rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 9651,ERR3266392,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L001_R1_001.fastq.gz,fastq,603238067.0,8014716.0,E MTAB 7846:sponge tdr gfp positive rep2 lane1,0:75.27 1:0,A:164797697;C:136552121;G:141138007;T:160737152;N:13090,75,0,,,164797697,136552121,141138007,160737152,13090,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95083,,0.06432,,0.71532,,0.50098,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9652,ERR3266393,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L002_R1_001.fastq.gz,fastq,603749720.0,8021069.0,E MTAB 7846:sponge tdr gfp positive rep2 lane2,0:75.27 1:0,A:164972969;C:136661417;G:141205792;T:160896264;N:13278,75,0,,,164972969,136661417,141205792,160896264,13278,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.951,,0.06542,,0.71768,,0.50051,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9653,ERR3266394,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L003_R1_001.fastq.gz,fastq,608154053.0,8079704.0,E MTAB 7846:sponge tdr gfp positive rep2 lane3,0:75.27 1:0,A:166117918;C:137731172;G:142320339;T:161970092;N:14532,75,0,,,166117918,137731172,142320339,161970092,14532,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95155,,0.0657,,0.71634,,0.49493,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9654,ERR3266395,ERX3293003,ERS3358386,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep2,SAMEA5556346,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556346|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep2 s,sponge tdr gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9pos_S2_L004_R1_001.fastq.gz,fastq,599143392.0,7959897.0,E MTAB 7846:sponge tdr gfp positive rep2 lane4,0:75.27 1:0,A:163706904;C:135622453;G:140192351;T:159605249;N:16435,75,0,,,163706904,135622453,140192351,159605249,16435,ERX3293003,ERS3358386,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95061,,0.06431,,0.71764,,0.50166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9655,ERR3266388,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L001_R1_001.fastq.gz,fastq,616761505.0,8202480.0,E MTAB 7846:sponge tdr gfp positive rep1 lane1,0:75.19 1:0,A:168679238;C:139548565;G:143969797;T:164545362;N:18543,75,0,,,168679238,139548565,143969797,164545362,18543,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95019,,0.06806,,0.7097,,0.50337,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9656,ERR3266389,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L002_R1_001.fastq.gz,fastq,617529482.0,8212485.0,E MTAB 7846:sponge tdr gfp positive rep1 lane2,0:75.19 1:0,A:168925757;C:139655387;G:144096837;T:164831236;N:20265,75,0,,,168925757,139655387,144096837,164831236,20265,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9492,,0.06753,,0.712,,0.49881,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9657,ERR3266390,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L003_R1_001.fastq.gz,fastq,624156883.0,8300861.0,E MTAB 7846:sponge tdr gfp positive rep1 lane3,0:75.19 1:0,A:170696950;C:141302376;G:145759286;T:166377781;N:20490,75,0,,,170696950,141302376,145759286,166377781,20490,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94917,,0.06724,,0.71291,,0.50783,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9658,ERR3266391,ERX3293002,ERS3358385,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp positive rep1,SAMEA5556345,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556345|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp positive rep1 s,sponge tdr gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6pos_S4_L004_R1_001.fastq.gz,fastq,615013615.0,8179180.0,E MTAB 7846:sponge tdr gfp positive rep1 lane4,0:75.19 1:0,A:168237742;C:139106952;G:143535658;T:164110735;N:22528,75,0,,,168237742,139106952,143535658,164110735,22528,ERX3293002,ERS3358385,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94892,,0.06723,,0.71206,,0.50775,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9659,ERR3266384,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L001_R1_001.fastq.gz,fastq,659562366.0,8762947.0,E MTAB 7846:sponge tdr gfp negative rep2 lane1,0:75.27 1:0,A:178744772;C:150091912;G:155092318;T:175619332;N:14032,75,0,,,178744772,150091912,155092318,175619332,14032,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9517,,0.06908,,0.70822,,0.48025,,73,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9660,ERR3266385,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L002_R1_001.fastq.gz,fastq,658688825.0,8751176.0,E MTAB 7846:sponge tdr gfp negative rep2 lane2,0:75.27 1:0,A:178540155;C:149844100;G:154850294;T:175438757;N:15519,75,0,,,178540155,149844100,154850294,175438757,15519,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95059,,0.06748,,0.70806,,0.48177,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9661,ERR3266386,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L003_R1_001.fastq.gz,fastq,665901310.0,8846927.0,E MTAB 7846:sponge tdr gfp negative rep2 lane3,0:75.27 1:0,A:180412445;C:151589489;G:156677030;T:177206192;N:16154,75,0,,,180412445,151589489,156677030,177206192,16154,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95095,,0.06855,,0.7082,,0.4787,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9662,ERR3266387,ERX3293001,ERS3358384,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep2,SAMEA5556344,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556344|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 6|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep2 s,sponge tdr gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_9neg_S1_L004_R1_001.fastq.gz,fastq,655674573.0,8711278.0,E MTAB 7846:sponge tdr gfp negative rep2 lane4,0:75.27 1:0,A:177658097;C:149188009;G:154201531;T:174609176;N:17760,75,0,,,177658097,149188009,154201531,174609176,17760,ERX3293001,ERS3358384,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9503,,0.06838,,0.70926,,0.47475,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9663,ERR3266380,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L001_R1_001.fastq.gz,fastq,634491637.0,8440052.0,E MTAB 7846:sponge tdr gfp negative rep1 lane1,0:75.18 1:0,A:170881257;C:145535643;G:150561786;T:167495156;N:17795,75,0,,,170881257,145535643,150561786,167495156,17795,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94996,,0.05672,,0.70571,,0.48691,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9664,ERR3266381,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L002_R1_001.fastq.gz,fastq,632900752.0,8418846.0,E MTAB 7846:sponge tdr gfp negative rep1 lane2,0:75.18 1:0,A:170454908;C:145141392;G:150172752;T:167112562;N:19138,75,0,,,170454908,145141392,150172752,167112562,19138,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94905,,0.05627,,0.70457,,0.4865,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9665,ERR3266382,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L003_R1_001.fastq.gz,fastq,638530115.0,8494045.0,E MTAB 7846:sponge tdr gfp negative rep1 lane3,0:75.17 1:0,A:171907482;C:146526309;G:151612209;T:168464163;N:19952,75,0,,,171907482,146526309,151612209,168464163,19952,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94919,,0.05578,,0.70849,,0.48073,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9666,ERR3266383,ERX3293000,ERS3358383,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge tdr gfp negative rep1,SAMEA5556343,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556343|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge tdr gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgstdrd3 diaph3:eGFPuq7mf|individual:pool 5|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge tdr gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge tdr gfp negative rep1 s,sponge tdr gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgstdrd3 diaph3:eGFPuq7mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E9_6neg_S3_L004_R1_001.fastq.gz,fastq,627433322.0,8346505.0,E MTAB 7846:sponge tdr gfp negative rep1 lane4,0:75.17 1:0,A:169016383;C:143886824;G:148914725;T:165593528;N:21862,75,0,,,169016383,143886824,148914725,165593528,21862,ERX3293000,ERS3358383,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94993,,0.05721,,0.7052,,0.48878,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9667,ERR3266376,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L001_R1_001.fastq.gz,fastq,618672195.0,8218047.0,E MTAB 7846:sponge isl gfp positive rep2 lane1,0:75.28 1:0,A:166422886;C:142212204;G:146857539;T:163167819;N:11747,75,0,,,166422886,142212204,146857539,163167819,11747,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94979,,0.08351,,0.70863,,0.47581,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9668,ERR3266377,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L002_R1_001.fastq.gz,fastq,618709102.0,8218295.0,E MTAB 7846:sponge isl gfp positive rep2 lane2,0:75.28 1:0,A:166470432;C:142189977;G:146819280;T:163216323;N:13090,75,0,,,166470432,142189977,146819280,163216323,13090,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94977,,0.08255,,0.70644,,0.47228,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9669,ERR3266378,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L003_R1_001.fastq.gz,fastq,625353059.0,8306375.0,E MTAB 7846:sponge isl gfp positive rep2 lane3,0:75.29 