific name:Danio rerio|strain:ins bns102,,,,,,,,,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,E MTAB 7283:Cyproterone 1 s,Cyproterone 1 s,Effects of anti androgenic compounds on zebrafish insulin mutants,insulin mutant embryos were obtained from two different crosses biological replicates. Embryos were grown at 28 degrees C in egg water. 10 animals per sample were pooled water was removed and Trizol was added. Animals were treated with 1% DMSO or Flutamide 10 micromolar or Cyproterone 10 micromolar from 84 hpf to 120 hpf. Total RNA was isolated from 120 hpf zebrafish using the RNA Clean & Concentrator kit Zymo Research combined with DNase digestion RNase free DNase Set Promega to avoid contamination by genomic DNA. 3µg of total RNA was used as input for Truseq Stranded mRNA Library preparation following manufacture's low sample protocol Illumina,Experimental Factor: compound:cyproter1|Experimental Factor: dose:10,RNA-Seq,TRANSCRIPTOMIC,Oligo-dT,SINGLE,ILLUMINA,NextSeq 500,,ERP112907,NextSeq 500 sequencing; Effects of anti androgenic compounds on zebrafish insulin mutants,ENA FIRST PUBLIC:2018 12 21|ENA LAST UPDATE:2018 12 18,Teja_Cyproterone_1_R1.fastq.gz,fastq,1901027130.0,25512731.0,E MTAB 7283:Cyproterone 1,0:74.51 1:0,A:487302419;C:449208827;G:422183780;T:542321577;N:10527,74,0,,,487302419,449208827,422183780,542321577,10527,ERX3014402,ERS2994076,ERA1697296,European Nucleotide Archive,European Nucleotide Archive,1,0.94427,,0.11318,,0.67294,,0.47183,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,trueseq,bulk,unknown,unknown,,Unknown,2018-12-18,Larval,Larval,Embryo Imprecise,All anatomical structures 9651,ERR3266392,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L001_R1_001.fastq.gz,fastq,603238067.0,8014716.0,E MTAB 7846:sponge tdr gfp positive rep2 lane1,0:75.27 1:0,A:164797697;C:136552121;G:141138007;T:160737152;N:13090,75,0,,,164797697,136552121,141138007,160737152,13090,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95083,,0.06432,,0.71532,,0.50098,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9652,ERR3266393,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L002_R1_001.fastq.gz,fastq,603749720.0,8021069.0,E MTAB 7846:sponge tdr gfp positive rep2 lane2,0:75.27 1:0,A:164972969;C:136661417;G:141205792;T:160896264;N:13278,75,0,,,164972969,136661417,141205792,160896264,13278,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.951,,0.06542,,0.71768,,0.50051,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9653,ERR3266394,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L003_R1_001.fastq.gz,fastq,608154053.0,8079704.0,E MTAB 7846:sponge tdr gfp positive rep2 lane3,0:75.27 1:0,A:166117918;C:137731172;G:142320339;T:161970092;N:14532,75,0,,,166117918,137731172,142320339,161970092,14532,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95155,,0.0657,,0.71634,,0.49493,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9654,ERR3266395,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L004_R1_001.fastq.gz,fastq,599143392.0,7959897.0,E MTAB 7846:sponge tdr gfp positive rep2 lane4,0:75.27 1:0,A:163706904;C:135622453;G:140192351;T:159605249;N:16435,75,0,,,163706904,135622453,140192351,159605249,16435,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95061,,0.06431,,0.71764,,0.50166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9655,ERR3266388,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L001_R1_001.fastq.gz,fastq,616761505.0,8202480.0,E MTAB 7846:sponge tdr gfp positive rep1 lane1,0:75.19 1:0,A:168679238;C:139548565;G:143969797;T:164545362;N:18543,75,0,,,168679238,139548565,143969797,164545362,18543,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95019,,0.06806,,0.7097,,0.50337,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9656,ERR3266389,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L002_R1_001.fastq.gz,fastq,617529482.0,8212485.0,E MTAB 7846:sponge tdr gfp positive rep1 lane2,0:75.19 1:0,A:168925757;C:139655387;G:144096837;T:164831236;N:20265,75,0,,,168925757,139655387,144096837,164831236,20265,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9492,,0.06753,,0.712,,0.49881,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9657,ERR3266390,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L003_R1_001.fastq.gz,fastq,624156883.0,8300861.0,E MTAB 7846:sponge tdr gfp positive rep1 lane3,0:75.19 1:0,A:170696950;C:141302376;G:145759286;T:166377781;N:20490,75,0,,,170696950,141302376,145759286,166377781,20490,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94917,,0.06724,,0.71291,,0.50783,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9658,ERR3266391,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L004_R1_001.fastq.gz,fastq,615013615.0,8179180.0,E MTAB 7846:sponge tdr gfp positive rep1 lane4,0:75.19 1:0,A:168237742;C:139106952;G:143535658;T:164110735;N:22528,75,0,,,168237742,139106952,143535658,164110735,22528,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94892,,0.06723,,0.71206,,0.50775,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9659,ERR3266384,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L001_R1_001.fastq.gz,fastq,659562366.0,8762947.0,E MTAB 7846:sponge tdr gfp negative rep2 lane1,0:75.27 1:0,A:178744772;C:150091912;G:155092318;T:175619332;N:14032,75,0,,,178744772,150091912,155092318,175619332,14032,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9517,,0.06908,,0.70822,,0.48025,,73,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9660,ERR3266385,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L002_R1_001.fastq.gz,fastq,658688825.0,8751176.0,E MTAB 7846:sponge tdr gfp negative rep2 lane2,0:75.27 1:0,A:178540155;C:149844100;G:154850294;T:175438757;N:15519,75,0,,,178540155,149844100,154850294,175438757,15519,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95059,,0.06748,,0.70806,,0.48177,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9661,ERR3266386,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L003_R1_001.fastq.gz,fastq,665901310.0,8846927.0,E MTAB 7846:sponge tdr gfp negative rep2 lane3,0:75.27 1:0,A:180412445;C:151589489;G:156677030;T:177206192;N:16154,75,0,,,180412445,151589489,156677030,177206192,16154,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95095,,0.06855,,0.7082,,0.4787,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9662,ERR3266387,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L004_R1_001.fastq.gz,fastq,655674573.0,8711278.0,E MTAB 7846:sponge tdr gfp negative rep2 lane4,0:75.27 1:0,A:177658097;C:149188009;G:154201531;T:174609176;N:17760,75,0,,,177658097,149188009,154201531,174609176,17760,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9503,,0.06838,,0.70926,,0.47475,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9663,ERR3266380,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L001_R1_001.fastq.gz,fastq,634491637.0,8440052.0,E MTAB 7846:sponge tdr gfp negative rep1 lane1,0:75.18 1:0,A:170881257;C:145535643;G:150561786;T:167495156;N:17795,75,0,,,170881257,145535643,150561786,167495156,17795,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94996,,0.05672,,0.70571,,0.48691,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9664,ERR3266381,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L002_R1_001.fastq.gz,fastq,632900752.0,8418846.0,E MTAB 7846:sponge tdr gfp negative rep1 lane2,0:75.18 1:0,A:170454908;C:145141392;G:150172752;T:167112562;N:19138,75,0,,,170454908,145141392,150172752,167112562,19138,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94905,,0.05627,,0.70457,,0.4865,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9665,ERR3266382,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L003_R1_001.fastq.gz,fastq,638530115.0,8494045.0,E MTAB 7846:sponge tdr gfp negative rep1 lane3,0:75.17 1:0,A:171907482;C:146526309;G:151612209;T:168464163;N:19952,75,0,,,171907482,146526309,151612209,168464163,19952,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94919,,0.05578,,0.70849,,0.48073,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9666,ERR3266383,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L004_R1_001.fastq.gz,fastq,627433322.0,8346505.0,E