rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 25170,SRR25661605,SRX21387413,SRS18627977,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,hand2 FLD+/? 20 hpf CMs rep3,GSM7714404,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD+/? 20 hpf CMs rep3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS,GSM7714404,GSM7714404: hand2 FLD+/? 20 hpf CMs rep3; Danio rerio; RNA Seq,GSM7714404 r1,GSM7714404,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_het_3_R1.fastq.gz,fastq,2441736984.0,34141777.0,GSM7714404 r1,0:71.52,A:706186414;C:496261994;G:526176364;T:713112212;N:0,71,,,,706186414,496261994,526176364,713112212,0,SRX21387413,SRS18627977,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.9026,,0.15816,,0.76278,,0.44042,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25171,SRR25661606,SRX21387412,SRS18627976,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,hand2 FLD+/? 20 hpf CMs rep2,GSM7714403,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD+/? 20 hpf CMs rep2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS,GSM7714403,GSM7714403: hand2 FLD+/? 20 hpf CMs rep2; Danio rerio; RNA Seq,GSM7714403 r1,GSM7714403,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_het_2_R1.fastq.gz,fastq,2185611269.0,30558084.0,GSM7714403 r1,0:71.52,A:612617675;C:458632518;G:474458738;T:639902338;N:0,71,,,,612617675,458632518,474458738,639902338,0,SRX21387412,SRS18627976,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90042,,0.14005,,0.75424,,0.44277,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25172,SRR25661607,SRX21387411,SRS18627975,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,hand2 FLD+/? 20 hpf CMs rep1,GSM7714402,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD+/? 20 hpf CMs rep1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS,GSM7714402,GSM7714402: hand2 FLD+/? 20 hpf CMs rep1; Danio rerio; RNA Seq,GSM7714402 r1,GSM7714402,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_het_1_R1.fastq.gz,fastq,2291884894.0,32043147.0,GSM7714402 r1,0:71.52,A:635094975;C:489594953;G:499909828;T:667285138;N:0,71,,,,635094975,489594953,499909828,667285138,0,SRX21387411,SRS18627975,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90883,,0.14288,,0.75331,,0.44459,,71,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25173,SRR25661608,SRX21387410,SRS18627974,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,WT 20 hpf CMs rep3,GSM7714401,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,WT 20 hpf CMs rep3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS,GSM7714401,GSM7714401: WT 20 hpf CMs rep3; Danio rerio; RNA Seq,GSM7714401 r1,GSM7714401,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_CMs_3_R1.fastq.gz,fastq,2268251602.0,31717610.0,GSM7714401 r1,0:71.51,A:637196241;C:477782543;G:497683941;T:655588877;N:0,71,,,,637196241,477782543,497683941,655588877,0,SRX21387410,SRS18627974,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90026,,0.13291,,0.78707,,0.40811,,71,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25174,SRR25661609,SRX21387409,SRS18627973,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,WT 20 hpf CMs rep2,GSM7714400,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,WT 20 hpf CMs rep2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS,GSM7714400,GSM7714400: WT 20 hpf CMs rep2; Danio rerio; RNA Seq,GSM7714400 r1,GSM7714400,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_CMs_2_R1.fastq.gz,fastq,2195524610.0,30700033.0,GSM7714400 r1,0:71.52,A:615401741;C:462686936;G:481135567;T:636300366;N:0,71,,,,615401741,462686936,481135567,636300366,0,SRX21387409,SRS18627973,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90323,,0.1476,,0.78744,,0.41728,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25175,SRR25661610,SRX21387408,SRS18627972,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,WT 20 hpf CMs rep1,GSM7714399,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,WT 20 hpf CMs rep1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS,GSM7714399,GSM7714399: WT 20 hpf CMs rep1; Danio rerio; RNA Seq,GSM7714399 r1,GSM7714399,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_CMs_1_R1.fastq.gz,fastq,2258160684.0,31576661.0,GSM7714399 r1,0:71.51,A:641254288;C:471580136;G:491501482;T:653824778;N:0,71,,,,641254288,471580136,491501482,653824778,0,SRX21387408,SRS18627972,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.9,,0.13993,,0.78445,,0.40575,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25176,SRR25661611,SRX21387407,SRS18627971,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,hand2 OE 20 hpf CMs rep3,GSM7714398,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 OE 20 hpf CMs rep3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS,GSM7714398,GSM7714398: hand2 OE 20 hpf CMs rep3; Danio rerio; RNA Seq,GSM7714398 r1,GSM7714398,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_OE_CMs_3_R1.fastq.gz,fastq,1886569909.0,26380170.0,GSM7714398 r1,0:71.51,A:534874421;C:392168718;G:411533838;T:547992932;N:0,71,,,,534874421,392168718,411533838,547992932,0,SRX21387407,SRS18627971,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.89968,,0.14763,,0.77881,,0.42601,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25177,SRR25661612,SRX21387406,SRS18627970,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,hand2 OE 20 hpf CMs rep2,GSM7714397,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 OE 20 hpf CMs rep2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS,GSM7714397,GSM7714397: hand2 OE 20 hpf CMs rep2; Danio rerio; RNA Seq,GSM7714397 r1,GSM7714397,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_OE_CMs_2_R1.fastq.gz,fastq,2197151812.0,30722639.0,GSM7714397 r1,0:71.52,A:617116635;C:461951919;G:481371246;T:636712012;N:0,71,,,,617116635,461951919,481371246,636712012,0,SRX21387406,SRS18627970,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90877,,0.14744,,0.77191,,0.42845,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25178,SRR25661613,SRX21387405,SRS18627969,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,hand2 OE 20 hpf CMs rep1,GSM7714396,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 OE 20 hpf CMs rep1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS,GSM7714396,GSM7714396: hand2 OE 20 hpf CMs rep1; Danio rerio; RNA Seq,GSM7714396 r1,GSM7714396,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_OE_CMs_1_R1.fastq.gz,fastq,1773398936.0,24797998.0,GSM7714396 r1,0:71.51,A:495618212;C:375438077;G:390377060;T:511965587;N:0,71,,,,495618212,375438077,390377060,511965587,0,SRX21387405,SRS18627969,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90769,,0.1387,,0.7768,,0.42096,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25179,SRR25661614,SRX21387404,SRS18627968,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,hand2 FLD / 20 hpf CMs rep3,GSM7714395,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD / 20 hpf CMs rep3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS,GSM7714395,GSM7714395: hand2 FLD / 20 hpf CMs rep3; Danio rerio; RNA Seq,GSM7714395 r1,GSM7714395,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_Mut_3_R1.fastq.gz,fastq,2179400259.0,30471965.0,GSM7714395 r1,0:71.52,A:600555691;C:468535203;G:483122661;T:627186704;N:0,71,,,,600555691,468535203,483122661,627186704,0,SRX21387404,SRS18627968,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.91581,,0.12256,,0.75209,,0.43413,,71,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25180,SRR25661615,SRX21387403,SRS18627967,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,hand2 FLD / 20 hpf CMs rep2,GSM7714394,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD / 20 hpf CMs rep2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS,GSM7714394,GSM7714394: hand2 FLD / 20 hpf CMs rep2; Danio rerio; RNA Seq,GSM7714394 r1,GSM7714394,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_Mut_2_R1.fastq.gz,fastq,2340991168.0,32733068.0,GSM7714394 r1,0:71.52,A:647423337;C:500120073;G:514803152;T:678644606;N:0,71,,,,647423337,500120073,514803152,678644606,0,SRX21387403,SRS18627967,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.91231,,0.12561,,0.75118,,0.44445,,71,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 25181,SRR25661616,SRX21387402,SRS18627966,SRP455520,PRJNA1006302,The transcriptome of hand2 loss and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion we performed transcriptomic analyses of hand2 loss and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs each group has 3 replicates.,,pubmed:39658721,,hand2 FLD / 20 hpf CMs rep1,GSM7714393,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD / 20 hpf CMs rep1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59 a maximum