1:0,A:168233274;C:143793178;G:148510556;T:164802476;N:13575,75,0,,,168233274,143793178,148510556,164802476,13575,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95014,,0.08368,,0.70743,,0.47846,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9670,ERR3266379,ERX3292999,ERS3358382,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep2,SAMEA5556342,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556342|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep2 s,sponge isl gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7pos_S10_L004_R1_001.fastq.gz,fastq,615204990.0,8171748.0,E MTAB 7846:sponge isl gfp positive rep2 lane4,0:75.28 1:0,A:165565861;C:141380152;G:146028839;T:162214263;N:15875,75,0,,,165565861,141380152,146028839,162214263,15875,ERX3292999,ERS3358382,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94954,,0.08233,,0.70834,,0.48166,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9671,ERR3266372,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L001_R1_001.fastq.gz,fastq,626474467.0,8318996.0,E MTAB 7846:sponge isl gfp positive rep1 lane1,0:75.31 1:0,A:170186220;C:142441110;G:147048643;T:166786401;N:12093,75,0,,,170186220,142441110,147048643,166786401,12093,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94907,,0.08132,,0.69684,,0.4736,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9672,ERR3266373,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L002_R1_001.fastq.gz,fastq,626477579.0,8318750.0,E MTAB 7846:sponge isl gfp positive rep1 lane2,0:75.31 1:0,A:170185337;C:142396801;G:147032265;T:166850532;N:12644,75,0,,,170185337,142396801,147032265,166850532,12644,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.08253,,0.6957,,0.47554,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9673,ERR3266374,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L003_R1_001.fastq.gz,fastq,632098509.0,8393388.0,E MTAB 7846:sponge isl gfp positive rep1 lane3,0:75.31 1:0,A:171699353;C:143766296;G:148442110;T:168177264;N:13486,75,0,,,171699353,143766296,148442110,168177264,13486,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94866,,0.08247,,0.69601,,0.48009,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9674,ERR3266375,ERX3292998,ERS3358381,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp positive rep1,SAMEA5556341,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556341|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp positive rep1 s,sponge isl gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6pos_S12_L004_R1_001.fastq.gz,fastq,622997479.0,8272752.0,E MTAB 7846:sponge isl gfp positive rep1 lane4,0:75.31 1:0,A:169306677;C:141586415;G:146241288;T:165847752;N:15347,75,0,,,169306677,141586415,146241288,165847752,15347,ERX3292998,ERS3358381,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.9483,,0.08034,,0.69662,,0.47868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9675,ERR3266368,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L001_R1_001.fastq.gz,fastq,707454819.0,9395082.0,E MTAB 7846:sponge isl gfp negative rep2 lane1,0:75.30 1:0,A:194991862;C:157927850;G:163280639;T:191241488;N:12980,75,0,,,194991862,157927850,163280639,191241488,12980,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93871,,0.08926,,0.70806,,0.46501,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9676,ERR3266369,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L002_R1_001.fastq.gz,fastq,704791838.0,9359668.0,E MTAB 7846:sponge isl gfp negative rep2 lane2,0:75.30 1:0,A:194317422;C:157276895;G:162624670;T:190558322;N:14529,75,0,,,194317422,157276895,162624670,190558322,14529,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93816,,0.08859,,0.70999,,0.4661,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9677,ERR3266370,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L003_R1_001.fastq.gz,fastq,715991833.0,9508323.0,E MTAB 7846:sponge isl gfp negative rep2 lane3,0:75.30 1:0,A:197297222;C:159913026;G:165363927;T:193402765;N:14893,75,0,,,197297222,159913026,165363927,193402765,14893,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93844,,0.08854,,0.70828,,0.46042,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9678,ERR3266371,ERX3292997,ERS3358380,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep2,SAMEA5556340,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556340|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 2|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep2 s,sponge isl gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_7neg_S9_L004_R1_001.fastq.gz,fastq,703723869.0,9345669.0,E MTAB 7846:sponge isl gfp negative rep2 lane4,0:75.30 1:0,A:194029886;C:157050176;G:162432310;T:190193608;N:17889,75,0,,,194029886,157050176,162432310,190193608,17889,ERX3292997,ERS3358380,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93897,,0.08993,,0.70863,,0.45707,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9679,ERR3266364,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L001_R1_001.fastq.gz,fastq,676581458.0,8983758.0,E MTAB 7846:sponge isl gfp negative rep1 lane1,0:75.31 1:0,A:184297337;C:153352193;G:158268476;T:180651038;N:12414,75,0,,,184297337,153352193,158268476,180651038,12414,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94981,,0.07715,,0.69138,,0.47243,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9680,ERR3266365,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L002_R1_001.fastq.gz,fastq,676876555.0,8987445.0,E MTAB 7846:sponge isl gfp negative rep1 lane2,0:75.31 1:0,A:184435129;C:153332402;G:158323789;T:180770978;N:14257,75,0,,,184435129,153332402,158323789,180770978,14257,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94901,,0.07805,,0.69179,,0.47182,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9681,ERR3266366,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L003_R1_001.fastq.gz,fastq,681771213.0,9052615.0,E MTAB 7846:sponge isl gfp negative rep1 lane3,0:75.31 1:0,A:185717696;C:154552039;G:159567102;T:181919781;N:14595,75,0,,,185717696,154552039,159567102,181919781,14595,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94923,,0.07768,,0.69167,,0.47219,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9682,ERR3266367,ERX3292996,ERS3358379,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge isl gfp negative rep1,SAMEA5556339,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556339|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge isl gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsisl2 scaper:eGFPuq5mf|individual:pool 1|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge isl gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge isl gfp negative rep1 s,sponge isl gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsisl2 scaper:eGFPuq5mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E4_6neg_S11_L004_R1_001.fastq.gz,fastq,671169917.0,8911624.0,E MTAB 7846:sponge isl gfp negative rep1 lane4,0:75.31 1:0,A:182910490;C:152045814;G:157010053;T:179186548;N:17012,75,0,,,182910490,152045814,157010053,179186548,17012,ERX3292996,ERS3358379,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94941,,0.07612,,0.69106,,0.47736,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9683,ERR3266360,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L001_R1_001.fastq.gz,fastq,745666738.0,9917771.0,E MTAB 7846:sponge ccn gfp positive rep2 lane1,0:75.18 1:0,A:207714377;C:163732420;G:169037726;T:205161925;N:20290,75,0,,,207714377,163732420,169037726,205161925,20290,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94006,,0.17809,,0.68166,,0.48912,,74,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9684,ERR3266361,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L002_R1_001.fastq.gz,fastq,747693645.0,9944395.0,E MTAB 7846:sponge ccn gfp positive rep2 lane2,0:75.19 1:0,A:208257288;C:164106384;G:169478025;T:205830399;N:21549,75,0,,,208257288,164106384,169478025,205830399,21549,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.93873,,0.17738,,0.68296,,0.49656,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9685,ERR3266362,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L003_R1_001.fastq.gz,fastq,756134124.0,10056818.0,E MTAB 7846:sponge ccn gfp positive rep2 lane3,0:75.19 1:0,A:210573012;C:166089133;G:171475300;T:207973232;N:23447,75,0,,,210573012,166089133,171475300,207973232,23447,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94077,,0.18001,,0.68004,,0.49812,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9686,ERR3266363,ERX3292995,ERS3358378,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep2,SAMEA5556338,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556338|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep2|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep2 s,sponge ccn gfp positive rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8pos_S6_L004_R1_001.fastq.gz,fastq,747687619.0,9944417.0,E MTAB 7846:sponge ccn gfp positive rep2 lane4,0:75.19 1:0,A:208315943;C:164104155;G:169484250;T:205757712;N:25559,75,0,,,208315943,164104155,169484250,205757712,25559,ERX3292995,ERS3358378,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.94025,,0.17965,,0.68124,,0.49249,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9687,ERR3266356,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L001_R1_001.fastq.gz,fastq,600153564.0,7972767.0,E MTAB 7846:sponge