MTAB 7846:sponge tdr gfp negative rep1 lane4,0:75.17 1:0,A:169016383;C:143886824;G:148914725;T:165593528;N:21862,75,0,,,169016383,143886824,148914725,165593528,21862,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94993,,0.05721,,0.7052,,0.48878,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9667,ERR3266376,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L001_R1_001.fastq.gz,fastq,618672195.0,8218047.0,E MTAB 7846:sponge isl gfp positive rep2 lane1,0:75.28 1:0,A:166422886;C:142212204;G:146857539;T:163167819;N:11747,75,0,,,166422886,142212204,146857539,163167819,11747,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94979,,0.08351,,0.70863,,0.47581,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9668,ERR3266377,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L002_R1_001.fastq.gz,fastq,618709102.0,8218295.0,E MTAB 7846:sponge isl gfp positive rep2 lane2,0:75.28 1:0,A:166470432;C:142189977;G:146819280;T:163216323;N:13090,75,0,,,166470432,142189977,146819280,163216323,13090,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94977,,0.08255,,0.70644,,0.47228,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9669,ERR3266378,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L003_R1_001.fastq.gz,fastq,625353059.0,8306375.0,E MTAB 7846:sponge isl gfp positive rep2 lane3,0:75.29 1:0,A:168233274;C:143793178;G:148510556;T:164802476;N:13575,75,0,,,168233274,143793178,148510556,164802476,13575,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95014,,0.08368,,0.70743,,0.47846,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9670,ERR3266379,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L004_R1_001.fastq.gz,fastq,615204990.0,8171748.0,E MTAB 7846:sponge isl gfp positive rep2 lane4,0:75.28 1:0,A:165565861;C:141380152;G:146028839;T:162214263;N:15875,75,0,,,165565861,141380152,146028839,162214263,15875,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94954,,0.08233,,0.70834,,0.48166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9671,ERR3266372,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L001_R1_001.fastq.gz,fastq,626474467.0,8318996.0,E MTAB 7846:sponge isl gfp positive rep1 lane1,0:75.31 1:0,A:170186220;C:142441110;G:147048643;T:166786401;N:12093,75,0,,,170186220,142441110,147048643,166786401,12093,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94907,,0.08132,,0.69684,,0.4736,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9672,ERR3266373,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L002_R1_001.fastq.gz,fastq,626477579.0,8318750.0,E MTAB 7846:sponge isl gfp positive rep1 lane2,0:75.31 1:0,A:170185337;C:142396801;G:147032265;T:166850532;N:12644,75,0,,,170185337,142396801,147032265,166850532,12644,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.08253,,0.6957,,0.47554,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9673,ERR3266374,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L003_R1_001.fastq.gz,fastq,632098509.0,8393388.0,E MTAB 7846:sponge isl gfp positive rep1 lane3,0:75.31 1:0,A:171699353;C:143766296;G:148442110;T:168177264;N:13486,75,0,,,171699353,143766296,148442110,168177264,13486,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94866,,0.08247,,0.69601,,0.48009,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9674,ERR3266375,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L004_R1_001.fastq.gz,fastq,622997479.0,8272752.0,E MTAB 7846:sponge isl gfp positive rep1 lane4,0:75.31 1:0,A:169306677;C:141586415;G:146241288;T:165847752;N:15347,75,0,,,169306677,141586415,146241288,165847752,15347,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9483,,0.08034,,0.69662,,0.47868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9675,ERR3266368,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L001_R1_001.fastq.gz,fastq,707454819.0,9395082.0,E MTAB 7846:sponge isl gfp negative rep2 lane1,0:75.30 1:0,A:194991862;C:157927850;G:163280639;T:191241488;N:12980,75,0,,,194991862,157927850,163280639,191241488,12980,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93871,,0.08926,,0.70806,,0.46501,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9676,ERR3266369,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L002_R1_001.fastq.gz,fastq,704791838.0,9359668.0,E MTAB 7846:sponge isl gfp negative rep2 lane2,0:75.30 1:0,A:194317422;C:157276895;G:162624670;T:190558322;N:14529,75,0,,,194317422,157276895,162624670,190558322,14529,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93816,,0.08859,,0.70999,,0.4661,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9677,ERR3266370,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L003_R1_001.fastq.gz,fastq,715991833.0,9508323.0,E MTAB 7846:sponge isl gfp negative rep2 lane3,0:75.30 1:0,A:197297222;C:159913026;G:165363927;T:193402765;N:14893,75,0,,,197297222,159913026,165363927,193402765,14893,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93844,,0.08854,,0.70828,,0.46042,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9678,ERR3266371,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L004_R1_001.fastq.gz,fastq,703723869.0,9345669.0,E MTAB 7846:sponge isl gfp negative rep2 lane4,0:75.30 1:0,A:194029886;C:157050176;G:162432310;T:190193608;N:17889,75,0,,,194029886,157050176,162432310,190193608,17889,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93897,,0.08993,,0.70863,,0.45707,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9679,ERR3266364,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L001_R1_001.fastq.gz,fastq,676581458.0,8983758.0,E MTAB 7846:sponge isl gfp negative rep1 lane1,0:75.31 1:0,A:184297337;C:153352193;G:158268476;T:180651038;N:12414,75,0,,,184297337,153352193,158268476,180651038,12414,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94981,,0.07715,,0.69138,,0.47243,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9680,ERR3266365,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L002_R1_001.fastq.gz,fastq,676876555.0,8987445.0,E MTAB 7846:sponge isl gfp negative rep1 lane2,0:75.31 1:0,A:184435129;C:153332402;G:158323789;T:180770978;N:14257,75,0,,,184435129,153332402,158323789,180770978,14257,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94901,,0.07805,,0.69179,,0.47182,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9681,ERR3266366,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L003_R1_001.fastq.gz,fastq,681771213.0,9052615.0,E MTAB 7846:sponge isl gfp negative rep1 lane3,0:75.31 1:0,A:185717696;C:154552039;G:159567102;T:181919781;N:14595,75,0,,,185717696,154552039,159567102,181919781,14595,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94923,,0.07768,,0.69167,,0.47219,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9682,ERR3266367,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L004_R1_001.fastq.gz,fastq,671169917.0,8911624.0,E MTAB 7846:sponge isl gfp negative rep1 lane4,0:75.31 1:0,A:182910490;C:152045814;G:157010053;T:179186548;N:17012,75,0,,,182910490,152045814,157010053,179186548,17012,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.07612,,0.69106,,0.47736,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9683,ERR3266360,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L001_R1_001.fastq.gz,fastq,745666738.0,9917771.0,E MTAB 7846:sponge ccn gfp positive rep2 lane1,0:75.18 1:0,A:207714377;C:163732420;G:169037726;T:205161925;N:20290,75,0,,,207714377,163732420,169037726,205161925,20290,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94006,,0.17809,,0.68166,,0.48912,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9684,ERR3266361,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L002_R1_001.fastq.gz,fastq,747693645.0,9944395.0,E MTAB 7846:sponge ccn gfp positive rep2 lane2,0:75.19 1:0,A:208257288;C:164106384;G:169478025;T:205830399;N:21549,75,0,,,208257288,164106384,169478025,205830399,21549,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93873,,0.17738,,0.68296,,0.49656,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9685,ERR3266362,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L003_R1_001.fastq.gz,fastq,756134124.0,10056818.0,E