Benjamini–Hochberg corrected p value of 0.05 and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS,GSM7714393,GSM7714393: hand2 FLD / 20 hpf CMs rep1; Danio rerio; RNA Seq,GSM7714393 r1,GSM7714393,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_Mut_1_R1.fastq.gz,fastq,2727863036.0,38140997.0,GSM7714393 r1,0:71.52,A:760867462;C:577539041;G:596986102;T:792470431;N:0,71,,,,760867462,577539041,596986102,792470431,0,SRX21387402,SRS18627966,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.91175,,0.1342,,0.75282,,0.44063,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System 26483,SRR25930975,SRX21649988,SRS18818460,SRP458853,PRJNA1013567,scRNA seq of 50 hpf and 80 hpf isolated zebrafish hearts,GSE242483,Transcriptome Analysis,Seeking to identify additional transcription factors required for cardiac valve formation we determined and explored the transcriptional landscape of endocardial cells at the time when key morphogenetic events underlying valve development take place. Overall design: We isolated wild type zebrafish hearts at 50 hpf when valve identity has just been established and at 80 hpf when forming valves are first observed,,pubmed:38748804,,50hpf,GSM7764481,,source name:heart|tissue:heart|genotype:wild type|age:50hpf|geo loc name:missing|collection date:missing,50hpf,Reads were aligned against the zebrafish genome and counted by StarSolo. Preprocessed counts were further analysed using Scanpy. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed cells that did not express more than 300 genes or had a mitochondrial content greater than 8%. Furthermore we filtered genes if they were detected in less than 30 cells. Raw counts per cell were normalised to the median count over all cells and transformed into log space to stabilise variance. We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding and cell clustering were based on the initial PCA. Final data visualization was done by scanpy and cellxgene packages. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,heart,,Whole hearts were isolated and cardiac cells were dissociated. Dead cells were removed from the final cell isolate by FACs sorting in PBS without xxx and Magnesium and with 0.04% BSA. Each sample was run separately on a lane in a Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3 1 10xGenomics. scRNA seq library preparation was done using a standard protocol and sequencing was done on a Nextseq2000,,tissue:heart|genotype:wild type|age:50hpf,GSM7764481,GSM7764481: 50hpf; Danio rerio; RNA Seq,GSM7764481 r1,GSM7764481,1,Whole hearts were isolated and cardiac cells were dissociated. Dead cells were removed from the final cell isolate by FACs sorting in PBS without xxx and Magnesium and with 0.04% BSA. Each sample was run separately on a lane in a Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3 1 10xGenomics. scRNA seq library preparation was done using a standard protocol and sequencing was done on a Nextseq2000,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP458853,,,Giulia_50hpf_S1_R2_001.fastq.gz Giulia_50hpf_S1_R1_001.fastq.gz,fastq fastq,19874763820.0,237988724.0,GSM7764481 r1,0:28 1:55.51,A:5320257914;C:4424267230;G:4320623789;T:5708249185;N:101365702,28,55,,,5320257914,4424267230,4320623789,5708249185,101365702,SRX21649988,SRS18818460,SRA1706674,"Bioinformatics, Max-Planck-Institute for Heart and Lung Research","Bioinformatics, Max-Planck-Institute for Heart and Lung Research",2,0.00185,0.94414,0.00087,0.13397,0.99675,0.80172,0.41142,0.51985,28,56,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2023-09-06,Hatching,Embryo,Heart,Cardiovascular System 29089,SRR27015253,SRX22707797,SRS19700098,SRP475323,PRJNA1047551,Identification of genes important during atrial myocardial morphogenesis,GSE249149,Transcriptome Analysis,Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.,,pubmed:39289341,,Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3,GSM7927518,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing,Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf,GSM7927518,GSM7927518: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 3; Danio rerio; RNA Seq,GSM7927518 r1,GSM7927518,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP475323,,loader:fastq load.py,dst226_zbrf_clt___ACrdmct-age___48h_b03_t01_m01_R1.fastq.gz,fastq,2161847345.0,35921817.0,GSM7927518 r1,0:60.18,A:505467877;C:418329045;G:416403136;T:483063599;N:338583688,60,,,,505467877,418329045,416403136,483063599,338583688,SRX22707797,SRS19700098,SRA1761360,MPI for heart and lung research,MPI for heart and lung research,1,0.89532,,0.08355,,0.82012,,0.68413,,35,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-12-01,Hatching,Embryo,Heart,Cardiovascular System 29090,SRR27015254,SRX22707796,SRS19700097,SRP475323,PRJNA1047551,Identification of genes important during atrial myocardial morphogenesis,GSE249149,Transcriptome Analysis,Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.,,pubmed:39289341,,Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2,GSM7927517,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing,Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf,GSM7927517,GSM7927517: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 2; Danio rerio; RNA Seq,GSM7927517 r1,GSM7927517,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP475323,,loader:fastq load.py,dst226_zbrf_clt___ACrdmct-age___48h_b02_t01_m01_R1.fastq.gz,fastq,2065547064.0,31863833.0,GSM7927517 r1,0:64.82,A:530497695;C:434164388;G:434118538;T:518043928;N:148722515,64,,,,530497695,434164388,434118538,518043928,148722515,SRX22707796,SRS19700097,SRA1761360,MPI for heart and lung research,MPI for heart and lung research,1,0.91772,,0.17863,,0.76828,,0.49567,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-12-01,Hatching,Embryo,Heart,Cardiovascular System 29091,SRR27015255,SRX22707795,SRS19700096,SRP475323,PRJNA1047551,Identification of genes important during atrial myocardial morphogenesis,GSE249149,Transcriptome Analysis,Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures. We aimed to identify the genes involved during this process and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.,,pubmed:39289341,,Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1,GSM7927516,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing,Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al. Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al. STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format multi mapping ribosomal or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix,embryonic heart,,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf,GSM7927516,GSM7927516: Wild type zebrafish atrial cardiomyocytes 48 hpf rep 1; Danio rerio; RNA Seq,GSM7927516 r1,GSM7927516,1,miRNeasy micro Kit Qiagen using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP475323,,loader:fastq load.py,dst226_zbrf_clt___ACrdmct-age___48h_b01_t01_m01_R1.fastq.gz,fastq,1619268089.0,24941754.0,GSM7927516 r1,0:64.92,A:410578311;C:344485123;G:343852178;T:401558739;N:118793738,64,,,,410578311,344485123,343852178,401558739,118793738,SRX22707795,SRS19700096,SRA1761360,MPI for heart and lung research,MPI for heart and lung research,1,0.91693,,0.13175,,0.77082,,0.47511,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-12-01,Hatching,Embryo,Heart,Cardiovascular System 31528,SRR28423881,SRX24027916,SRS20821688,SRP497294,PRJNA1090898,The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169,GSE262247,Transcriptome Analysis,The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq.,parent bioproject:PRJNA1090894,pubmed:39271818,,ventricular cells myd88 / 24 hpci,GSM8161054,,source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing,ventricular cells myd88 / 24 hpci,Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,cardiac ventricles,cardiac cryoinjury 24 hours prior to heart extraction,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury,GSM8161054,GSM8161054: ventricular cells myd88 / 24 hpci; Danio rerio; RNA Seq,GSM8161054 r1,GSM8161054,1,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP497294,,,Pinelopi_10x_Zebrafish_Mut_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_Mut_Lib_R2.fastq.gz,fastq fastq,31356990530.0,394538049.0,GSM8161054 r1,0:28 1:51.48,A:8573180857;C:6884590114;G:7520784498;T:8220228225;N:158206836,28,51,,,8573180857,6884590114,7520784498,8220228225,158206836,SRX24027916,SRS20821688,SRA1832827,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-03-22,Cleavage,Embryo,Heart,Cardiovascular System 31529,SRR28423882,SRX24027915,SRS20821687,SRP497294,PRJNA1090898,The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169,GSE262247,Transcriptome Analysis,The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration. MyD88 is a key component of the innate immune response; however its role during regeneration remains unclear. Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration. Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 / ventricles. Consistent with these findings we observed increased myofibroblasts fibrin abundance and scarring in myd88 / ventricles. Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 / endocardium. Moreover loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area. Notably endothelial specific overexpression of myd88 reverses the neutrophil fibrotic and scarring phenotypes in cryoinjured myd88 / ventricles. Mechanistically we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss and gain of function tools show that it controls neutrophil recruitment. Altogether these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 / ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq.,parent bioproject:PRJNA1090894,pubmed:39271818,,ventricular cells myd88+/+ 24 hpci,GSM8161053,,source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing,ventricular cells myd88+/+ 24 hpci,Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al. doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al. doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al. https://arxiv.org/abs/1810.08473 were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,cardiac ventricles,cardiac cryoinjury 24 hours prior to heart extraction,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury,GSM8161053,GSM8161053: ventricular cells myd88+/+ 24 hpci; Danio rerio; RNA Seq,GSM8161053 r1,GSM8161053,1,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 / ventricles for the myd88+/+ and myd88 / sample respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM Library & Gel Bead Kit v3.1 16 rxns PN 1000121.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP497294,,,Pinelopi_10x_Zebrafish_WT_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_WT_Lib_R2.fastq.gz,fastq fastq,40672259373.0,511650018.0,GSM8161053 r1,0:28 1:51.49,A:11079272327;C:8809520398;G:9307205642;T:11269370263;N:206890743,28,51,,,11079272327,8809520398,9307205642,11269370263,206890743,SRX24027915,SRS20821687,SRA1832827,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-03-22,Cleavage,Embryo,Heart,Cardiovascular System 32609,SRR29325925,SRX24842084,SRS21553259,SRP512516,PRJNA1121299,"Gene expression profile of single endocardial cells in 48 hpf and 72 hpf zebrafish embryos/larvae. In the study ""The heart is a niche for hematopoietic stem and progenitor cells in zebrafish.""",GSE269378,Transcriptome Analysis,We used single cell RNA expression to uncover the cellular and molecular heterogeneity of isolated endocardial cells in the heart. From this study we uncovered the presence of an endocardial hematopoietic cluster along with other significant clusters including valve endocardial and interstitial cells and non valve cells. Overall design: Endocardial cells were isolated using FACS from physically extracted Tgkdrl:nls mCherry and Tgcd41:GFP hearts according to presence of mCherry positive cells and further analyzed using scRNAseq.,,pubmed:39217144,,EC 2d,GSM8314110,,source name:Heart|tissue:Heart|cell type:Endocardial cells|genotype:Tgkdrl:nls mCherry; Tgcd41:GFP|developmental stage:48 hpf loc name:missing|collection date:missing,EC 2d,Sequencing was done on Nextseq2000 and raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Preprocessed counts were further analysed using Scanpy ollowed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 5 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 5%. Furthermore we filtered 24259 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance. We initially reduced dimensionality of the dataset using PCA retaining 50 principal components. Subsequent steps like low dimensional UMAP embedding McInnes & Healy https://arxiv.org/abs/1802.03426 and cell clustering via community detection were based on the initial PCA. Final data visualization was done by scanpy and cellxgene packages. Assembly: danRer11 Supplementary files format and content: starsolo outputs,Heart,,Embryos were raised in a solution composed of 0.33 Danieau's medium containing the following concentrations: 17.4 mM NaCl 0.21 mM KCl 0.12 mM MgSO4·H2O and 0.18 mM CaNO32 while being maintained at a stable temperature of 28°C. To isolate EdCs for the single cell RNA sequencing experiment hearts from 48 and 72 hpf Tgkdrl:nls mCherry; Tgcd41:GFP larvae were manually dissected in DMEM + 10% FBS. Hearts were then centrifuged for 60 seconds at 3000 rpm washed with 1 mL Hanks’ Balanced Salt Solution and dissociated into single cells by incubating in 100 μl Enzyme 1 and 5 μl Enzyme 2 Pierce Cardiomyocyte Dissociation Kit Thermo Fisher Scientific Cat#88281 for 20 minutes at 300 rpm in a 30°C shaker 79. The samples were centrifuged for 5 minutes at 3000 rpm the supernatant was discarded and fresh medium was added to the dissociated cells and passed through 40 μM filter polystyrene 5ml tubes. Negative controls of non fluorescent hearts or single color fluorescent hearts were prepared to define the sorting gates. Cells were sorted using the BD FACSAria™ III BD Biosciences instrument. Live cells were selected by exclusion of DAPI using 30mW 405nm excitation paired with 450/50 nm band pass filter. The software used for sorting and analysis is BD FACSDiva v8.0.1. Single positive Tgkdrl:nls mCherry+ cells and double positive Tgkdrl:nls mCherry+; Tgcd41:GFP+ cells were sorted and collected into tubes with DMEM + 10% FBS. Cells from both collected samples were immediately combined and processed for the single cell RNA sequencing. mCherry fluorescence was measured with 50mW 561nm excitation paired with 610/20nm band pass filter. GFP fluorescence was measured with 50mW 488nm excitation paired with 530/30 band pass filter. The cell suspensions were counted with Moxi cell counter and diluted according to manufacturer’s protocol to obtain 4.000 2d HC and 8.000 3d 10.497 EC 1.569 HC single cell data points per sample respectively. Each sample was run separately on a lane in Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3.1 10xGenomics. Library preparation was conducted according to the manufacturer indications.,Embryos/larvae were grown in 28 degree incubator until extraction at 48 or 72 hpf,tissue:Heart|cell type:Endocardial cells|genotype:Tgkdrl:nls mCherry; Tgcd41:GFP|developmental stage:48 hpf,GSM8314110,GSM8314110: EC 2d; Danio rerio; RNA Seq,GSM8314110 r1,GSM8314110,1,Embryos were raised in a solution composed of 0.33 Danieau's medium containing the following concentrations: 17.4 mM NaCl 0.21 mM KCl 0.12 mM MgSO4·H2O and 0.18 mM CaNO32 while being maintained at a stable temperature of 28°C. To isolate EdCs for the single cell RNA sequencing experiment hearts from 48 and 72 hpf Tgkdrl:nls mCherry; Tgcd41:GFP larvae were manually dissected in DMEM + 10% FBS. Hearts were then centrifuged for 60 seconds at 3000 rpm washed with 1 mL Hanks' Balanced Salt Solution and dissociated into single cells by incubating in 100 μl Enzyme 1 and 5 μl Enzyme 2 Pierce Cardiomyocyte Dissociation Kit Thermo Fisher Scientific Cat#88281 for 20 minutes at 300 rpm in a 30°C shaker 79. The samples were centrifuged for 5 minutes at 3000 rpm the supernatant was discarded and fresh medium was added to the dissociated cells and passed through 40 μM filter polystyrene 5ml tubes. Negative controls of non fluorescent hearts or single color fluorescent hearts were prepared to define the sorting gates. Cells were sorted using the BD FACSAria™ III BD Biosciences instrument. Live cells were selected by exclusion of DAPI using 30mW 405nm excitation paired with 450/50 nm band pass filter. The software used for sorting and analysis is BD FACSDiva v8.0.1. Single positive Tgkdrl:nls mCherry+ cells and double positive Tgkdrl:nls mCherry+; Tgcd41:GFP+ cells were sorted and collected into tubes with DMEM + 10% FBS. Cells from both collected samples were immediately combined and processed for the single cell RNA sequencing. mCherry fluorescence was measured with 50mW 561nm excitation paired with 610/20nm band pass filter. GFP fluorescence was measured with 50mW 488nm excitation paired with 530/30 band pass filter. The cell suspensions were counted with Moxi cell counter and diluted according to manufacturer's protocol to obtain 4.000 2d HC and 8.000 3d 10.497 EC 1.569 HC single cell data points per sample respectively. Each sample was run separately on a lane in Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3.1 10xGenomics. Library preparation was conducted according to the manufacturer indications.