ccn gfp positive rep1 lane1,0:75.28 1:0,A:165075878;C:133961511;G:138306424;T:162797903;N:11848,75,0,,,165075878,133961511,138306424,162797903,11848,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95367,,0.14146,,0.69154,,0.46621,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9688,ERR3266357,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L002_R1_001.fastq.gz,fastq,600790169.0,7981038.0,E MTAB 7846:sponge ccn gfp positive rep1 lane2,0:75.28 1:0,A:165262968;C:133988329;G:138458635;T:163066854;N:13383,75,0,,,165262968,133988329,138458635,163066854,13383,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95365,,0.14116,,0.69301,,0.46836,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9689,ERR3266358,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L003_R1_001.fastq.gz,fastq,608611085.0,8084904.0,E MTAB 7846:sponge ccn gfp positive rep1 lane3,0:75.28 1:0,A:167402055;C:135871708;G:140314669;T:165009252;N:13401,75,0,,,167402055,135871708,140314669,165009252,13401,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95403,,0.14167,,0.69311,,0.4702,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9690,ERR3266359,ERX3292994,ERS3358377,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp positive rep1,SAMEA5556337,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556337|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp positive rep1|age:72|broker name:ArrayExpress|cell type:GFP positive|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp positive rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp positive rep1 s,sponge ccn gfp positive rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP positive,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7pos_S8_L004_R1_001.fastq.gz,fastq,599558663.0,7964718.0,E MTAB 7846:sponge ccn gfp positive rep1 lane4,0:75.28 1:0,A:164965131;C:133749666;G:138194884;T:162633558;N:15424,75,0,,,164965131,133749666,138194884,162633558,15424,ERX3292994,ERS3358377,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95285,,0.14085,,0.69037,,0.47345,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9691,ERR3266352,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L001_R1_001.fastq.gz,fastq,599599608.0,7970460.0,E MTAB 7846:sponge ccn gfp negative rep2 lane1,0:75.23 1:0,A:162236409;C:136907675;G:141538730;T:158902520;N:14274,75,0,,,162236409,136907675,141538730,158902520,14274,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95404,,0.05923,,0.69737,,0.48627,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9692,ERR3266353,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L002_R1_001.fastq.gz,fastq,600057776.0,7976438.0,E MTAB 7846:sponge ccn gfp negative rep2 lane2,0:75.23 1:0,A:162367410;C:136994919;G:141577782;T:159102194;N:15471,75,0,,,162367410,136994919,141577782,159102194,15471,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.953,,0.06085,,0.6952,,0.48868,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9693,ERR3266354,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L003_R1_001.fastq.gz,fastq,607089697.0,8069901.0,E MTAB 7846:sponge ccn gfp negative rep2 lane3,0:75.23 1:0,A:164235344;C:138684000;G:143335680;T:160819270;N:15403,75,0,,,164235344,138684000,143335680,160819270,15403,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95245,,0.06055,,0.69589,,0.48813,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9694,ERR3266355,ERX3292993,ERS3358376,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep2,SAMEA5556336,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556336|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep2|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 4|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep2|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep2 s,sponge ccn gfp negative rep2 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_8neg_S5_L004_R1_001.fastq.gz,fastq,598098243.0,7950223.0,E MTAB 7846:sponge ccn gfp negative rep2 lane4,0:75.23 1:0,A:161836808;C:136564804;G:141157424;T:158521860;N:17347,75,0,,,161836808,136564804,141157424,158521860,17347,ERX3292993,ERS3358376,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95299,,0.06032,,0.69501,,0.48928,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9695,ERR3266348,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L001_R1_001.fastq.gz,fastq,668175990.0,8872549.0,E MTAB 7846:sponge ccn gfp negative rep1 lane1,0:75.31 1:0,A:179859350;C:153483169;G:158360605;T:176462088;N:10778,75,0,,,179859350,153483169,158360605,176462088,10778,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.95955,,0.07154,,0.69696,,0.46425,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9696,ERR3266349,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L002_R1_001.fastq.gz,fastq,668154755.0,8872093.0,E MTAB 7846:sponge ccn gfp negative rep1 lane2,0:75.31 1:0,A:179811687;C:153454931;G:158314391;T:176560936;N:12810,75,0,,,179811687,153454931,158314391,176560936,12810,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96029,,0.06969,,0.69684,,0.46725,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9697,ERR3266350,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L003_R1_001.fastq.gz,fastq,676984426.0,8989004.0,E MTAB 7846:sponge ccn gfp negative rep1 lane3,0:75.31 1:0,A:182159685;C:155578195;G:160511499;T:178722363;N:12684,75,0,,,182159685,155578195,160511499,178722363,12684,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96012,,0.07159,,0.69554,,0.46811,,75,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 9698,ERR3266351,ERX3292992,ERS3358375,ERP114712,PRJEB32081,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E-MTAB-7846,Transcriptome Analysis,To investigate the activity of sponge enhancers in vertebrates transgenic experiments was performed where sponge enhancers were inserted into zebrafish embryos and stable lines generated abstract: Transcription factors TFs bind DNA enhancer sequences to regulate gene transcription in animals. Unlike TFs the evolution of enhancers has been difficult to trace because of their fast evolution. Here we take enhancers in the sponge Amphimedon queenslandica and test their activity in zebrafish and mouse. Of the five sponge enhancers assessed three were located in conserved syntenic gene regions that are unique to animals Islet–Scaper Ccne1–Uri Tdrd3–Diaph3. Despite diverging over 700 million yrs ago and a dearth of sequence identity sponge enhancers are able to drive cell type specific reporter gene expression in vertebrates. Analysis of the type and frequency of TF binding motifs in the sponge Islet enhancer allowed for the identification of homologous enhancers in human and mouse which show remarkably similar reporter expression patterns to the sponge enhancer. These findings uncover an unexpected deep conservation of enhancers and suggest that enhancers established early in metazoan evolution can remain functional through retention of combinations of transcription factor binding motifs despite substantial sequence divergence.,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,,Protocols: 72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,sponge ccn gfp negative rep1,SAMEA5556335,UQ,ENA FIRST PUBLIC:2019 11 30T04:02:56Z|ENA LAST UPDATE:2019 04 08T12:20:25Z|External Id:SAMEA5556335|INSDC center name:UQ|INSDC first public:2019 11 30T04:02:56Z|INSDC last update:2019 04 08T12:20:25Z|INSDC status:public|Submitter Id:E MTAB 7846:sponge ccn gfp negative rep1|age:72|broker name:ArrayExpress|cell type:GFP negative|common name:zebrafish|developmental stage:larval protruding mouth|genotype:Tgsccne1 c19orf2:eGFPuq6mf|individual:pool 3|organism part:zebrafish comp1nt|sample name:E MTAB 7846:sponge ccn gfp negative rep1|scientific name:Danio rerio|sex:both|strain:A/B or Tu strains,,,,,,,,,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,E MTAB 7846:sponge ccn gfp negative rep1 s,sponge ccn gfp negative rep1 s,RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,72hpf zebrafish embryos were anesthetised with tricane diluted 1:1 in the embryo medium and the yolks were mechanically removed by pipetting up and down at least 10 times in calcium free ringer's solution. Zebrafish embryos were further digested in PBS containing 0.25% liberase at 28°C for 5 minutes and a single cell solution was prepared by passing through a 40μm nylon mesh. Both GFP positive and negative single cells were sorted into Trizol LS reagent Life Technologies respectively with a BD FACSAria Cell Sorter BD Biosciences. RNA was extracted using a Direct zol RNA extraction kit Zymo research. RNA Seq libraries were prepared from purified total RNA using a modified Smart Seq2 protocol developed by Picelli et al. 55. 