MTAB 7846:sponge ccn gfp positive rep2 lane3,0:75.19 1:0,A:210573012;C:166089133;G:171475300;T:207973232;N:23447,75,0,,,210573012,166089133,171475300,207973232,23447,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94077,,0.18001,,0.68004,,0.49812,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9686,ERR3266363,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L004_R1_001.fastq.gz,fastq,747687619.0,9944417.0,E MTAB 7846:sponge ccn gfp positive rep2 lane4,0:75.19 1:0,A:208315943;C:164104155;G:169484250;T:205757712;N:25559,75,0,,,208315943,164104155,169484250,205757712,25559,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94025,,0.17965,,0.68124,,0.49249,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9687,ERR3266356,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L001_R1_001.fastq.gz,fastq,600153564.0,7972767.0,E MTAB 7846:sponge ccn gfp positive rep1 lane1,0:75.28 1:0,A:165075878;C:133961511;G:138306424;T:162797903;N:11848,75,0,,,165075878,133961511,138306424,162797903,11848,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95367,,0.14146,,0.69154,,0.46621,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9688,ERR3266357,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L002_R1_001.fastq.gz,fastq,600790169.0,7981038.0,E MTAB 7846:sponge ccn gfp positive rep1 lane2,0:75.28 1:0,A:165262968;C:133988329;G:138458635;T:163066854;N:13383,75,0,,,165262968,133988329,138458635,163066854,13383,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95365,,0.14116,,0.69301,,0.46836,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9689,ERR3266358,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L003_R1_001.fastq.gz,fastq,608611085.0,8084904.0,E MTAB 7846:sponge ccn gfp positive rep1 lane3,0:75.28 1:0,A:167402055;C:135871708;G:140314669;T:165009252;N:13401,75,0,,,167402055,135871708,140314669,165009252,13401,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95403,,0.14167,,0.69311,,0.4702,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9690,ERR3266359,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L004_R1_001.fastq.gz,fastq,599558663.0,7964718.0,E MTAB 7846:sponge ccn gfp positive rep1 lane4,0:75.28 1:0,A:164965131;C:133749666;G:138194884;T:162633558;N:15424,75,0,,,164965131,133749666,138194884,162633558,15424,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95285,,0.14085,,0.69037,,0.47345,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9691,ERR3266352,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L001_R1_001.fastq.gz,fastq,599599608.0,7970460.0,E MTAB 7846:sponge ccn gfp negative rep2 lane1,0:75.23 1:0,A:162236409;C:136907675;G:141538730;T:158902520;N:14274,75,0,,,162236409,136907675,141538730,158902520,14274,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95404,,0.05923,,0.69737,,0.48627,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9692,ERR3266353,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L002_R1_001.fastq.gz,fastq,600057776.0,7976438.0,E MTAB 7846:sponge ccn gfp negative rep2 lane2,0:75.23 1:0,A:162367410;C:136994919;G:141577782;T:159102194;N:15471,75,0,,,162367410,136994919,141577782,159102194,15471,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.953,,0.06085,,0.6952,,0.48868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9693,ERR3266354,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L003_R1_001.fastq.gz,fastq,607089697.0,8069901.0,E MTAB 7846:sponge ccn gfp negative rep2 lane3,0:75.23 1:0,A:164235344;C:138684000;G:143335680;T:160819270;N:15403,75,0,,,164235344,138684000,143335680,160819270,15403,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95245,,0.06055,,0.69589,,0.48813,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9694,ERR3266355,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L004_R1_001.fastq.gz,fastq,598098243.0,7950223.0,E MTAB 7846:sponge ccn gfp negative rep2 lane4,0:75.23 1:0,A:161836808;C:136564804;G:141157424;T:158521860;N:17347,75,0,,,161836808,136564804,141157424,158521860,17347,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95299,,0.06032,,0.69501,,0.48928,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9695,ERR3266348,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L001_R1_001.fastq.gz,fastq,668175990.0,8872549.0,E MTAB 7846:sponge ccn gfp negative rep1 lane1,0:75.31 1:0,A:179859350;C:153483169;G:158360605;T:176462088;N:10778,75,0,,,179859350,153483169,158360605,176462088,10778,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95955,,0.07154,,0.69696,,0.46425,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9696,ERR3266349,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L002_R1_001.fastq.gz,fastq,668154755.0,8872093.0,E MTAB 7846:sponge ccn gfp negative rep1 lane2,0:75.31 1:0,A:179811687;C:153454931;G:158314391;T:176560936;N:12810,75,0,,,179811687,153454931,158314391,176560936,12810,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96029,,0.06969,,0.69684,,0.46725,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9697,ERR3266350,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L003_R1_001.fastq.gz,fastq,676984426.0,8989004.0,E MTAB 7846:sponge ccn gfp negative rep1 lane3,0:75.31 1:0,A:182159685;C:155578195;G:160511499;T:178722363;N:12684,75,0,,,182159685,155578195,160511499,178722363,12684,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96012,,0.07159,,0.69554,,0.46811,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9698,ERR3266351,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L004_R1_001.fastq.gz,fastq,666031892.0,8843695.0,E MTAB 7846:sponge ccn gfp negative rep1 lane4,0:75.31 1:0,A:179243298;C:152946459;G:157873912;T:175953752;N:14471,75,0,,,179243298,152946459,157873912,175953752,14471,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96014,,0.07169,,0.69493,,0.47058,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 10285,ERR7132868,ERX6700306,ERS8071630,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 6,SAMEA10418786,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418786|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Oxy 6|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 6 p,Oxy 6 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.B11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2330698400.0,23306984.0,E MTAB 11086:SLX 19351.B11.HMLG7DRXX.s 2.r ,0:50 1:50,A:619569172;C:544582535;G:551543197;T:614938437;N:65059,50,50,,,619569172,544582535,551543197,614938437,65059,ERX6700306,ERS8071630,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.9448,0.95044,0.1029,0.09965,0.67152,0.66864,0.46844,0.47553,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10286,ERR7132867,ERX6700305,ERS8071629,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 5,SAMEA10418785,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418785|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Oxy 5|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 5 p,Oxy 5 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.H9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2005314000.0,20053140.0,E MTAB 11086:SLX 19351.H9.HMLG7DRXX.s 2.r ,0:50 1:50,A:533671597;C:466449227;G:473126638;T:532010412;N:56126,50,50,,,533671597,466449227,473126638,532010412,56126,ERX6700305,ERS8071629,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94406,0.94793,0.11192,0.10798,0.66184,0.66074,0.4603,0.4683,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10287,ERR7132866,ERX6700304,ERS8071628,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 4,SAMEA10418784,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418784|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Oxy 4|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 4 p,Oxy 4 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.A9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2036392600.0,20363926.0,E MTAB 11086:SLX 19351.A9.HMLG7DRXX.s 2.r ,0:50 