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP512516,,,Felix_10x_Lib_EC-2d_R1.fastq.gz Felix_10x_Lib_EC-2d_R2.fastq.gz,fastq fastq,37849382027.0,476135961.0,GSM8314110 r1,0:28 1:51.49,A:10212120425;C:8162504214;G:8573129268;T:10704929378;N:196698742,28,51,,,10212120425,8162504214,8573129268,10704929378,196698742,SRX24842084,SRS21553259,SRA1892449,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,mate1 technical by mapping diff,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-06-07,Hatching,Embryo,Heart,Cardiovascular System 33805,SRR30670312,SRX26088984,SRS22655387,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,DKOwBF 4,GSM8516797,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing,DKOwBF 4,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62,GSM8516797,GSM8516797: DKOwBF 4; Danio rerio; RNA Seq,GSM8516797 r1,GSM8516797,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,DKOwBF_4_R1_val_1.fq.gz DKOwBF_4_R2_val_2.fq.gz,fastq fastq,2631656843.0,35135298.0,GSM8516797 r1,0:37.47 1:37.43,A:693207862;C:610024232;G:611701090;T:716593105;N:130554,37,37,,,693207862,610024232,611701090,716593105,130554,SRX26088984,SRS22655387,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33806,SRR30670313,SRX26088983,SRS22655386,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,DKOwBF 3,GSM8516796,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing,DKOwBF 3,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62,GSM8516796,GSM8516796: DKOwBF 3; Danio rerio; RNA Seq,GSM8516796 r1,GSM8516796,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,DKOwBF_3_R1_val_1.fq.gz DKOwBF_3_R2_val_2.fq.gz,fastq fastq,2307127989.0,30809808.0,GSM8516796 r1,0:37.48 1:37.40,A:604817176;C:534788281;G:546273175;T:621136766;N:112591,37,37,,,604817176,534788281,546273175,621136766,112591,SRX26088983,SRS22655386,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33807,SRR30670314,SRX26088982,SRS22655385,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,DKOwBF 2,GSM8516795,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing,DKOwBF 2,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62,GSM8516795,GSM8516795: DKOwBF 2; Danio rerio; RNA Seq,GSM8516795 r1,GSM8516795,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,DKOwBF_2_R1_val_1.fq.gz DKOwBF_2_R2_val_2.fq.gz,fastq fastq,2359951661.0,31500054.0,GSM8516795 r1,0:37.48 1:37.44,A:616053500;C:552042916;G:552098980;T:639639620;N:116645,37,37,,,616053500,552042916,552098980,639639620,116645,SRX26088982,SRS22655385,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33808,SRR30670315,SRX26088981,SRS22655384,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,DKOwBF 1,GSM8516794,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing,DKOwBF 1,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62,GSM8516794,GSM8516794: DKOwBF 1; Danio rerio; RNA Seq,GSM8516794 r1,GSM8516794,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,DKOwBF_1_R1_val_1.fq.gz DKOwBF_1_R2_val_2.fq.gz,fastq fastq,2279765098.0,30432486.0,GSM8516794 r1,0:37.48 1:37.43,A:593961620;C:534035377;G:534433858;T:617220513;N:113730,37,37,,,593961620,534035377,534433858,617220513,113730,SRX26088981,SRS22655384,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33809,SRR30670316,SRX26088980,SRS22655383,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,ccm2 4,GSM8516793,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing,ccm2 4,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201,GSM8516793,GSM8516793: ccm2 4; Danio rerio; RNA Seq,GSM8516793 r1,GSM8516793,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,ccm2_4_R1_val_1.fq.gz ccm2_4_R2_val_2.fq.gz,fastq fastq,1774723235.0,23698743.0,GSM8516793 r1,0:37.48 1:37.40,A:458133535;C:421770768;G:424339889;T:470391262;N:87781,37,37,,,458133535,421770768,424339889,470391262,87781,SRX26088980,SRS22655383,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33810,SRR30670317,SRX26088979,SRS22655382,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,ccm2 3,GSM8516792,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing,ccm2 3,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201,GSM8516792,GSM8516792: ccm2 3; Danio rerio; RNA Seq,GSM8516792 r1,GSM8516792,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,ccm2_3_R1_val_1.fq.gz ccm2_3_R2_val_2.fq.gz,fastq fastq,2785670574.0,37207625.0,GSM8516792 r1,0:37.47 1:37.39,A:733595813;C:647190941;G:651896211;T:752851756;N:135853,37,37,,,733595813,647190941,651896211,752851756,135853,SRX26088979,SRS22655382,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33811,SRR30670318,SRX26088978,SRS22655381,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,ccm2 2,GSM8516791,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing,ccm2 2,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201,GSM8516791,GSM8516791: ccm2 2; Danio rerio; RNA Seq,GSM8516791 r1,GSM8516791,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,ccm2_2_R1_val_1.fq.gz ccm2_2_R2_val_2.fq.gz,fastq fastq,1710862794.0,22847832.0,GSM8516791 r1,0:37.48 1:37.40,A:451866074;C:396308875;G:397143039;T:465461428;N:83378,37,37,,,451866074,396308875,397143039,465461428,83378,SRX26088978,SRS22655381,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33812,SRR30670319,SRX26088977,SRS22655380,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,ccm2 1,GSM8516790,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing,ccm2 1,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201,GSM8516790,GSM8516790: ccm2 1; Danio rerio; RNA Seq,GSM8516790 r1,GSM8516790,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,ccm2_1_R1_val_1.fq.gz ccm2_1_R2_val_2.fq.gz,fastq fastq,2152186897.0,28739460.0,GSM8516790 r1,0:37.48 1:37.40,A:565328171;C:501524678;G:502042276;T:583186005;N:105767,37,37,,,565328171,501524678,502042276,583186005,105767,SRX26088977,SRS22655380,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33813,SRR30670320,SRX26088976,SRS22655379,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,wt 4,GSM8516789,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing,wt 4,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:wild type,GSM8516789,GSM8516789: wt 4; Danio rerio; RNA Seq,GSM8516789 r1,GSM8516789,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,wt_4_R1_val_1.fq.gz wt_4_R2_val_2.fq.gz,fastq fastq,2115730283.0,28251845.0,GSM8516789 r1,0:37.48 1:37.40,A:554039480;C:497170515;G:497588268;T:566828365;N:103655,37,37,,,554039480,497170515,497588268,566828365,103655,SRX26088976,SRS22655379,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33814,SRR30670321,SRX26088975,SRS22655378,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,wt 3,GSM8516788,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing,wt 3,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:wild type,GSM8516788,GSM8516788: wt 3; Danio rerio; RNA Seq,GSM8516788 r1,GSM8516788,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,wt_3_R1_val_1.fq.gz wt_3_R2_val_2.fq.gz,fastq fastq,1222858943.0,16325477.0,GSM8516788 r1,0:37.47 1:37.44,A:319777234;C:285362000;G:288524099;T:329135216;N:60394,37,37,,,319777234,285362000,288524099,329135216,60394,SRX26088975,SRS22655378,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33815,SRR30670322,SRX26088974,SRS22655377,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,wt 2,GSM8516787,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing,wt 2,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:wild type,GSM8516787,GSM8516787: wt 2; Danio rerio; RNA Seq,GSM8516787 r1,GSM8516787,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,wt_2_R1_val_1.fq.gz wt_2_R2_val_2.fq.gz,fastq fastq,2264925518.0,30237170.0,GSM8516787 r1,0:37.48 1:37.43,A:593545435;C:529227225;G:529813966;T:612227538;N:111354,37,37,,,593545435,529227225,529813966,612227538,111354,SRX26088974,SRS22655377,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 33816,SRR30670323,SRX26088973,SRS22655376,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1 CCM2 or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7 component of the Polycomb Repressive Complex 1 contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients and in human mouse and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish CCM2 deficient HUVECs and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK Angiopoietin1 WNT9 and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt ccm2 mutant ccm2 double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit with 30 ng of RNA as starting point.,,pubmed:39402138,,wt 1,GSM8516786,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing,wt 1,base calling alignment filtering peak calling generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:wild type,GSM8516786,GSM8516786: wt 1; Danio rerio; RNA Seq,GSM8516786 r1,GSM8516786,1,RNA extraction DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,wt_1_R1_val_1.fq.gz wt_1_R2_val_2.fq.gz,fastq fastq,2171991020.0,29008519.0,GSM8516786 r1,0:37.49 1:37.39,A:564449762;C:511917485;G:512535386;T:582980181;N:108206,37,37,,,564449762,511917485,512535386,582980181,108206,SRX26088973,SRS22655376,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System 36641,SRR700539,SRX233125,SRS393099,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq15,GSM1081113,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,Seq15,Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,GSM1081113,GSM1081113: Seq15; Danio rerio; RNA Seq,GSM1081113 1,,1,,GEO Accession:GSM1081113,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP018538,,,,,1505008521.0,29509971.0,GSM1081113 r1,0:51,A:394410844;C:370013758;G:356489603;T:384055071;N:39245,51,,,,394410844,370013758,356489603,384055071,39245,SRX233125,SRS393099,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.9123,,0.07373,,0.71346,,0.47555,,51,,B,,usable mapping rate,illumina,hiseq_era,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System 36642,SRR700538,SRX233124,SRS393098,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq14,GSM1081112,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,Seq14,Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,GSM1081112,GSM1081112: Seq14; Danio rerio; RNA Seq,GSM1081112 1,,1,,GEO Accession:GSM1081112,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP018538,,,seq14.txt.gz,fastq,3144425502.0,61655402.0,GSM1081112 r1,0:51,A:825172912;C:756354008;G:742919584;T:819897573;N:81425,51,,,,825172912,756354008,742919584,819897573,81425,SRX233124,SRS393098,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.93659,,0.0806,,0.73716,,0.47614,,51,,B,,usable mapping rate,illumina,hiseq_era,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System 36643,SRR700537,SRX233123,SRS393097,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq11,GSM1081111,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,Seq11,Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,GSM1081111,GSM1081111: Seq11; Danio rerio; RNA Seq,GSM1081111 1,,1,,GEO Accession:GSM1081111,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP018538,,,,,1364181264.0,37893924.0,GSM1081111 r1,0:36,A:362442341;C:297159061;G:406723961;T:297355968;N:499933,36,,,,362442341,297159061,406723961,297355968,499933,SRX233123,SRS393097,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.67174,,0.07612,,0.74416,,0.48016,,36,,B,,usable mapping rate,illumina,early_illumina,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System 36644,SRR700536,SRX233122,SRS393096,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq13,GSM1081110,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,Seq13,Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,GSM1081110,GSM1081110: Seq13; Danio rerio; RNA Seq,GSM1081110 1,,1,,GEO Accession:GSM1081110,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP018538,,,seq13.txt.gz,fastq,1693675269.0,33209319.0,GSM1081110 r1,0:51,A:443719209;C:411369010;G:404182982;T:434361031;N:43037,51,,,,443719209,411369010,404182982,434361031,43037,SRX233122,SRS393096,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.91781,,0.08107,,0.74976,,0.46528,,51,,B,,usable mapping rate,illumina,hiseq_era,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System 36645,SRR700535,SRX233121,SRS393095,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq5,GSM1081109,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,Seq5,Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,GSM1081109,GSM1081109: Seq5; Danio rerio; RNA Seq,GSM1081109 1,,1,,GEO Accession:GSM1081109,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP018538,,,seq5.txt.gz,fastq,1245644280.0,34601230.0,GSM1081109 r1,0:36,A:334131135;C:287707996;G:288492153;T:334895459;N:417537,36,,,,334131135,287707996,288492153,334895459,417537,SRX233121,SRS393095,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.89495,,0.1058,,0.74247,,0.46422,,36,,B,,usable mapping rate,illumina,early_illumina,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System 36646,SRR700534,SRX233120,SRS393094,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development but the molecular basis for its function remain poorly understood. We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos. Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited. Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq1,GSM1081108,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,Seq1,Basecalls demultiplexing and filtering of reads was performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb version: development 20110921150240 with the following parameters: Ambiguity threshold = 1 Max Number Gap Opens = 1 Max Number Gap Extensions = 1. Differential expression was generated with the DESEQ package with native goby support using gobyweb version: development 20110921150240 with the following parameters: q value threshold = 1.0 weight adjustment = none Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1 a log2 fold change > 1 for WT/G4 and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb version: development20110921150240. Additional supplementary .xlsx file containing RPKM counts and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development. 2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo. At 24 hpf batches of approximately 200 embryos were pooled into 1.5 ml tube. Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS 0.8mM CaCl2 50U/ml penicillin and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies and stored at 80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase the solution was transferred to an RNeasy minElute column Qiagen. On column DNase digestion subsequent washing and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries. Libraries were prepared for RNA sequencing using the mRNA Seq seq1 seq5 and seq11 or TruSeq Kit seq13 seq14 and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes. 25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,GSM1081108,GSM1081108: Seq1; Danio rerio; RNA Seq,GSM1081108 1,,1,,GEO Accession:GSM1081108,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP018538,,,seq1.txt.gz,fastq,929284704.0,25813464.0,GSM1081108 r1,0:36,A:244730361;C:220466820;G:213037296;T:250386569;N:663658,36,,,,244730361,220466820,213037296,250386569,663658,SRX233120,SRS393094,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.87436,,0.11629,,0.73302,,0.46999,,36,,B,,usable mapping rate,illumina,early_illumina,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System 37255,SRR1043688,SRX387598,SRS511498,SRP033532,PRJNA230686,Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae,GSE53022,Transcriptome Analysis,We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.,,pubmed:24430697,,kctd10 mut zebrafish heart,GSM1280516,,source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart,kctd10 mut zebrafish heart,sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant.,heart,,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,,strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart,GSM1280516,GSM1280516: kctd10 mut zebrafish heart; Danio rerio; RNA Seq,GSM1280516,,1,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,GEO Accession:GSM1280516,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033532,,,s_8_1_1101_qseq.txt.gz,Illumina native,159161750.0,3183235.0,GSM1280516 r1,0:50,A:40560849;C:38239286;G:38051715;T:41572492;N:737408,50,,,,40560849,38239286,38051715,41572492,737408,SRX387598,SRS511498,SRA115339,GEO,"College of Life Sciences, Peking University",1,0.93678,,0.06225,,0.68834,,0.44699,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2013-12-05,Hatching,Embryo,Heart,Cardiovascular System 37256,SRR1104059,SRX387598,SRS511498,SRP033532,PRJNA230686,Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae,GSE53022,Transcriptome Analysis,We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.,,pubmed:24430697,,kctd10 mut zebrafish heart,GSM1280516,,source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart,kctd10 mut zebrafish heart,sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant.,heart,,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,,strain background:AB|development stage:48 hpf|genotype/variation:kctd10 / kctd10 mutant|tissue:heart,GSM1280516,GSM1280516: kctd10 mut zebrafish heart; Danio rerio; RNA Seq,GSM1280516,,1,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,GEO Accession:GSM1280516,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033532,,,,,10053590150.0,201071803.0,GSM1280516 