2 ng of purified total RNA 0.4 ng/µL was combined with 1 µL of 10 µM oligo dT primer /5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN; Integrated DNA Technologies and 1 µL of dNTP mix 10 mM each; Invitrogen y02256 then the protocol was continued as described ref. 2. Briefly the RNA was reverse transcribed with the Smart Seq2 TSO /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG Integrated DNA Technologies followed by 12 cycles of PCR amplification to obtain enough cDNA to prepare a library. Volumes of reagents were scaled accordingly to maintain final concentration ratios as in the original protocol except for the PCR preamplification where the Smart Seq2 ISPCR primer /5Biosg/AAGCAGTGGTATCAACGCAGAGT; Integrated DNA Technologies was added to a final concentration of 0.25 µM. 0.5 ng of cDNA was prepped into a library using the Nextera XT DNA Library Prep Kit Illumina FC 131 1096 with 12 cycles of PCR used to amplify the final library. The final Nextera XT libraries were quantified on the Perkin Elmer LabChip GX with the DNA High Sensitivity Reagent kit Perkin Elmer CLS760672. Libraries were pooled in equimolar ratios.,Experimental Factor: genotype:Tgsccne1 c19orf2:eGFPuq6mf|Experimental Factor: cell type:GFP negative,RNA-Seq,TRANSCRIPTOMIC,PolyA,SINGLE,ILLUMINA,NextSeq 500,,ERP114712,NextSeq 500 sequencing; RNA seq of GFP positive and negative fractions of zebrafish transgenic cell lines of sea sponge enhancers,ENA FIRST PUBLIC:2019 11 30|ENA LAST UPDATE:2019 04 08,E6_7neg_S7_L004_R1_001.fastq.gz,fastq,666031892.0,8843695.0,E MTAB 7846:sponge ccn gfp negative rep1 lane4,0:75.31 1:0,A:179243298;C:152946459;G:157873912;T:175953752;N:14471,75,0,,,179243298,152946459,157873912,175953752,14471,ERX3292992,ERS3358375,ERA1822647,European Nucleotide Archive,European Nucleotide Archive,1,0.96014,,0.07169,,0.69493,,0.47058,,76,,B,,usable mapping rate,illumina,nextseq,unknown,poly_a,nextera,sc,single_cell_plate,smartseq,,Unknown,2019-04-08,Larval,Larval,Embryo Imprecise,All anatomical structures 28389,SRR26213385,SRX21923919,SRS19008430,SRP463773,PRJNA1022165,Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.,GSE244308,Transcriptome Analysis,Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.,,,,Neutrophils WT infected 4,GSM7813285,,tissue:Neutrophil|developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2/WT|infection:Salm1lla typhimurium|geo loc name:missing|collection date:missing,Neutrophils WT infected 4,The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.,Neutrophil,At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions,developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2/WT|infection:Salm1lla typhimurium,GSM7813285,GSM7813285: Neutrophils WT infected 4; Danio rerio; RNA Seq,GSM7813285 r1,GSM7813285,1,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP463773,,loader:fastq load.py,WTInfected-4_S8_R1_001.fastq.gz,fastq,2240130033.0,29683768.0,GSM7813285 r1,0:75.47,A:639465198;C:479506246;G:493408026;T:627654835;N:95728,75,,,,639465198,479506246,493408026,627654835,95728,SRX21923919,SRS19008430,SRA1722831,The University of Auckland,The University of Auckland,1,0.89082,,0.28084,,0.75523,,0.4978,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,New Zealand,2023-09-28,Larval,Larval,Blood,Hematopoietic System 28390,SRR26213386,SRX21923918,SRS19008429,SRP463773,PRJNA1022165,Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.,GSE244308,Transcriptome Analysis,Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.,,,,Neutrophils WT infected 3,GSM7813284,,tissue:Neutrophil|developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2/WT|infection:Salm1lla typhimurium|geo loc name:missing|collection date:missing,Neutrophils WT infected 3,The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.,Neutrophil,At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions,developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2/WT|infection:Salm1lla typhimurium,GSM7813284,GSM7813284: Neutrophils WT infected 3; Danio rerio; RNA Seq,GSM7813284 r1,GSM7813284,1,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP463773,,loader:fastq load.py,WTInfected-3_S7_R1_001.fastq.gz,fastq,2789643441.0,37059064.0,GSM7813284 r1,0:75.28,A:770315857;C:626379098;G:642210747;T:750373702;N:364037,75,,,,770315857,626379098,642210747,750373702,364037,SRX21923918,SRS19008429,SRA1722831,The University of Auckland,The University of Auckland,1,0.89494,,0.12907,,0.81154,,0.50044,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,New Zealand,2023-09-28,Larval,Larval,Blood,Hematopoietic System 28391,SRR26213387,SRX21923917,SRS19008428,SRP463773,PRJNA1022165,Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.,GSE244308,Transcriptome Analysis,Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.,,,,Neutrophils WT infected 2,GSM7813283,,tissue:Neutrophil|developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2/WT|infection:Salm1lla typhimurium|geo loc name:missing|collection date:missing,Neutrophils WT infected 2,The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.,Neutrophil,At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions,developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2/WT|infection:Salm1lla typhimurium,GSM7813283,GSM7813283: Neutrophils WT infected 2; Danio rerio; RNA Seq,GSM7813283 r1,GSM7813283,1,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP463773,,loader:fastq load.py,WTInfected-2_S6_R1_001.fastq.gz,fastq,2502579643.0,33171064.0,GSM7813283 r1,0:75.44,A:690295075;C:562877524;G:577315919;T:671999174;N:91951,75,,,,690295075,562877524,577315919,671999174,91951,SRX21923917,SRS19008428,SRA1722831,The University of Auckland,The University of Auckland,1,0.89596,,0.11653,,0.82562,,0.47762,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,New Zealand,2023-09-28,Larval,Larval,Blood,Hematopoietic System 28392,SRR26213388,SRX21923916,SRS19008427,SRP463773,PRJNA1022165,Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.,GSE244308,Transcriptome Analysis,Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.,,,,Neutrophils WT infected 1,GSM7813282,,tissue:Neutrophil|developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2/WT|infection:Salm1lla typhimurium|geo loc name:missing|collection date:missing,Neutrophils WT infected 1,The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.,Neutrophil,At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions,developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2/WT|infection:Salm1lla typhimurium,GSM7813282,GSM7813282: Neutrophils WT infected 1; Danio rerio; RNA Seq,GSM7813282 r1,GSM7813282,1,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP463773,,loader:fastq load.py,WTInfected-1_S5_R1_001.fastq.gz,fastq,2629109363.0,34890907.0,GSM7813282 r1,0:75.35,A:717313087;C:596048245;G:613729475;T:701790568;N:227988,75,,,,717313087,596048245,613729475,701790568,227988,SRX21923916,SRS19008427,SRA1722831,The University of Auckland,The University of Auckland,1,0.88964,,0.13171,,0.81142,,0.49273,,73,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,New Zealand,2023-09-28,Larval,Larval,Blood,Hematopoietic System 28393,SRR26213389,SRX21923915,SRS19008426,SRP463773,PRJNA1022165,Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.,GSE244308,Transcriptome Analysis,Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.,,,,Neutrophils per2 infected 4,GSM7813281,,tissue:Neutrophil|developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2;per2 / |infection:Salm1lla typhimurium|geo loc name:missing|collection date:missing,Neutrophils per2 infected 4,The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.,Neutrophil,At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions,developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2;per2 / |infection:Salm1lla typhimurium,GSM7813281,GSM7813281: Neutrophils per2 infected 4; Danio rerio; RNA Seq,GSM7813281 r1,GSM7813281,1,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP463773,,loader:fastq load.py,per2Infected-4_S16_R1_001.fastq.gz,fastq,2915831120.0,38708122.0,GSM7813281 r1,0:75.33,A:819771092;C:637630362;G:654348519;T:803699649;N:381498,75,,,,819771092,637630362,654348519,803699649,381498,SRX21923915,SRS19008426,SRA1722831,The University of Auckland,The University of Auckland,1,0.90568,,0.15837,,0.82055,,0.49547,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,New Zealand,2023-09-28,Larval,Larval,Blood,Hematopoietic System 28394,SRR26213390,SRX21923914,SRS19008425,SRP463773,PRJNA1022165,Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.,GSE244308,Transcriptome Analysis,Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.,,,,Neutrophils per2 infected 3,GSM7813280,,tissue:Neutrophil|developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2;per2 / |infection:Salm1lla typhimurium|geo loc name:missing|collection date:missing,Neutrophils per2 infected 3,The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.,Neutrophil,At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions,developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2;per2 / |infection:Salm1lla typhimurium,GSM7813280,GSM7813280: Neutrophils per2 infected 3; Danio rerio; RNA Seq,GSM7813280 r1,GSM7813280,1,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP463773,,loader:fastq load.py,per2Infected-3_S15_R1_001.fastq.gz,fastq,2622630688.0,34745018.0,GSM7813280 r1,0:75.48,A:726047024;C:584906297;G:600999032;T:710582433;N:95902,75,,,,726047024,584906297,600999032,710582433,95902,SRX21923914,SRS19008425,SRA1722831,The University of Auckland,The University of Auckland,1,0.91129,,0.1229,,0.81345,,0.48284,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,New Zealand,2023-09-28,Larval,Larval,Blood,Hematopoietic System 28395,SRR26213391,SRX21923913,SRS19008424,SRP463773,PRJNA1022165,Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.,GSE244308,Transcriptome Analysis,Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.,,,,Neutrophils