1:50,A:547586305;C:468797712;G:476477515;T:543474510;N:56558,50,50,,,547586305,468797712,476477515,543474510,56558,ERX6700304,ERS8071628,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94235,0.94873,0.11388,0.11054,0.67655,0.67294,0.47135,0.47234,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10288,ERR7132865,ERX6700303,ERS8071627,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 3,SAMEA10418783,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418783|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Oxy 3|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 3 p,Oxy 3 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.B9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2409819000.0,24098190.0,E MTAB 11086:SLX 19351.B9.HMLG7DRXX.s 2.r ,0:50 1:50,A:641053989;C:561685242;G:569693271;T:637320302;N:66196,50,50,,,641053989,561685242,569693271,637320302,66196,ERX6700303,ERS8071627,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94407,0.94902,0.10789,0.10496,0.66478,0.66387,0.47154,0.47373,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10289,ERR7132864,ERX6700302,ERS8071626,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 2,SAMEA10418782,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418782|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Oxy 2|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 2 p,Oxy 2 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.A11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2068575200.0,20685752.0,E MTAB 11086:SLX 19351.A11.HMLG7DRXX.s 2.r ,0:50 1:50,A:547986796;C:484533693;G:490663629;T:545334125;N:56957,50,50,,,547986796,484533693,490663629,545334125,56957,ERX6700302,ERS8071626,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94539,0.95188,0.10373,0.10116,0.66718,0.66584,0.46991,0.47611,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10290,ERR7132863,ERX6700301,ERS8071625,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Oxy 1,SAMEA10418781,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418781|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Oxy 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Oxy 1|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Oxy 1 p,Oxy 1 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:oxycod1|Experimental Factor: dose:1.14,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.G9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.G9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2101607900.0,21016079.0,E MTAB 11086:SLX 19351.G9.HMLG7DRXX.s 2.r ,0:50 1:50,A:557420271;C:491161431;G:497494262;T:555471610;N:60326,50,50,,,557420271,491161431,497494262,555471610,60326,ERX6700301,ERS8071625,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94378,0.94916,0.10779,0.10431,0.66507,0.66377,0.45477,0.4679,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10291,ERR7132862,ERX6700300,ERS8071624,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 6,SAMEA10418780,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418780|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Nic 6|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 6 p,Nic 6 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.H11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2236235700.0,22362357.0,E MTAB 11086:SLX 19351.H11.HMLG7DRXX.s 2.r ,0:50 1:50,A:597573047;C:518264376;G:525314754;T:595021334;N:62189,50,50,,,597573047,518264376,525314754,595021334,62189,ERX6700300,ERS8071624,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94255,0.94893,0.11268,0.10955,0.66819,0.66687,0.46882,0.47485,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10292,ERR7132861,ERX6700299,ERS8071623,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 5,SAMEA10418779,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418779|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Nic 5|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 5 p,Nic 5 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.D10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1904348300.0,19043483.0,E MTAB 11086:SLX 19351.D10.HMLG7DRXX.s 2.r ,0:50 1:50,A:506678821;C:443756285;G:450118827;T:503742221;N:52146,50,50,,,506678821,443756285,450118827,503742221,52146,ERX6700299,ERS8071623,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94468,0.95019,0.10313,0.10023,0.66762,0.66513,0.47749,0.47611,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10293,ERR7132860,ERX6700298,ERS8071622,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 4,SAMEA10418778,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418778|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Nic 4|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 4 p,Nic 4 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.C10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2134565600.0,21345656.0,E MTAB 11086:SLX 19351.C10.HMLG7DRXX.s 2.r ,0:50 1:50,A:568799307;C:496480840;G:503115671;T:566109163;N:60619,50,50,,,568799307,496480840,503115671,566109163,60619,ERX6700298,ERS8071622,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94279,0.94878,0.11466,0.1122,0.66291,0.66176,0.46991,0.47168,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10294,ERR7132859,ERX6700297,ERS8071621,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 3,SAMEA10418777,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418777|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Nic 3|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 3 p,Nic 3 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.B10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.B10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2409355400.0,24093554.0,E MTAB 11086:SLX 19351.B10.HMLG7DRXX.s 2.r ,0:50 1:50,A:643046449;C:559571909;G:567748411;T:638920943;N:67688,50,50,,,643046449,559571909,567748411,638920943,67688,ERX6700297,ERS8071621,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94305,0.94796,0.11097,0.10766,0.66149,0.65888,0.46643,0.47512,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10295,ERR7132858,ERX6700296,ERS8071620,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 2,SAMEA10418776,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418776|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Nic 2|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 2 p,Nic 2 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.F10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2046910800.0,20469108.0,E MTAB 11086:SLX 19351.F10.HMLG7DRXX.s 2.r ,0:50 1:50,A:547096034;C:475610002;G:481041169;T:543104402;N:59193,50,50,,,547096034,475610002,481041169,543104402,59193,ERX6700296,ERS8071620,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94391,0.94965,0.10824,0.10557,0.66241,0.65963,0.47747,0.47375,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10296,ERR7132857,ERX6700295,ERS8071619,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Nic 1,SAMEA10418775,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418775|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Nic 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Nic 1|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Nic 1 p,Nic 1 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:nicotine|Experimental Factor: dose:5,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.G10.HMLG7DRXX.s_2.r_2.fq.gz SLX-19351.G10.HMLG7DRXX.s_2.r_1.fq.gz,fastq fastq,2001312600.0,20013126.0,E MTAB 11086:SLX 19351.G10.HMLG7DRXX.s 2.r ,0:50 1:50,A:535065614;C:463328218;G:468900497;T:533963156;N:55115,50,50,,,535065614,463328218,468900497,533963156,55115,ERX6700295,ERS8071619,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94179,0.9477,0.11455,0.11139,0.66697,0.66569,0.45749,0.47217,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10297,ERR7132856,ERX6700294,ERS8071618,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 6,SAMEA10418774,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418774|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Cnt 6|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 6 p,Cnt 6 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.C11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2311609400.0,23116094.0,E