r2,0:50,A:2588651143;C:2370219438;G:2396055158;T:2650913003;N:47751408,50,,,,2588651143,2370219438,2396055158,2650913003,47751408,SRX387598,SRS511498,SRA115339,GEO,"College of Life Sciences, Peking University",1,0.92227,,0.06457,,0.69367,,0.45203,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2013-12-05,Hatching,Embryo,Heart,Cardiovascular System 37257,SRR1043687,SRX387597,SRS511497,SRP033532,PRJNA230686,Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae,GSE53022,Transcriptome Analysis,We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.,,pubmed:24430697,,wt zebrafish heart,GSM1280515,,source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart,wt zebrafish heart,sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant.,heart,,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,,strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart,GSM1280515,GSM1280515: wt zebrafish heart; Danio rerio; RNA Seq,GSM1280515,,1,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,GEO Accession:GSM1280515,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033532,,,s_6_1_1101_qseq.txt.gz,Illumina native,155968450.0,3119369.0,GSM1280515 r1,0:50,A:40015379;C:37108086;G:37319547;T:41209982;N:315456,50,,,,40015379,37108086,37319547,41209982,315456,SRX387597,SRS511497,SRA115339,GEO,"College of Life Sciences, Peking University",1,0.92288,,0.06296,,0.69209,,0.4533,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2013-12-05,Hatching,Embryo,Heart,Cardiovascular System 37258,SRR1104058,SRX387597,SRS511497,SRP033532,PRJNA230686,Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae,GSE53022,Transcriptome Analysis,We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.,,pubmed:24430697,,wt zebrafish heart,GSM1280515,,source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart,wt zebrafish heart,sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant.,heart,,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,,strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart,GSM1280515,GSM1280515: wt zebrafish heart; Danio rerio; RNA Seq,GSM1280515,,1,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,GEO Accession:GSM1280515,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033532,,,,,10404769750.0,208095395.0,GSM1280515 r2,0:50,A:2661715782;C:2489013308;G:2484808257;T:2727159333;N:42073070,50,,,,2661715782,2489013308,2484808257,2727159333,42073070,SRX387597,SRS511497,SRA115339,GEO,"College of Life Sciences, Peking University",1,0.93515,,0.0656,,0.68986,,0.45312,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2013-12-05,Hatching,Embryo,Heart,Cardiovascular System 37991,SRR1265766,SRX529160,SRS598857,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Heart Replicate 3 sRNAseq,GSM1376649,,source name:Heart|tissue:Heart|genetic background:Wild type Singapore strain,Heart Replicate 3 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Heart,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,tissue:Heart|genetic background:Wild type Singapore strain,GSM1376649,GSM1376649: Heart Replicate 3 sRNAseq; Danio rerio; miRNA Seq,GSM1376649,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376649,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZH008_GATCAG_L005_R1.fastq.gz,fastq,4401229692.0,57910917.0,GSM1376649 r1,0:76,A:1009381958;C:1130057881;G:1173217392;T:1088123982;N:448479,76,,,,1009381958,1130057881,1173217392,1088123982,448479,SRX529160,SRS598857,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00129,,0.00046,,0.99882,,0.51351,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Heart,Cardiovascular System 37992,SRR1265765,SRX529159,SRS598856,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Heart Replicate 2 sRNAseq,GSM1376648,,source name:Heart|tissue:Heart|genetic background:Wild type Singapore strain,Heart Replicate 2 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Heart,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,tissue:Heart|genetic background:Wild type Singapore strain,GSM1376648,GSM1376648: Heart Replicate 2 sRNAseq; Danio rerio; miRNA Seq,GSM1376648,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376648,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZH007_ACTTGA_L005_R1.fastq.gz,fastq,3202357508.0,42136283.0,GSM1376648 r1,0:76,A:666309720;C:845347679;G:846066601;T:844306103;N:327405,76,,,,666309720,845347679,846066601,844306103,327405,SRX529159,SRS598856,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00042,,3e-05,,0.99924,,0.56521,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Heart,Cardiovascular System 37993,SRR1265764,SRX529158,SRS598855,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Heart Replicate 1 sRNAseq,GSM1376647,,source name:Heart|tissue:Heart|genetic background:Wild type Singapore strain,Heart Replicate 1 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Heart,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,tissue:Heart|genetic background:Wild type Singapore strain,GSM1376647,GSM1376647: Heart Replicate 1 sRNAseq; Danio rerio; miRNA Seq,GSM1376647,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376647,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZH002_CAGATC_L005_R1.fastq.gz,fastq,3777814232.0,49708082.0,GSM1376647 r1,0:76,A:791204432;C:1050679958;G:1001897360;T:933655799;N:376683,76,,,,791204432,1050679958,1001897360,933655799,376683,SRX529158,SRS598855,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00034,,4e-05,,0.99943,,0.62264,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Heart,Cardiovascular System 38364,SRR1793802,SRX869237,SRS840014,SRP053359,PRJNA274951,Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein,GSE65751,Transcriptome Analysis,How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs.,,pubmed:25992545,,d red ZF sample 0012,GSM1604058,,tissue:Dorsal endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf,d red ZF sample 0012,Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules.,Dorsal endothelial cells,,RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011,The vPCV vs dPCV endothelial cells were analyzed at 24hpf,strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf,GSM1604058,GSM1604058: d red ZF sample 0012; Danio rerio; RNA Seq,GSM1604058,,1,RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011,GEO Accession:GSM1604058,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP053359,,,d_red_ZF_sample_0012.fastq.gz,fastq,136949295.0,3912837.0,GSM1604058 r1,0:35,A:38967686;C:29235653;G:29781723;T:38764742;N:199491,35,,,,38967686,29235653,29781723,38764742,199491,SRX869237,SRS840014,SRA236924,GEO,"Itai Yanai, Biology, Technion - Israel Institute of Technology",1,0.50546,,0.22201,,0.91524,,0.49457,,35,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,celseq,,Israel,2015-02-09,Pharyngula,Embryo,Endothelium,Cardiovascular System 38365,SRR1793801,SRX869236,SRS840015,SRP053359,PRJNA274951,Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein,GSE65751,Transcriptome Analysis,How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs.,,pubmed:25992545,,d red ZF sample 0008,GSM1604057,,tissue:Dorsal endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf,d red ZF sample 0008,Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules.,Dorsal endothelial cells,,RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011,The vPCV vs dPCV endothelial cells were analyzed at 24hpf,strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf,GSM1604057,GSM1604057: d red ZF sample 0008; Danio rerio; RNA Seq,GSM1604057,,1,RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011,GEO Accession:GSM1604057,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP053359,,,d_red_ZF_sample_0008.fastq.gz,fastq,230204380.0,6577268.0,GSM1604057 r1,0:35,A:63286154;C:49924891;G:50948035;T:65703538;N:341762,35,,,,63286154,49924891,50948035,65703538,341762,SRX869236,SRS840015,SRA236924,GEO,"Itai Yanai, Biology, Technion - Israel Institute of Technology",1,0.59898,,0.14092,,0.89073,,0.49292,,35,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,celseq,,Israel,2015-02-09,Pharyngula,Embryo,Endothelium,Cardiovascular System 38366,SRR1793800,SRX869235,SRS840013,SRP053359,PRJNA274951,Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein,GSE65751,Transcriptome Analysis,How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs.,,pubmed:25992545,,V red ZF sample 0011,GSM1604056,,tissue:Ventral endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf,V red ZF sample 0011,Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules.,Ventral endothelial cells,,RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011,The vPCV vs dPCV endothelial cells were analyzed at 24hpf,strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf,GSM1604056,GSM1604056: V red ZF sample 