per2 infected 2,GSM7813279,,tissue:Neutrophil|developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2;per2 / |infection:Salm1lla typhimurium|geo loc name:missing|collection date:missing,Neutrophils per2 infected 2,The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.,Neutrophil,At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions,developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2;per2 / |infection:Salm1lla typhimurium,GSM7813279,GSM7813279: Neutrophils per2 infected 2; Danio rerio; RNA Seq,GSM7813279 r1,GSM7813279,1,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP463773,,loader:fastq load.py,per2Infected-2_S14_R1_001.fastq.gz,fastq,2152892336.0,28547218.0,GSM7813279 r1,0:75.42,A:594950127;C:480727855;G:495163350;T:581915730;N:135274,75,,,,594950127,480727855,495163350,581915730,135274,SRX21923913,SRS19008424,SRA1722831,The University of Auckland,The University of Auckland,1,0.9068,,0.11944,,0.82804,,0.48956,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,New Zealand,2023-09-28,Larval,Larval,Blood,Hematopoietic System 28396,SRR26213392,SRX21923912,SRS19008423,SRP463773,PRJNA1022165,Transcriptomic analysis of Per2 deficient neutrophils compared WT neutrophils following infection.,GSE244308,Transcriptome Analysis,Functional analysis demonstrates that neutrophils deficient in Per2 have reduced bactericidal activity when compared WT neutrophils. Overall design: Differential gene expression analysis of RNA seq data from Per2 deficient neutrophils and WT neutrophils post Salmonella typhimurium infection in biological quadruplet.,,,,Neutrophils per2 infected 1,GSM7813278,,tissue:Neutrophil|developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2;per2 / |infection:Salm1lla typhimurium|geo loc name:missing|collection date:missing,Neutrophils per2 infected 1,The filtered clean reads were mapped to the Danio rerio reference genome GRCz10 by HISAT2. Expression levels were measured as FPKM using the Cuffquant and Cuffnorm components of Cufflinks software. DESeq was used to analyze the DEGs between sets of two groups as a control treatment pairwise comparison. The expression log2FC was set to >1 and the FDR was set to <0.05. Assembly: GRCz10 Supplementary files format and content: Comma separated values file show FPKM Log2FC and adj P value of DEGs comparing Per2Infected and WTInfected samples.,Neutrophil,At 52 hpf 4 hours post lights on Tglyz:DsRED2/WT and Tglyz:DsRED2;per2 / zebrafish larvae we infected with 1 000 CFU Salmonella Typhimurium and neutrophils were isolated at 3 hours post infection by FACS.,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,Tglyz:DsRED2 zebrafish larvae were raised in E3 medium supplemented with 0.003% PTU at 28C under standard light:dark conditions,developmental stage:larvae|cell type:Neutrophil|genotype:Tglyz:DsRED2;per2 / |infection:Salm1lla typhimurium,GSM7813278,GSM7813278: Neutrophils per2 infected 1; Danio rerio; RNA Seq,GSM7813278 r1,GSM7813278,1,Larvae were homogenized in 0.25% trypsin with mechanical agitation prior to FACS isolation of 1 000 neutrophils per sample. cDNA was synthesised directly from cell lysates using the SMART Seq v4 Ultra Low Input RNA kit for sequencing Takara Bio Libraries were made using the Nextera XT DNA Library Preparation Kit Illumina.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP463773,,loader:fastq load.py,per2Infcted-1_S13_R1_001.fastq.gz,fastq,2276537599.0,30215018.0,GSM7813278 r1,0:75.34,A:614225653;C:523562022;G:541795396;T:596817124;N:137404,75,,,,614225653,523562022,541795396,596817124,137404,SRX21923912,SRS19008423,SRA1722831,The University of Auckland,The University of Auckland,1,0.92361,,0.09247,,0.81324,,0.46862,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,New Zealand,2023-09-28,Larval,Larval,Blood,Hematopoietic System 29894,SRR30873028,SRX26270368,SRS22808226,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep15,GSM8553345,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types|geo loc name:missing|collection date:missing,arid1b 6 dpf rep15,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types,GSM8553345,GSM8553345: arid1b 6 dpf rep15; Danio rerio; RNA Seq,GSM8553345 r1,GSM8553345,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-wt_AR28_S28_R1_001.fastq.gz,fastq,4135380800.0,41353808.0,GSM8553345 r1,0:100,A:1084939463;C:1011079577;G:970891275;T:1068398012;N:72473,100,,,,1084939463,1011079577,970891275,1068398012,72473,SRX26270368,SRS22808226,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29895,SRR30873029,SRX26270367,SRS22808225,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep14,GSM8553344,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types|geo loc name:missing|collection date:missing,arid1b 6 dpf rep14,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types,GSM8553344,GSM8553344: arid1b 6 dpf rep14; Danio rerio; RNA Seq,GSM8553344 r1,GSM8553344,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-wt_AR27_S27_R1_001.fastq.gz,fastq,6224312000.0,62243120.0,GSM8553344 r1,0:100,A:1606079574;C:1540033115;G:1483199092;T:1594888859;N:111360,100,,,,1606079574,1540033115,1483199092,1594888859,111360,SRX26270367,SRS22808225,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29896,SRR30873030,SRX26270366,SRS22808224,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep13,GSM8553343,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types|geo loc name:missing|collection date:missing,arid1b 6 dpf rep13,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types,GSM8553343,GSM8553343: arid1b 6 dpf rep13; Danio rerio; RNA Seq,GSM8553343 r1,GSM8553343,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-wt_AR26_S26_R1_001.fastq.gz,fastq,4549812900.0,45498129.0,GSM8553343 r1,0:100,A:1188852707;C:1130004381;G:1033560381;T:1197314769;N:80662,100,,,,1188852707,1130004381,1033560381,1197314769,80662,SRX26270366,SRS22808224,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29897,SRR30873031,SRX26270365,SRS22808223,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep12,GSM8553342,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types|geo loc name:missing|collection date:missing,arid1b 6 dpf rep12,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types,GSM8553342,GSM8553342: arid1b 6 dpf rep12; Danio rerio; RNA Seq,GSM8553342 r1,GSM8553342,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-wt_AR25_S25_R1_001.fastq.gz,fastq,4879728400.0,48797284.0,GSM8553342 r1,0:100,A:1257198257;C:1231843411;G:1157132375;T:1233469179;N:85178,100,,,,1257198257,1231843411,1157132375,1233469179,85178,SRX26270365,SRS22808223,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29898,SRR30873032,SRX26270364,SRS22808222,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep11,GSM8553341,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types|geo loc name:missing|collection date:missing,arid1b 6 dpf rep11,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i wild types,GSM8553341,GSM8553341: arid1b 6 dpf rep11; Danio rerio; RNA Seq,GSM8553341 r1,GSM8553341,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-wt_AR24_S24_R1_001.fastq.gz,fastq,4082165400.0,40821654.0,GSM8553341 r1,0:100,A:1040984378;C:1022942149;G:978845633;T:1039318707;N:74533,100,,,,1040984378,1022942149,978845633,1039318707,74533,SRX26270364,SRS22808222,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29899,SRR30873033,SRX26270363,SRS22808221,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep10,GSM8553340,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep10,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous,GSM8553340,GSM8553340: arid1b 6 dpf rep10; Danio rerio; RNA Seq,GSM8553340 r1,GSM8553340,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-hom_AR23_S23_R1_001.fastq.gz,fastq,4661017700.0,46610177.0,GSM8553340 r1,0:100,A:1238725482;C:1138186288;G:1061058641;T:1222964445;N:82844,100,,,,1238725482,1138186288,1061058641,1222964445,82844,SRX26270363,SRS22808221,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29900,SRR30873034,SRX26270362,SRS22808220,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep9,GSM8553339,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep9,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous,GSM8553339,GSM8553339: arid1b 6 dpf rep9; Danio rerio; RNA Seq,GSM8553339 r1,GSM8553339,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-hom_AR22_S22_R1_001.fastq.gz,fastq,4221752400.0,42217524.0,GSM8553339 r1,0:100,A:1065652742;C:1071696614;G:1016007642;T:1068321142;N:74260,100,,,,1065652742,1071696614,1016007642,1068321142,74260,SRX26270362,SRS22808220,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29901,SRR30873035,SRX26270361,SRS22808219,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep8,GSM8553338,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep8,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous,GSM8553338,GSM8553338: arid1b 6 dpf rep8; Danio rerio; RNA Seq,GSM8553338 r1,GSM8553338,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-hom_AR21_S21_R1_001.fastq.gz,fastq,4432057900.0,44320579.0,GSM8553338 r1,0:100,A:1141942260;C:1108384050;G:1058194972;T:1123456708;N:79910,100,,,,1141942260,1108384050,1058194972,1123456708,79910,SRX26270361,SRS22808219,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29902,SRR30873036,SRX26270360,SRS22808218,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep7,GSM8553337,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep7,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous,GSM8553337,GSM8553337: arid1b 6 dpf rep7; Danio rerio; RNA Seq,GSM8553337 r1,GSM8553337,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-hom_AR20_S20_R1_001.fastq.gz,fastq,4445102100.0,44451021.0,GSM8553337 r1,0:100,A:1155131497;C:1102948564;G:1044423066;T:1142521451;N:77522,100,,,,1155131497,1102948564,1044423066,1142521451,77522,SRX26270360,SRS22808218,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29903,SRR30873037,SRX26270359,SRS22808217,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep6,GSM8553336,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep6,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i homozygous,GSM8553336,GSM8553336: arid1b 6 dpf rep6; Danio rerio; RNA Seq,GSM8553336 r1,GSM8553336,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-hom_AR19_S19_R1_001.fastq.gz,fastq,4466739200.0,44667392.0,GSM8553336 r1,0:100,A:1142963908;C:1130243443;G:1069626640;T:1123824589;N:80620,100,,,,1142963908,1130243443,1069626640,1123824589,80620,SRX26270359,SRS22808217,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29904,SRR30873038,SRX26270358,SRS22808216,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep5,GSM8553335,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep5,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous,GSM8553335,GSM8553335: arid1b 6 dpf rep5; Danio rerio; RNA Seq,GSM8553335 r1,GSM8553335,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-het_AR18_S18_R1_001.fastq.gz,fastq,3870464200.0,38704642.0,GSM8553335 r1,0:100,A:1000259085;C:960215025;G:917241491;T:992680013;N:68586,100,,,,1000259085,960215025,917241491,992680013,68586,SRX26270358,SRS22808216,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29905,SRR30873039,SRX26270357,SRS22808215,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep4,GSM8553334,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep4,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous,GSM8553334,GSM8553334: arid1b 6 dpf rep4; Danio rerio; RNA Seq,GSM8553334 r1,GSM8553334,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-het_AR17_S17_R1_001.fastq.gz,fastq,4594184100.0,45941841.0,GSM8553334 r1,0:100,A:1184283243;C:1151731213;G:1096934508;T:1161152565;N:82571,100,,,,1184283243,1151731213,1096934508,1161152565,82571,SRX26270357,SRS22808215,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29906,SRR30873040,SRX26270356,SRS22808214,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep3,GSM8553333,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep3,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous,GSM8553333,GSM8553333: arid1b 6 dpf rep3; Danio rerio; RNA Seq,GSM8553333 r1,GSM8553333,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-het_AR16_S16_R1_001.fastq.gz,fastq,4941522000.0,49415220.0,GSM8553333 r1,0:100,A:1259383920;C:1247709712;G:1186755788;T:1247582989;N:89591,100,,,,1259383920,1247709712,1186755788,1247582989,89591,SRX26270356,SRS22808214,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29907,SRR30873041,SRX26270355,SRS22808213,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep2,GSM8553332,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep2,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous,GSM8553332,GSM8553332: arid1b 6 dpf rep2; Danio rerio; RNA Seq,GSM8553332 r1,GSM8553332,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-het_AR15_S15_R1_001.fastq.gz,fastq,4104651300.0,41046513.0,GSM8553332 r1,0:100,A:1076649631;C:1007609502;G:973534133;T:1046799245;N:58789,100,,,,1076649631,1007609502,973534133,1046799245,58789,SRX26270355,SRS22808213,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29908,SRR30873042,SRX26270354,SRS22808212,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,arid1b 6 dpf rep1,GSM8553331,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous|geo loc name:missing|collection date:missing,arid1b 6 dpf rep1,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:arid1b 195d50i heterozygous,GSM8553331,GSM8553331: arid1b 6 dpf rep1; Danio rerio; RNA Seq,GSM8553331 r1,GSM8553331,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,,arid1b-195d50i-het_AR14_S14_R1_001.fastq.gz,fastq,2182363600.0,21823636.0,GSM8553331 r1,0:100,A:567445925;C:541275778;G:507884278;T:565718419;N:39200,100,,,,567445925,541275778,507884278,565718419,39200,SRX26270354,SRS22808212,SRA1985473,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-10-03,Larval,Larval,Multi-tissue,Multi-system 29960,SRR27592985,SRX23261695,SRS20163660,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep14,GSM8020155,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i wild types|geo loc name:missing|collection date:missing,deaf1 6 dpf rep14,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i wild types,GSM8020155,GSM8020155: deaf1 6 dpf rep14; Danio rerio; RNA Seq,GSM8020155 r1,GSM8020155,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-wt_C4_S28_R1_001.fastq.gz,fastq,3929983225.0,38910725.0,GSM8020155 r1,0:101,A:1024547567;C:957640911;G:915138235;T:1032535260;N:121252,101,,,,1024547567,957640911,915138235,1032535260,121252,SRX23261695,SRS20163660,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29961,SRR27592986,SRX23261694,SRS20163658,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep13,GSM8020154,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i wild types|geo loc name:missing|collection date:missing,deaf1 6 dpf rep13,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i wild types,GSM8020154,GSM8020154: deaf1 6 dpf rep13; Danio rerio; RNA Seq,GSM8020154 r1,GSM8020154,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-wt_C3_S27_R1_001.fastq.gz,fastq,3398044101.0,33644001.0,GSM8020154 r1,0:101,A:885187846;C:821364346;G:803770460;T:887617386;N:104063,101,,,,885187846,821364346,803770460,887617386,104063,SRX23261694,SRS20163658,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29962,SRR27592987,SRX23261693,SRS20163659,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep12,GSM8020153,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i wild types|geo loc name:missing|collection date:missing,deaf1 6 dpf rep12,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i wild types,GSM8020153,GSM8020153: deaf1 6 dpf rep12; Danio rerio; RNA Seq,GSM8020153 r1,GSM8020153,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-wt_C2_S26_R1_001.fastq.gz,fastq,5035800713.0,49859413.0,GSM8020153 r1,0:101,A:1333647614;C:1193799648;G:1179125857;T:1329071614;N:155980,101,,,,1333647614,1193799648,1179125857,1329071614,155980,SRX23261693,SRS20163659,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29963,SRR27592988,SRX23261692,SRS20163657,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep11,GSM8020152,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i wild types|geo loc name:missing|collection date:missing,deaf1 6 dpf rep11,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i wild types,GSM8020152,GSM8020152: deaf1 6 dpf rep11; Danio rerio; RNA Seq,GSM8020152 r1,GSM8020152,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-wt_C1_S25_R1_001.fastq.gz,fastq,3565807727.0,35305027.0,GSM8020152 r1,0:101,A:912147405;C:880055335;G:858888661;T:914605631;N:110695,101,,,,912147405,880055335,858888661,914605631,110695,SRX23261692,SRS20163657,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29964,SRR27592989,SRX23261691,SRS20163655,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep10,GSM8020151,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous|geo loc name:missing|collection date:missing,deaf1 6 dpf rep10,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous,GSM8020151,GSM8020151: deaf1 6 dpf rep10; Danio rerio; RNA Seq,GSM8020151 r1,GSM8020151,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-hom_B12_S24_R1_001.fastq.gz,fastq,3931681439.0,38927539.0,GSM8020151 r1,0:101,A:1019714387;C:963143457;G:926446608;T:1022254324;N:122663,101,,,,1019714387,963143457,926446608,1022254324,122663,SRX23261691,SRS20163655,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29965,SRR27592990,SRX23261690,SRS20163654,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep9,GSM8020150,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous|geo loc name:missing|collection date:missing,deaf1 6 dpf rep9,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous,GSM8020150,GSM8020150: deaf1 6 dpf rep9; Danio rerio; RNA Seq,GSM8020150 r1,GSM8020150,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-hom_B11_S23_R1_001.fastq.gz,fastq,3494769074.0,34601674.0,GSM8020150 r1,0:101,A:900665381;C:855792466;G:834354551;T:903848341;N:108335,101,,,,900665381,855792466,834354551,903848341,108335,SRX23261690,SRS20163654,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29966,SRR27592991,SRX23261689,SRS20163653,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep8,GSM8020149,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous|geo loc name:missing|collection date:missing,deaf1 6 dpf rep8,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous,GSM8020149,GSM8020149: deaf1 6 dpf rep8; Danio rerio; RNA Seq,GSM8020149 r1,GSM8020149,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-hom_B10_S22_R1_001.fastq.gz,fastq,5266326042.0,52141842.0,GSM8020149 