MTAB 11086:SLX 19351.C11.HMLG7DRXX.s 2.r ,0:50 1:50,A:616569709;C:538286683;G:545161394;T:611525546;N:66068,50,50,,,616569709,538286683,545161394,611525546,66068,ERX6700294,ERS8071618,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94486,0.95028,0.1097,0.10661,0.66703,0.6644,0.47311,0.47453,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10298,ERR7132855,ERX6700293,ERS8071617,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 5,SAMEA10418773,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418773|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Cnt 5|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 5 p,Cnt 5 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.G11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.G11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1590322800.0,15903228.0,E MTAB 11086:SLX 19351.G11.HMLG7DRXX.s 2.r ,0:50 1:50,A:407583907;C:385496371;G:392945463;T:404250386;N:46673,50,50,,,407583907,385496371,392945463,404250386,46673,ERX6700293,ERS8071617,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94942,0.95571,0.10693,0.10576,0.69329,0.69063,0.46419,0.4826,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10299,ERR7132854,ERX6700292,ERS8071616,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 4,SAMEA10418772,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418772|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Cnt 4|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 4 p,Cnt 4 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.C9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.C9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2079441500.0,20794415.0,E MTAB 11086:SLX 19351.C9.HMLG7DRXX.s 2.r ,0:50 1:50,A:555430147;C:483109623;G:489773903;T:551069513;N:58314,50,50,,,555430147,483109623,489773903,551069513,58314,ERX6700292,ERS8071616,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94258,0.9491,0.10928,0.10545,0.66561,0.66279,0.46967,0.47237,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10300,ERR7132853,ERX6700291,ERS8071615,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 3,SAMEA10418771,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418771|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Cnt 3|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 3 p,Cnt 3 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.H10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.H10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2606680900.0,26066809.0,E MTAB 11086:SLX 19351.H10.HMLG7DRXX.s 2.r ,0:50 1:50,A:698010494;C:604285893;G:612505273;T:691805693;N:73547,50,50,,,698010494,604285893,612505273,691805693,73547,ERX6700291,ERS8071615,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94271,0.94917,0.11288,0.10987,0.67115,0.66827,0.4729,0.4736,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10301,ERR7132852,ERX6700290,ERS8071614,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 2,SAMEA10418770,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418770|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Cnt 2|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 2 p,Cnt 2 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.E11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2248468400.0,22484684.0,E MTAB 11086:SLX 19351.E11.HMLG7DRXX.s 2.r ,0:50 1:50,A:601914808;C:521501189;G:527610060;T:597380501;N:61842,50,50,,,601914808,521501189,527610060,597380501,61842,ERX6700290,ERS8071614,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94347,0.94939,0.11234,0.10984,0.66689,0.66342,0.46711,0.46831,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10302,ERR7132851,ERX6700289,ERS8071613,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Cnt 1,SAMEA10418769,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418769|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Cnt 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Cnt 1|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Cnt 1 p,Cnt 1 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:n1,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.D11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1958517300.0,19585173.0,E MTAB 11086:SLX 19351.D11.HMLG7DRXX.s 2.r ,0:50 1:50,A:523101436;C:454540970;G:459925156;T:520895141;N:54597,50,50,,,523101436,454540970,459925156,520895141,54597,ERX6700289,ERS8071613,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94413,0.95047,0.10482,0.10253,0.67044,0.66782,0.47233,0.4771,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10303,ERR7132850,ERX6700288,ERS8071612,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 6,SAMEA10418768,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418768|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:6|sample name:E MTAB 11086:Amp 6|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 6 p,Amp 6 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.E9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1712505000.0,17125050.0,E MTAB 11086:SLX 19351.E9.HMLG7DRXX.s 2.r ,0:50 1:50,A:455641002;C:398314392;G:404466444;T:454036255;N:46907,50,50,,,455641002,398314392,404466444,454036255,46907,ERX6700288,ERS8071612,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94358,0.94966,0.10681,0.1037,0.66665,0.66373,0.46688,0.47225,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10304,ERR7132849,ERX6700287,ERS8071611,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 5,SAMEA10418767,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418767|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 5|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:5|sample name:E MTAB 11086:Amp 5|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 5 p,Amp 5 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.A10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.A10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2007519200.0,20075192.0,E MTAB 11086:SLX 19351.A10.HMLG7DRXX.s 2.r ,0:50 1:50,A:534568558;C:467539630;G:473805079;T:531550688;N:55245,50,50,,,534568558,467539630,473805079,531550688,55245,ERX6700287,ERS8071611,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94408,0.9499,0.10888,0.10604,0.66797,0.66458,0.46039,0.46669,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10305,ERR7132848,ERX6700286,ERS8071610,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 4,SAMEA10418766,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418766|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:4|sample name:E MTAB 11086:Amp 4|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 4 p,Amp 4 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.F11.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F11.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,1845345300.0,18453453.0,E MTAB 11086:SLX 19351.F11.HMLG7DRXX.s 2.r ,0:50 1:50,A:490920758;C:430637266;G:435667744;T:488067453;N:52079,50,50,,,490920758,430637266,435667744,488067453,52079,ERX6700286,ERS8071610,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94484,0.9504,0.10472,0.10237,0.66618,0.66336,0.46903,0.47774,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10306,ERR7132847,ERX6700285,ERS8071609,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 3,SAMEA10418765,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418765|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:3|sample name:E MTAB 11086:Amp 3|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 3 p,Amp 3 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.F9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.F9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2195415300.0,21954153.0,E MTAB 11086:SLX 19351.F9.HMLG7DRXX.s 2.r ,0:50 1:50,A:583956682;C:511927452;G:518373455;T:581095379;N:62332,50,50,,,583956682,511927452,518373455,581095379,62332,ERX6700285,ERS8071609,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94571,0.95178,0.10567,0.10288,0.6688,0.66661,0.4677,0.47288,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10307,ERR7132846,ERX6700284,ERS8071608,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 2,SAMEA10418764,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418764|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:2|sample name:E MTAB 11086:Amp 2|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 2 p,Amp 2 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.D9.