0011; Danio rerio; RNA Seq,GSM1604056,,1,RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011,GEO Accession:GSM1604056,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP053359,,,V_red_ZF_sample_0011.fastq.gz,fastq,146319705.0,4180563.0,GSM1604056 r1,0:35,A:40991954;C:30892087;G:32112709;T:42103782;N:219173,35,,,,40991954,30892087,32112709,42103782,219173,SRX869235,SRS840013,SRA236924,GEO,"Itai Yanai, Biology, Technion - Israel Institute of Technology",1,0.57038,,0.16086,,0.89014,,0.53016,,35,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,celseq,,Israel,2015-02-09,Pharyngula,Embryo,Endothelium,Cardiovascular System 38367,SRR1793799,SRX869234,SRS840016,SRP053359,PRJNA274951,Lymphatic vessels arise from a niche of multipotent angioblasts within the floor of the cardinal vein,GSE65751,Transcriptome Analysis,How cells acquire their fate is a fundamental question in both developmental and regenerative biology. Multipotent progenitors undergo gradual cell fate restriction in response to temporal and positional cues from the microenvironment the nature of which is far from being clear. In the case of the lymphatic system venous endothelial cells are thought to give rise to lymphatic vessels through a process of trans differentiation. Upon expression of a set of transcription factors venous cells acquire a lymphatic fate and bud out to generate the lymphatic vasculature. In this work we challenge this view and show that while lymphatic endothelial cells LECs do arise in the Cardinal Vein CV they do so from a previously uncharacterized pool of multipotent angioblasts. Using lymphatic specific transgenic zebrafish in combination with endothelial photoconvertible reporters and long term live imaging we demonstrate that these multipotent angioblasts can generate not only lymphatic but also arterious and venous fates. We further reveal that the underlying endoderm serves as a source of Wnt5b which acts as a lymphatic inductive signal promoting the angioblast to lymphatic transition. Moreover Wnt5b induced lymphatic specification in human embryonic stem cells derived vascular progenitors suggesting that this process is evolutionary conserved. Our results uncover a novel mechanism of lymphatic vessel formation whereby multipotent angioblasts and not venous endothelial cells give rise to the lymphatic endothelium and provide the first characterization of their inductive niche. More broadly our findings highlight the CV as a plastic and heterogeneous structure containing different cell populations analogous to the hematopoietic niche in the aortic floor. Overall design: Following Kaede photoconversion of dorsal or ventral halves of the PCV in Tgfli1:gal4;uasKaede embryos at 24 hpf 6 embryos per group were used for FACS isolation of Kaede photconverted red ECs.,,pubmed:25992545,,V red ZF sample 0007,GSM1604055,,tissue:Ventral endothelial cells|strain:Tgfli1:gal4; uasKaede|developmental stage:24hpf,V red ZF sample 0007,Libraries were sequenced on the Illumina HiSeq2500 according to standard paired end sequencing protocols. Primary analysis done in RTA 1.17.20 1.13.48 Conversion from BCL to FASTQ and deumltiplexing using CASAVA 1.8 configureBclToFastq.pl fastq cluster count 1234567890 mismatches 0 use bases mask Y15n I6n Y35n Filter and read trimming barcode minimum quality of 20. trimming of read2 to 35 bases not required. CEL Seq Hashimshony et al. 2012 demultiplexing of second mate using first mate barcode allowing no mismatches in barcode. bowtie2 version 2.1.0 against Zv9 genome Read counting with htseq count version 0.5.4p3. Using on Ensemble Zv9 annotations. Reads with the same unique molecular identifiers UMIs were colapsed for transcript counting. Genome build: Zv9 Supplementary files format and content: Tabular expression matrix includes number of transcript molecules.,Ventral endothelial cells,,RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011,The vPCV vs dPCV endothelial cells were analyzed at 24hpf,strain:Tgfli1:gal4;uasKaede|developmental stage:24hpf,GSM1604055,GSM1604055: V red ZF sample 0007; Danio rerio; RNA Seq,GSM1604055,,1,RNA was isolated using TRIzol with addition of ERCC spike ins and GenElute LPA Sigma The CEL Seq protocol Hashimshony et al. 2012 was used to amplify and sequence. CEL Seq multiplexing barocdes with slite modification were used. Each CEL Seq primer cointained a barcode and a unique moleculare identifier Teemu et al. 2011,GEO Accession:GSM1604055,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP053359,,,V_red_ZF_sample_0007.fastq.gz,fastq,219537045.0,6272487.0,GSM1604055 r1,0:35,A:61562432;C:46586451;G:48274564;T:62792331;N:321267,35,,,,61562432,46586451,48274564,62792331,321267,SRX869234,SRS840016,SRA236924,GEO,"Itai Yanai, Biology, Technion - Israel Institute of Technology",1,0.57949,,0.1659,,0.88187,,0.51446,,35,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,celseq,,Israel,2015-02-09,Pharyngula,Embryo,Endothelium,Cardiovascular System 40737,SRR3290613,SRX1660379,SRS1360338,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,56hpf con3 ESD 21 N1,GSM2098629,,source name:heart|line:AB|tissue:heart|developmental stage:56hpf,56hpf con3 ESD 21 N1,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:56hpf,GSM2098629,GSM2098629: 56hpf con3 ESD 21 N1; Danio rerio; RNA Seq,GSM2098629,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098629,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-21_N1.fastq.gz,fastq,2561571150.0,51231423.0,GSM2098629 r1,0:50,A:738531563;C:525473156;G:523941846;T:773278863;N:345722,50,,,,738531563,525473156,523941846,773278863,345722,SRX1660379,SRS1360338,SRA395278,GEO,IGBMC,1,0.90421,,0.28766,,0.74312,,0.52751,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System 40738,SRR3290612,SRX1660378,SRS1360339,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,56hpf con2 ESD 20 N8,GSM2098628,,source name:heart|line:AB|tissue:heart|developmental stage:56hpf,56hpf con2 ESD 20 N8,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:56hpf,GSM2098628,GSM2098628: 56hpf con2 ESD 20 N8; Danio rerio; RNA Seq,GSM2098628,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098628,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-20_N8.fastq.gz,fastq,2243358450.0,44867169.0,GSM2098628 r1,0:50,A:653175386;C:451218310;G:450082444;T:688620234;N:262076,50,,,,653175386,451218310,450082444,688620234,262076,SRX1660378,SRS1360339,SRA395278,GEO,IGBMC,1,0.90525,,0.27718,,0.74915,,0.53438,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System 40739,SRR3290611,SRX1660377,SRS1360340,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,56hpf con1 ESD 19 N6,GSM2098627,,source name:heart|line:AB|tissue:heart|developmental stage:56hpf,56hpf con1 ESD 19 N6,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:56hpf,GSM2098627,GSM2098627: 56hpf con1 ESD 19 N6; Danio rerio; RNA Seq,GSM2098627,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098627,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-19_N6.fastq.gz,fastq,2100229600.0,42004592.0,GSM2098627 r1,0:50,A:601981170;C:436442080;G:439494399;T:622070663;N:241288,50,,,,601981170,436442080,439494399,622070663,241288,SRX1660377,SRS1360340,SRA395278,GEO,IGBMC,1,0.87598,,0.32196,,0.74146,,0.58008,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System 40740,SRR3290610,SRX1660376,SRS1360341,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,48hpf con3 ESD 15 N5,GSM2098626,,source name:heart|line:AB|tissue:heart|developmental stage:48hpf,48hpf con3 ESD 15 N5,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:48hpf,GSM2098626,GSM2098626: 48hpf con3 ESD 15 N5; Danio rerio; RNA Seq,GSM2098626,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098626,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-15_N5.fastq.gz,fastq,1677511000.0,33550220.0,GSM2098626 r1,0:50,A:515769850;C:312578723;G:314926898;T:534106645;N:128884,50,,,,515769850,312578723,314926898,534106645,128884,SRX1660376,SRS1360341,SRA395278,GEO,IGBMC,1,0.88227,,0.34705,,0.74905,,0.40306,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System 40741,SRR3290609,SRX1660375,SRS1360342,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,48hpf con2 ESD 14 N3,GSM2098625,,source name:heart|line:AB|tissue:heart|developmental stage:48hpf,48hpf con2 ESD 14 N3,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:48hpf,GSM2098625,GSM2098625: 48hpf con2 ESD 14 N3; Danio rerio; RNA Seq,GSM2098625,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098625,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-14_N3.fastq.gz,fastq,3262822450.0,65256449.0,GSM2098625 