r1,0:101,A:1377092992;C:1271335207;G:1235215906;T:1382519057;N:162880,101,,,,1377092992,1271335207,1235215906,1382519057,162880,SRX23261689,SRS20163653,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29967,SRR27592992,SRX23261688,SRS20163656,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep7,GSM8020148,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous|geo loc name:missing|collection date:missing,deaf1 6 dpf rep7,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous,GSM8020148,GSM8020148: deaf1 6 dpf rep7; Danio rerio; RNA Seq,GSM8020148 r1,GSM8020148,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-hom_B9_S21_R1_001.fastq.gz,fastq,3981685832.0,39422632.0,GSM8020148 r1,0:101,A:1027397987;C:970696826;G:955899926;T:1027567681;N:123412,101,,,,1027397987,970696826,955899926,1027567681,123412,SRX23261688,SRS20163656,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29968,SRR27592993,SRX23261687,SRS20163652,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep6,GSM8020147,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous|geo loc name:missing|collection date:missing,deaf1 6 dpf rep6,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i homozygous,GSM8020147,GSM8020147: deaf1 6 dpf rep6; Danio rerio; RNA Seq,GSM8020147 r1,GSM8020147,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-hom_B8_S20_R1_001.fastq.gz,fastq,3511062899.0,34762999.0,GSM8020147 r1,0:101,A:920619550;C:847444051;G:821952225;T:920937641;N:109432,101,,,,920619550,847444051,821952225,920937641,109432,SRX23261687,SRS20163652,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29969,SRR27592994,SRX23261686,SRS20163651,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep5,GSM8020146,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i heterozygous|geo loc name:missing|collection date:missing,deaf1 6 dpf rep5,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i heterozygous,GSM8020146,GSM8020146: deaf1 6 dpf rep5; Danio rerio; RNA Seq,GSM8020146 r1,GSM8020146,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-het_B7_S19_R1_001.fastq.gz,fastq,3584512624.0,35490224.0,GSM8020146 r1,0:101,A:913282881;C:889075256;G:865104443;T:916938683;N:111361,101,,,,913282881,889075256,865104443,916938683,111361,SRX23261686,SRS20163651,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29970,SRR27592995,SRX23261685,SRS20163650,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,deaf1 6 dpf rep4,GSM8020145,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i heterozygous|geo loc name:missing|collection date:missing,deaf1 6 dpf rep4,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:deaf1 23d46i heterozygous,GSM8020145,GSM8020145: deaf1 6 dpf rep4; Danio rerio; RNA Seq,GSM8020145 r1,GSM8020145,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,deaf1-23d46i-6dpf-het_B6_S18_R1_001.fastq.gz,fastq,1942752978.0,19235178.0,GSM8020145 r1,0:101,A:510778300;C:474772116;G:456593849;T:500548378;N:60335,101,,,,510778300,474772116,456593849,500548378,60335,SRX23261685,SRS20163650,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29972,SRR27592997,SRX23261683,SRS20163648,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep11,GSM8020215,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b wild types|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep11,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b wild types,GSM8020215,GSM8020215: kmt5b 6 dpf rep11; Danio rerio; RNA Seq,GSM8020215 r1,GSM8020215,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-wt_ST12_S11_L001_R1_001.fastq.gz,fastq,2811106942.0,27832742.0,GSM8020215 r1,0:101,A:742607456;C:672481785;G:661003699;T:735010237;N:3765,101,,,,742607456,672481785,661003699,735010237,3765,SRX23261683,SRS20163648,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29973,SRR27592998,SRX23261682,SRS20163646,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep10,GSM8020214,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b wild types|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep10,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b wild types,GSM8020214,GSM8020214: kmt5b 6 dpf rep10; Danio rerio; RNA Seq,GSM8020214 r1,GSM8020214,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-wt_ST11_S10_L001_R1_001.fastq.gz,fastq,2995768474.0,29661074.0,GSM8020214 r1,0:101,A:778796313;C:726678609;G:718151791;T:772137908;N:3853,101,,,,778796313,726678609,718151791,772137908,3853,SRX23261682,SRS20163646,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29974,SRR27592999,SRX23261681,SRS20163647,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep9,GSM8020213,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b wild types|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep9,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b wild types,GSM8020213,GSM8020213: kmt5b 6 dpf rep9; Danio rerio; RNA Seq,GSM8020213 r1,GSM8020213,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-wt_ST10_S9_L001_R1_001.fastq.gz,fastq,3100692122.0,30699922.0,GSM8020213 r1,0:101,A:802618514;C:755714809;G:746538025;T:795816685;N:4089,101,,,,802618514,755714809,746538025,795816685,4089,SRX23261681,SRS20163647,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29975,SRR27593000,SRX23261680,SRS20163645,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep8,GSM8020212,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b homozygous|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep8,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b homozygous,GSM8020212,GSM8020212: kmt5b 6 dpf rep8; Danio rerio; RNA Seq,GSM8020212 r1,GSM8020212,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-hom_ST9_S8_L001_R1_001.fastq.gz,fastq,3106011792.0,30752592.0,GSM8020212 r1,0:101,A:863424381;C:702180650;G:684425392;T:855977322;N:4047,101,,,,863424381,702180650,684425392,855977322,4047,SRX23261680,SRS20163645,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29976,SRR27593001,SRX23261679,SRS20163644,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep7,GSM8020211,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b homozygous|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep7,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b homozygous,GSM8020211,GSM8020211: kmt5b 6 dpf rep7; Danio rerio; RNA Seq,GSM8020211 r1,GSM8020211,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-hom_ST8_S7_L001_R1_001.fastq.gz,fastq,3075023982.0,30445782.0,GSM8020211 r1,0:101,A:835646166;C:717541810;G:703459633;T:818372433;N:3940,101,,,,835646166,717541810,703459633,818372433,3940,SRX23261679,SRS20163644,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29977,SRR27593002,SRX23261678,SRS20163643,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep6,GSM8020210,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b homozygous|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep6,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b homozygous,GSM8020210,GSM8020210: kmt5b 6 dpf rep6; Danio rerio; RNA Seq,GSM8020210 r1,GSM8020210,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-hom_ST7_S6_L001_R1_001.fastq.gz,fastq,2624342186.0,25983586.0,GSM8020210 r1,0:101,A:679347120;C:640703762;G:632252315;T:672035427;N:3562,101,,,,679347120,640703762,632252315,672035427,3562,SRX23261678,SRS20163643,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29978,SRR27593003,SRX23261677,SRS20163642,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep5,GSM8020209,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b homozygous|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep5,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b homozygous,GSM8020209,GSM8020209: kmt5b 6 dpf rep5; Danio rerio; RNA Seq,GSM8020209 r1,GSM8020209,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-hom_ST6_S5_L001_R1_001.fastq.gz,fastq,5437715063.0,53838763.0,GSM8020209 r1,0:101,A:1481531392;C:1262906390;G:1249347683;T:1443922426;N:7172,101,,,,1481531392,1262906390,1249347683,1443922426,7172,SRX23261677,SRS20163642,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29979,SRR27593004,SRX23261676,SRS20163641,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep4,GSM8020208,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b heterozygous|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep4,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b heterozygous,GSM8020208,GSM8020208: kmt5b 6 dpf rep4; Danio rerio; RNA Seq,GSM8020208 r1,GSM8020208,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-het_ST5_S4_L001_R1_001.fastq.gz,fastq,3496810587.0,34621887.0,GSM8020208 r1,0:101,A:920956592;C:840496211;G:832829579;T:902523782;N:4423,101,,,,920956592,840496211,832829579,902523782,4423,SRX23261676,SRS20163641,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29980,SRR27593005,SRX23261675,SRS20163640,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep3,GSM8020207,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b heterozygous|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep3,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b heterozygous,GSM8020207,GSM8020207: kmt5b 6 dpf rep3; Danio rerio; RNA Seq,GSM8020207 r1,GSM8020207,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-het_ST4_S3_L001_R1_001.fastq.gz,fastq,3779380105.0,37419605.0,GSM8020207 