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.D9.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2093635000.0,20936350.0,E MTAB 11086:SLX 19351.D9.HMLG7DRXX.s 2.r ,0:50 1:50,A:556451381;C:488314672;G:495691630;T:553118514;N:58803,50,50,,,556451381,488314672,495691630,553118514,58803,ERX6700284,ERS8071608,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94407,0.95012,0.11198,0.10872,0.66651,0.66352,0.46901,0.47198,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 10308,ERR7132845,ERX6700283,ERS8071607,ERP132573,PRJEB48231,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,E-MTAB-11086,Transcriptome Analysis,RNA seq of wild type Tüpfel long fin TLF zebrafish embryos developmentally exposed to three addictive drugs 5 µM nicotine 1.14 µM oxycodone and 5 µM amphetamine. Each of the 24 samples 6 samples per drug plus 6 control samples represents RNA from a pool of seven 5 dpf zebrafish embryos exposed to the drug between 1 dpf and 5 dpf.,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,,Protocols: Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Amp 1,SAMEA10418763,Cambridge Institute of Therapeutic Immunology & Infectious Disease,ENA first public:2022 01 24|ENA last update:2022 01 24|External Id:SAMEA10418763|INSDC center alias:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC center name:Cambridge Institute of Therapeutic Immunology & Infectious Disease|INSDC first public:2022 01 24T16:27:32Z|INSDC last update:2022 01 24T16:27:32Z|INSDC status:public|Submitter Id:E MTAB 11086:Amp 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:larval day 5|genotype:wild type genotype|individual:pool of 7 embryos|organism part:whole organism|replicate:1|sample name:E MTAB 11086:Amp 1|sex:not available|strain:Tüpfel long fin TLF,,,,,,,,,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to 3 addictive drugs,E MTAB 11086:Amp 1 p,Amp 1 p,RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,Zebrafish embryos were exposed to a drug from xxx dpf ttwo xxx dpf and at the end of the exposure period larvae were collected as 6 pools of 7 embryos per condition for RNA extraction. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was removed without xxx the beads. Whilst still on the magnet beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalogue number M0303L. Illumina TruSeq Stranded mRNA Sample Prep Kit.,Experimental Factor: compound:amphetamine|Experimental Factor: dose:25,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP132573,Illumina NovaSeq 6000 paired end sequencing; RNA seq of wild type zebrafish embryos developmentally exposed to three addictive drugs,ENA FIRST PUBLIC:2022 01 24|ENA LAST UPDATE:2022 01 24,SLX-19351.E10.HMLG7DRXX.s_2.r_1.fq.gz SLX-19351.E10.HMLG7DRXX.s_2.r_2.fq.gz,fastq fastq,2254130000.0,22541300.0,E MTAB 11086:SLX 19351.E10.HMLG7DRXX.s 2.r ,0:50 1:50,A:599784010;C:525655199;G:531849347;T:596777643;N:63801,50,50,,,599784010,525655199,531849347,596777643,63801,ERX6700283,ERS8071607,ERA6757821,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,Cambridge Institute of Therapeutic Immunology & Infectious Disease|European Nucleotide Archive,2,0.94449,0.95026,0.10608,0.10323,0.66758,0.66257,0.46869,0.47045,50,50,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,trueseq,bulk,unknown,unknown,,United Kingdom,2022-01-24,Larval,Larval,Embryo Imprecise,All anatomical structures 11723,ERR11422840,ERX10830011,ERS15422295,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 het 1,SAMEA113427169,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427169|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 1|organism part:embryo|replicate:1|sample name:E MTAB 12934:srpk3 hom ttn1 het 1|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 het 1 p,srpk3 hom ttn1 het 1 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.C4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.C4.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,5201588100.0,17338627.0,E MTAB 12934:SLX 21419.C4.HV2TTDRXY.s 2.r ,0:150 1:150,A:1395812979;C:1209220590;G:1233107747;T:1363200419;N:246365,150,150,,,1395812979,1209220590,1233107747,1363200419,246365,ERX10830011,ERS15422295,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11724,ERR11422856,ERX10830027,ERS15422311,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 het 8,SAMEA113427185,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427185|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 8|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 8|organism part:embryo|replicate:8|sample name:E MTAB 12934:srpk3 wt ttn1 het 8|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 het 8 p,srpk3 wt ttn1 het 8 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.C5.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.C5.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,6243031800.0,20810106.0,E MTAB 12934:SLX 21419.C5.HV2TTDRXY.s 2.r ,0:150 1:150,A:1678428066;C:1448795147;G:1483028868;T:1632478253;N:301466,150,150,,,1678428066,1448795147,1483028868,1632478253,301466,ERX10830027,ERS15422311,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11725,ERR11422863,ERX10830034,ERS15422318,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 wt 7,SAMEA113427192,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427192|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 wt 7|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/+|individual:pool of 3 embryos 7|organism part:embryo|replicate:7|sample name:E MTAB 12934:srpk3 wt ttn1 wt 7|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 wt 7 p,srpk3 wt ttn1 wt 7 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/+,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.G3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.G3.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,7924538100.0,26415127.0,E MTAB 12934:SLX 21419.G3.HV2TTDRXY.s 2.r ,0:150 1:150,A:2128544326;C:1844570027;G:1875605207;T:2075443615;N:374925,150,150,,,2128544326,1844570027,1875605207,2075443615,374925,ERX10830034,ERS15422318,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11726,ERR11422862,ERX10830033,ERS15422317,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 wt 6,SAMEA113427191,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427191|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 wt 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/+|individual:pool of 3 embryos 6|organism part:embryo|replicate:6|sample name:E MTAB 12934:srpk3 wt ttn1 wt 6|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 wt 6 p,srpk3 wt ttn1 wt 6 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/+,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.D5.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.D5.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,8652848700.0,28842829.0,E MTAB 12934:SLX 21419.D5.HV2TTDRXY.s 2.r ,0:150 1:150,A:2323784475;C:2011287942;G:2055678520;T:2261686116;N:411647,150,150,,,2323784475,2011287942,2055678520,2261686116,411647,ERX10830033,ERS15422317,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11727,ERR11422852,ERX10830023,ERS15422307,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 het 1,SAMEA113427181,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427181|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 1|organism part:embryo|replicate:1|sample name:E MTAB 12934:srpk3 wt ttn1 het 1|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 het 1 p,srpk3 wt ttn1 het 1 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.E3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.E3.