r1,0:101,A:998848737;C:910675528;G:892963309;T:976887623;N:4908,101,,,,998848737,910675528,892963309,976887623,4908,SRX23261675,SRS20163640,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29981,SRR27593006,SRX23261674,SRS20163639,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep2,GSM8020206,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b heterozygous|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep2,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b heterozygous,GSM8020206,GSM8020206: kmt5b 6 dpf rep2; Danio rerio; RNA Seq,GSM8020206 r1,GSM8020206,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-het_ST3_S2_L001_R1_001.fastq.gz,fastq,4697277599.0,46507699.0,GSM8020206 r1,0:101,A:1214157843;C:1147760212;G:1129537221;T:1205816178;N:6145,101,,,,1214157843,1147760212,1129537221,1205816178,6145,SRX23261674,SRS20163639,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29982,SRR27593007,SRX23261673,SRS20163638,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,kmt5b 6 dpf rep1,GSM8020205,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:kmt5b heterozygous|geo loc name:missing|collection date:missing,kmt5b 6 dpf rep1,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:kmt5b heterozygous,GSM8020205,GSM8020205: kmt5b 6 dpf rep1; Danio rerio; RNA Seq,GSM8020205 r1,GSM8020205,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,kmt5b-6dpf-het_ST2_S1_L001_R1_001.fastq.gz,fastq,4057743175.0,40175675.0,GSM8020205 r1,0:101,A:1072507807;C:970584483;G:958817150;T:1055828545;N:5190,101,,,,1072507807,970584483,958817150,1055828545,5190,SRX23261673,SRS20163638,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29983,SRR27593008,SRX23261672,SRS20163637,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,hdlbpa 6 dpf rep10,GSM8020204,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:hdlbpa wild types|geo loc name:missing|collection date:missing,hdlbpa 6 dpf rep10,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:hdlbpa wild types,GSM8020204,GSM8020204: hdlbpa 6 dpf rep10; Danio rerio; RNA Seq,GSM8020204 r1,GSM8020204,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,hdlbpa-6dpf-wt_H14_S21_L002_R1_001.fastq.gz,fastq,5345570642.0,52926442.0,GSM8020204 r1,0:101,A:1439943379;C:1249929878;G:1229033309;T:1426645468;N:18608,101,,,,1439943379,1249929878,1229033309,1426645468,18608,SRX23261672,SRS20163637,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29984,SRR27593009,SRX23261671,SRS20163636,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,hdlbpa 6 dpf rep9,GSM8020203,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:hdlbpa wild types|geo loc name:missing|collection date:missing,hdlbpa 6 dpf rep9,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:hdlbpa wild types,GSM8020203,GSM8020203: hdlbpa 6 dpf rep9; Danio rerio; RNA Seq,GSM8020203 r1,GSM8020203,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,hdlbpa-6dpf-wt_H13_S20_L002_R1_001.fastq.gz,fastq,3927587101.0,38887001.0,GSM8020203 r1,0:101,A:1065676696;C:913744882;G:891757533;T:1056394325;N:13665,101,,,,1065676696,913744882,891757533,1056394325,13665,SRX23261671,SRS20163636,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29985,SRR27593010,SRX23261670,SRS20163635,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,hdlbpa 6 dpf rep8,GSM8020202,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:hdlbpa wild types|geo loc name:missing|collection date:missing,hdlbpa 6 dpf rep8,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:hdlbpa wild types,GSM8020202,GSM8020202: hdlbpa 6 dpf rep8; Danio rerio; RNA Seq,GSM8020202 r1,GSM8020202,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,hdlbpa-6dpf-wt_H12_S19_L002_R1_001.fastq.gz,fastq,6495421706.0,64311106.0,GSM8020202 r1,0:101,A:1776534004;C:1513743907;G:1447648946;T:1757472399;N:22450,101,,,,1776534004,1513743907,1447648946,1757472399,22450,SRX23261670,SRS20163635,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29986,SRR27593011,SRX23261669,SRS20163634,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,hdlbpa 6 dpf rep7,GSM8020201,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:hdlbpa wild types|geo loc name:missing|collection date:missing,hdlbpa 6 dpf rep7,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:hdlbpa wild types,GSM8020201,GSM8020201: hdlbpa 6 dpf rep7; Danio rerio; RNA Seq,GSM8020201 r1,GSM8020201,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,hdlbpa-6dpf-wt_H11_S18_L002_R1_001.fastq.gz,fastq,3911576379.0,38728479.0,GSM8020201 r1,0:101,A:1058589544;C:907080870;G:898659386;T:1047232965;N:13614,101,,,,1058589544,907080870,898659386,1047232965,13614,SRX23261669,SRS20163634,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29987,SRR27593012,SRX23261668,SRS20163633,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,hdlbpa 6 dpf rep6,GSM8020200,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:hdlbpa homozygous|geo loc name:missing|collection date:missing,hdlbpa 6 dpf rep6,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:hdlbpa homozygous,GSM8020200,GSM8020200: hdlbpa 6 dpf rep6; Danio rerio; RNA Seq,GSM8020200 r1,GSM8020200,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,hdlbpa-6dpf-hom_H9_S16_L002_R1_001.fastq.gz,fastq,1927080000.0,19080000.0,GSM8020200 r1,0:101,A:523643390;C:445913624;G:440889014;T:516627902;N:6070,101,,,,523643390,445913624,440889014,516627902,6070,SRX23261668,SRS20163633,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29988,SRR27593013,SRX23261667,SRS20163632,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,hdlbpa 6 dpf rep5,GSM8020199,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:hdlbpa homozygous|geo loc name:missing|collection date:missing,hdlbpa 6 dpf rep5,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:hdlbpa homozygous,GSM8020199,GSM8020199: hdlbpa 6 dpf rep5; Danio rerio; RNA Seq,GSM8020199 r1,GSM8020199,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,hdlbpa-6dpf-hom_H8_S15_L002_R1_001.fastq.gz,fastq,1946049618.0,19267818.0,GSM8020199 r1,0:101,A:539909954;C:443888173;G:429627730;T:532616963;N:6798,101,,,,539909954,443888173,429627730,532616963,6798,SRX23261667,SRS20163632,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system 29989,SRR27593014,SRX23261666,SRS20163631,SRP484215,PRJNA1065838,Diencephalic and Neuropeptidergic Dysfunction in Zebrafish with Autism Risk Mutations,GSE253405,Transcriptome Analysis,Hundreds of human mutations are linked to autism and related disorders yet the functions of many of these mutated genes during vertebrate neural development are unclear. We generated 28 zebrafish mutants with presumptive protein truncating mutations or patient specific missense variants corresponding to autism risk alleles in 17 human genes. We observed baseline and stimulus driven behavioral changes at larval stages as well as social behavior differences in lines tested as juveniles. Imaging whole brain activity revealed a near identical activity map for mutations in the unrelated genes kmt5b and hdlbpa defined by increased activity mainly in the diencephalon. Truncating 7 of the 17 risk genes resulted in substantial brain size differences. Using RNA sequencing we further defined molecular drivers of the observed phenotypes identifying targetable disruptions in neuropeptide signaling neuronal maturation and cell proliferation. This multi modal screen has nominated brain regions cell types and molecular pathways that may contribute to autism susceptibility. Overall design: Dissected heads of larval zebrafish and brains of adult zebrafish mutants in genes that increase risk for autism which were generated using CRISPR/Cas9 mutagenesis.,,,,hdlbpa 6 dpf rep4,GSM8020198,,source name:head with eyes 2 5 heads combined|tissue:head with eyes 2 5 heads combined|genotype:hdlbpa homozygous|geo loc name:missing|collection date:missing,hdlbpa 6 dpf rep4,Single end reads were aligned to GRCz11 release 104 using the Lawson Lab Zebrafish Transcriptome Annotation version 4.3.2 with STAR aligner 2.7.3a GCC 6.4.0 2.28. https://www.umassmed.edu/lawson lab/reagents/zebrafish transcriptome/ The raw counts files from STAR in this record were normalized using the rlog method in DESeq2 for subsequent published analysis. Assembly: GRCz11 Supplementary files format and content: Raw counts files from STAR; expected input for DESeq2.,head with eyes 2 5 heads combined,,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,tissue:head with eyes 2 5 heads combined|genotype:hdlbpa homozygous,GSM8020198,GSM8020198: hdlbpa 6 dpf rep4; Danio rerio; RNA Seq,GSM8020198 r1,GSM8020198,1,RNA was extracted using the MicroElute Total RNA Kit Omega Bio Tek R6834 02 with a 15 min incubation with Dnase I. Libraries were constructed using an in house protocol based on SMART Seq2 followed by Nextera XT Library Preparation FC 131 1096.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP484215,,loader:fastq load.py,hdlbpa-6dpf-hom_H7_S14_L002_R1_001.fastq.gz,fastq,1039274749.0,10289849.0,GSM8020198 r1,0:101,A:283894686;C:241034413;G:233108651;T:281233307;N:3692,101,,,,283894686,241034413,233108651,281233307,3692,SRX23261666,SRS20163631,SRA1787174,UMass Chan Medical School,UMass Chan Medical School,,,,,,,,,,,,B,,usable mapping rate,illumina,novaseq_era,unknown,cdna_unspecified,nextera,sc,single_cell_plate,smartseq,,United States,2024-01-16,Larval,Larval,Multi-tissue,Multi-system