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,5595162300.0,18650541.0,E MTAB 12934:SLX 21419.E3.HV2TTDRXY.s 2.r ,0:150 1:150,A:1500582422;C:1301393746;G:1326420086;T:1466508237;N:257809,150,150,,,1500582422,1301393746,1326420086,1466508237,257809,ERX10830023,ERS15422307,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11728,ERR11422841,ERX10830012,ERS15422296,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 het 10,SAMEA113427170,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427170|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 10|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 10|organism part:embryo|replicate:10|sample name:E MTAB 12934:srpk3 hom ttn1 het 10|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 het 10 p,srpk3 hom ttn1 het 10 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.F2.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.F2.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,6163159800.0,20543866.0,E MTAB 12934:SLX 21419.F2.HV2TTDRXY.s 2.r ,0:150 1:150,A:1651051246;C:1435397149;G:1465377920;T:1611039390;N:294095,150,150,,,1651051246,1435397149,1465377920,1611039390,294095,ERX10830012,ERS15422296,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11729,ERR11422858,ERX10830029,ERS15422313,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 wt 2,SAMEA113427187,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427187|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 wt 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/+|individual:pool of 3 embryos 2|organism part:embryo|replicate:2|sample name:E MTAB 12934:srpk3 wt ttn1 wt 2|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 wt 2 p,srpk3 wt ttn1 wt 2 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/+,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.E4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.E4.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,4948755000.0,16495850.0,E MTAB 12934:SLX 21419.E4.HV2TTDRXY.s 2.r ,0:150 1:150,A:1328315519;C:1150664187;G:1172962823;T:1296576134;N:236337,150,150,,,1328315519,1150664187,1172962823,1296576134,236337,ERX10830029,ERS15422313,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11730,ERR11422853,ERX10830024,ERS15422308,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 het 2,SAMEA113427182,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427182|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 2|organism part:embryo|replicate:2|sample name:E MTAB 12934:srpk3 wt ttn1 het 2|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 het 2 p,srpk3 wt ttn1 het 2 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.A5.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.A5.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,5172515100.0,17241717.0,E MTAB 12934:SLX 21419.A5.HV2TTDRXY.s 2.r ,0:150 1:150,A:1390660856;C:1200693628;G:1226597252;T:1354312680;N:250684,150,150,,,1390660856,1200693628,1226597252,1354312680,250684,ERX10830024,ERS15422308,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11731,ERR11422842,ERX10830013,ERS15422297,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 het 2,SAMEA113427171,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427171|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 2|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 2|organism part:embryo|replicate:2|sample name:E MTAB 12934:srpk3 hom ttn1 het 2|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 het 2 p,srpk3 hom ttn1 het 2 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.B3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.B3.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,7596727500.0,25322425.0,E MTAB 12934:SLX 21419.B3.HV2TTDRXY.s 2.r ,0:150 1:150,A:2040744877;C:1765753859;G:1800431343;T:1989434039;N:363382,150,150,,,2040744877,1765753859,1800431343,1989434039,363382,ERX10830013,ERS15422297,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11732,ERR11422854,ERX10830025,ERS15422309,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 het 3,SAMEA113427183,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427183|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 3|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 3|organism part:embryo|replicate:3|sample name:E MTAB 12934:srpk3 wt ttn1 het 3|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 het 3 p,srpk3 wt ttn1 het 3 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.B4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.B4.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,4147455600.0,13824852.0,E MTAB 12934:SLX 21419.B4.HV2TTDRXY.s 2.r ,0:150 1:150,A:1111933168;C:965101703;G:986324158;T:1083898570;N:198001,150,150,,,1111933168,965101703,986324158,1083898570,198001,ERX10830025,ERS15422309,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11733,ERR11422855,ERX10830026,ERS15422310,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 het 7,SAMEA113427184,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427184|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 7|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 7|organism part:embryo|replicate:7|sample name:E MTAB 12934:srpk3 wt ttn1 het 7|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 het 7 p,srpk3 wt ttn1 het 7 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.C3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.C3.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,7815347400.0,26051158.0,E MTAB 12934:SLX 21419.C3.HV2TTDRXY.s 2.r ,0:150 1:150,A:2105543787;C:1810060936;G:1848658748;T:2050709339;N:374590,150,150,,,2105543787,1810060936,1848658748,2050709339,374590,ERX10830026,ERS15422310,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11734,ERR11422847,ERX10830018,ERS15422302,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 wt 4,SAMEA113427176,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427176|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 4|organism part:embryo|replicate:4|sample name:E MTAB 12934:srpk3 hom ttn1 wt 4|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 wt 4 p,srpk3 hom ttn1 wt 4 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/+,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.F4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.F4.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,5552048400.0,18506828.0,E MTAB 12934:SLX 21419.F4.HV2TTDRXY.s 2.r ,0:150 1:150,A:1494691750;C:1287655327;G:1313223405;T:1456215647;N:262271,150,150,,,1494691750,1287655327,1313223405,1456215647,262271,ERX10830018,ERS15422302,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11735,ERR11422843,ERX10830014,ERS15422298,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 het 7,SAMEA113427172,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427172|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 7|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 7|organism part:embryo|replicate:7|sample name:E MTAB 12934:srpk3 hom ttn1 het 7|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 het 7 p,srpk3 hom ttn1 het 7 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.G2.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.G2.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,6130593900.0,20435313.0,E MTAB 12934:SLX 21419.G2.HV2TTDRXY.s 2.r ,0:150 1:150,A:1646268883;C:1426071699;G:1453474221;T:1604484627;N:294470,150,150,,,1646268883,1426071699,1453474221,1604484627,294470,ERX10830014,ERS15422298,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11736,ERR11422857,ERX10830028,ERS15422312,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 het 9,SAMEA113427186,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427186|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 het 9|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/ |individual:pool of 3 embryos 9|organism part:embryo|replicate:9|sample name:E MTAB 12934:srpk3 wt ttn1 het 9|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 het 9 p,srpk3 wt ttn1 het 9 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.A3.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.A3.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,7955802600.0,26519342.0,E MTAB 12934:SLX 21419.A3.HV2TTDRXY.s 2.r ,0:150 1:150,A:2139048525;C:1844468923;G:1881094685;T:2090808427;N:382040,150,150,,,2139048525,1844468923,1881094685,2090808427,382040,ERX10830028,ERS15422312,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11737,ERR11422844,ERX10830015,ERS15422299,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 het 8,SAMEA113427173,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427173|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 het 8|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/ |individual:pool of 3 embryos 8|organism part:embryo|replicate:8|sample name:E MTAB 12934:srpk3 hom ttn1 het 8|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 het 8 p,srpk3 hom ttn1 het 8 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/ ,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.H2.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.H2.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,4707444000.0,15691480.0,E MTAB 12934:SLX 21419.H2.HV2TTDRXY.s 2.r ,0:150 1:150,A:1266769556;C:1091810198;G:1114454117;T:1234185729;N:224400,150,150,,,1266769556,1091810198,1114454117,1234185729,224400,ERX10830015,ERS15422299,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11738,ERR11422850,ERX10830021,ERS15422305,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 wt 7,SAMEA113427179,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427179|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 7|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 7|organism part:embryo|replicate:7|sample name:E MTAB 12934:srpk3 hom ttn1 wt 7|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 wt 7 p,srpk3 hom ttn1 wt 7 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/+,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.G4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.G4.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,6262379700.0,20874599.0,E MTAB 12934:SLX 21419.G4.HV2TTDRXY.s 2.r ,0:150 1:150,A:1681113096;C:1456657472;G:1485545256;T:1638760380;N:303496,150,150,,,1681113096,1456657472,1485545256,1638760380,303496,ERX10830021,ERS15422305,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11739,ERR11422846,ERX10830017,ERS15422301,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 wt 1,SAMEA113427175,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427175|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 1|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 1|organism part:embryo|replicate:1|sample name:E MTAB 12934:srpk3 hom ttn1 wt 1|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 wt 1 p,srpk3 hom ttn1 wt 1 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/+,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.A4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.A4.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,6071901300.0,20239671.0,E MTAB 12934:SLX 21419.A4.HV2TTDRXY.s 2.r ,0:150 1:150,A:1629141748;C:1412963306;G:1441970376;T:1587528201;N:297669,150,150,,,1629141748,1412963306,1441970376,1587528201,297669,ERX10830017,ERS15422301,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11740,ERR11422860,ERX10830031,ERS15422315,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 wt ttn1 wt 4,SAMEA113427189,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427189|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 wt ttn1 wt 4|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 +/+; ttn.1 +/+|individual:pool of 3 embryos 4|organism part:embryo|replicate:4|sample name:E MTAB 12934:srpk3 wt ttn1 wt 4|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 wt ttn1 wt 4 p,srpk3 wt ttn1 wt 4 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 +/+; ttn.1 +/+,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.H4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.H4.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,8552416200.0,28508054.0,E MTAB 12934:SLX 21419.H4.HV2TTDRXY.s 2.r ,0:150 1:150,A:2292742388;C:1992671634;G:2031906776;T:2234679447;N:415955,150,150,,,2292742388,1992671634,2031906776,2234679447,415955,ERX10830031,ERS15422315,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11741,ERR11422851,ERX10830022,ERS15422306,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 wt 8,SAMEA113427180,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427180|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 8|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 8|organism part:embryo|replicate:8|sample name:E MTAB 12934:srpk3 hom ttn1 wt 8|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 wt 8 p,srpk3 hom ttn1 wt 8 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/+,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.D4.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.D4.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,4693977900.0,15646593.0,E MTAB 12934:SLX 21419.D4.HV2TTDRXY.s 2.r ,0:150 1:150,A:1260530822;C:1090058889;G:1111595821;T:1231573984;N:218384,150,150,,,1260530822,1090058889,1111595821,1231573984,218384,ERX10830022,ERS15422306,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures 11742,ERR11422849,ERX10830020,ERS15422304,ERP147133,PRJEB62042,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E-MTAB-12934,Transcriptome Analysis,RNA seq of zebrafish embryos with mutations in srpk3 sa1890 allele and/or ttn.1 sa5562 allele. Each of the 24 samples six samples for each of four genotypes represents RNA from a pool of three 5 dpf zebrafish embryos.,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,,Protocols: Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,srpk3 hom ttn1 wt 6,SAMEA113427178,QMUL,ENA FIRST PUBLIC:2024 02 09T16:00:07Z|ENA LAST UPDATE:2024 02 09T16:00:07Z|External Id:SAMEA113427178|INSDC center name:QMUL|INSDC first public:2024 02 09T16:00:07Z|INSDC last update:2024 02 09T16:00:07Z|INSDC status:public|Submitter Id:E MTAB 12934:srpk3 hom ttn1 wt 6|age:5|broker name:ArrayExpress|common name:zebrafish|developmental stage:embryo|genotype:srpk3 / ; ttn.1 +/+|individual:pool of 3 embryos 6|organism part:embryo|replicate:6|sample name:E MTAB 12934:srpk3 hom ttn1 wt 6|scientific name:Danio rerio|sex:not available|strain:Tüpfel long fin,,,,,,,,,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,E MTAB 12934:srpk3 hom ttn1 wt 6 p,srpk3 hom ttn1 wt 6 p,RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,Zebrafish embryos were collected for DNA and RNA extraction at 5 dpf in 6 pools of 3 embryos per genotype. Samples were lysed in 110 μl RLT buffer Qiagen containing 1.1 μl of 14.3 M β mercaptoethanol Sigma. The lysate was allowed to bind to 450 μl of Agencourt AMPure XP beads Beckman Coulter for 15 minutes. The tubes were left on a magnet Invitrogen until the solutions cleared and the supernatant was then removed without xxx the beads. Whilst still on the magnet the beads were washed three times with 70% ethanol and allowed to dry for 20 minutes. Total nucleic acid was eluted from the beads following the manufacturer's instructions and treated with DNase I NEB Catalog number M0303L. NEBNext Ultra II DNA Library Prep Kit for Illumina.,Experimental Factor: genotype:srpk3 / ; ttn.1 +/+,RNA-Seq,TRANSCRIPTOMIC,PolyA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,ERP147133,Illumina NovaSeq 6000 paired end sequencing; RNA seq of zebrafish embryos with mutations in a muscle specific kinase and the giant titin protein,ENA FIRST PUBLIC:2024 02 09|ENA LAST UPDATE:2024 02 09,SLX-21419.E2.HV2TTDRXY.s_2.r_1.fq.gz SLX-21419.E2.HV2TTDRXY.s_2.r_2.fq.gz,fastq fastq,8212296300.0,27374321.0,E MTAB 12934:SLX 21419.E2.HV2TTDRXY.s 2.r ,0:150 1:150,A:2208490788;C:1905530286;G:1945454560;T:2152431537;N:389129,150,150,,,2208490788,1905530286,1945454560,2152431537,389129,ERX10830020,ERS15422304,ERA23329494,European Bioinformatics Institute|European Nucleotide Archive,European Bioinformatics Institute|European Nucleotide Archive,,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2024-02-09,Larval,Larval,Embryo Imprecise,All anatomical structures