r1,0:50,A:1003248923;C:599408057;G:606959271;T:1052958480;N:247719,50,,,,1003248923,599408057,606959271,1052958480,247719,SRX1660375,SRS1360342,SRA395278,GEO,IGBMC,1,0.8699,,0.34134,,0.75848,,0.48365,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System 40742,SRR3290608,SRX1660374,SRS1360343,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,48hpf con1 ESD 13 N1,GSM2098624,,source name:heart|line:AB|tissue:heart|developmental stage:48hpf,48hpf con1 ESD 13 N1,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:48hpf,GSM2098624,GSM2098624: 48hpf con1 ESD 13 N1; Danio rerio; RNA Seq,GSM2098624,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies Inc. following manufacturer's instructions. Briefly total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used as substrate in the linear amplification process SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies Inc. according to manufacturer's instructions. Briefly 100 ng of amplified cDNA were blunted phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius 30 sec at 60 degrees Celsius 1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098624,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-13_N1.fastq.gz,fastq,1560642600.0,31212852.0,GSM2098624 r1,0:50,A:451261879;C:320132595;G:321545848;T:467582692;N:119586,50,,,,451261879,320132595,321545848,467582692,119586,SRX1660374,SRS1360343,SRA395278,GEO,IGBMC,1,0.8654,,0.30695,,0.74286,,0.54249,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System 40970,SRR3498280,SRX1756826,SRS1433357,SRP074847,PRJNA321312,mRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues,GSE81335,Transcriptome Analysis,Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages,parent bioproject:PRJNA321317,pubmed:28350988;pubmed:33273096,,48hpf E1,GSM2150744,,source name:Endothelial cell|developmental stage:48 hpf|tissue:Endothelial|stain:GFP,48hpf E1,Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include FPKM values for each Sample .,Endothelial cell,,Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473.,developmental stage:48 hpf|tissue:Endothelial|stain:GFP,GSM2150744,GSM2150744: 48hpf E1; Danio rerio; RNA Seq,GSM2150744,,1,Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2150744,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer,,SRP074847,,,EF_034_002_CGATGT_L002_R1.fastq.gz,fastq,485202316.0,6384241.0,GSM2150744 r1,0:76,A:128473144;C:107489507;G:107138177;T:135707012;N:6394476,76,,,,128473144,107489507,107138177,135707012,6394476,SRX1756826,SRS1433357,SRA424807,GEO,"Internal Medicine, Yale University",1,0.89084,,0.1385,,0.71985,,0.4908,,76,,B,,usable mapping rate,illumina,early_illumina,unknown,small_rna,trueseq,bulk,unknown,unknown,,United States,2016-05-11,Hatching,Embryo,Endothelium,Cardiovascular System 40971,SRR3498279,SRX1756825,SRS1433356,SRP074847,PRJNA321312,mRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues,GSE81335,Transcriptome Analysis,Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages,parent bioproject:PRJNA321317,pubmed:28350988;pubmed:33273096,,24hpf E1,GSM2150743,,source name:Endothelial cell|developmental stage:24 hpf|tissue:Endothelial|stain:GFP,24hpf E1,Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include FPKM values for each Sample .,Endothelial cell,,Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473.,developmental stage:24 hpf|tissue:Endothelial|stain:GFP,GSM2150743,GSM2150743: 24hpf E1; Danio rerio; RNA Seq,GSM2150743,,1,Transgenic fish were treated with Liberase to dissociate the cells. post FACS sorting the GFP positive RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2150743,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer,,SRP074847,,,EF_033_001_ATCACG_L002_R1.fastq.gz,fastq,426238476.0,5608401.0,GSM2150743 r1,0:76,A:113332066;C:95045840;G:93307502;T:118935708;N:5617360,76,,,,113332066,95045840,93307502,118935708,5617360,SRX1756825,SRS1433356,SRA424807,GEO,"Internal Medicine, Yale University",1,0.88651,,0.15752,,0.72805,,0.48414,,76,,B,,usable mapping rate,illumina,early_illumina,unknown,small_rna,trueseq,bulk,unknown,unknown,,United States,2016-05-11,Pharyngula,Embryo,Endothelium,Cardiovascular System 40975,SRR3498291,SRX1756837,SRS1433368,SRP074848,PRJNA321321,microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues,GSE81340,Transcriptome Analysis,Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate,parent bioproject:PRJNA321317,pubmed:28350988;pubmed:33273096,,NoEndo 48hpf E2,GSM2150816,,source name:Endothelial cell|developmental stage:48hpf|tissue:Endothelial|stain:GFP,NoEndo 48hpf E2,Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ...,Endothelial cell,,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473.,developmental stage:48hpf|tissue:Endothelial|stain:GFP,GSM2150816,GSM2150816: NoEndo 48hpf E2; Danio rerio; miRNA Seq,GSM2150816,,1,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2150816,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer,,SRP074848,,,NoEndo_48hpf_E2.fastq.gz,fastq,553364740.0,7281115.0,GSM2150816 r1,0:76,A:129173344;C:134804122;G:141026546;T:148331467;N:29261,76,,,,129173344,134804122,141026546,148331467,29261,SRX1756837,SRS1433368,SRA424808,GEO,"Internal Medicine, Yale University",1,1e-05,,0.0,,0.99997,,0.0,,76,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,United States,2016-05-11,Hatching,Embryo,Endothelium,Cardiovascular System 40976,SRR3498290,SRX1756836,SRS1433367,SRP074848,PRJNA321321,microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues,GSE81340,Transcriptome Analysis,Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate,parent bioproject:PRJNA321317,pubmed:28350988;pubmed:33273096,,NoEndo 48hpf E1,GSM2150815,,source name:Endothelial cell|developmental stage:48hpf|tissue:Endothelial|stain:GFP,NoEndo 48hpf E1,Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ...,Endothelial cell,,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473.,developmental stage:48hpf|tissue:Endothelial|stain:GFP,GSM2150815,GSM2150815: NoEndo 48hpf E1; Danio rerio; miRNA Seq,GSM2150815,,1,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2150815,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer,,SRP074848,,,NoEndo_48hpf_E1.fastq.gz,fastq,1204752152.0,15852002.0,GSM2150815 r1,0:76,A:297517299;C:293969730;G:317491224;T:295696492;N:77407,76,,,,297517299,293969730,317491224,295696492,77407,SRX1756836,SRS1433367,SRA424808,GEO,"Internal Medicine, Yale University",1,0.0,,0.0,,1.0,,,,76,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,United States,2016-05-11,Hatching,Embryo,Endothelium,Cardiovascular System 40977,SRR3498289,SRX1756835,SRS1433366,SRP074848,PRJNA321321,microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues,GSE81340,Transcriptome Analysis,Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate,parent bioproject:PRJNA321317,pubmed:28350988;pubmed:33273096,,NoEndo 24hpf E1,GSM2150814,,source name:Endothelial cell|developmental stage:24hpf|tissue:Endothelial|stain:GFP,NoEndo 24hpf E1,Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ...,Endothelial cell,,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473.,developmental stage:24hpf|tissue:Endothelial|stain:GFP,GSM2150814,GSM2150814: NoEndo 24hpf E1; Danio rerio; miRNA Seq,GSM2150814,,1,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2150814,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer,,SRP074848,,,NoEndo_24hpf_E1.fastq.gz,fastq,1422085704.0,18711654.0,GSM2150814 r1,0:76,A:347700492;C:356065333;G:376424133;T:341806001;N:89745,76,,,,347700492,356065333,376424133,341806001,89745,SRX1756835,SRS1433366,SRA424808,GEO,"Internal Medicine, Yale University",1,0.0,,0.0,,1.0,,,,76,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,United States,2016-05-11,Pharyngula,Embryo,Endothelium,Cardiovascular System 40981,SRR3498285,SRX1756831,SRS1433362,SRP074848,PRJNA321321,microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues,GSE81340,Transcriptome Analysis,Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate,parent bioproject:PRJNA321317,pubmed:28350988;pubmed:33273096,,Endo 48hpf E2,GSM2150810,,source name:Endothelial cell|developmental stage:48hpf|tissue:Endothelial|stain:GFP,Endo 48hpf E2,Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ...,Endothelial cell,,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473.,developmental stage:48hpf|tissue:Endothelial|stain:GFP,GSM2150810,GSM2150810: Endo 48hpf E2; Danio rerio; miRNA Seq,GSM2150810,,1,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2150810,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer,,SRP074848,,,Endo_48hpf_E2.fastq.gz,fastq,1254556624.0,16507324.0,GSM2150810 r1,0:76,A:316229540;C:323340793;G:307552357;T:307354555;N:79379,76,,,,316229540,323340793,307552357,307354555,79379,SRX1756831,SRS1433362,SRA424808,GEO,"Internal Medicine, Yale University",1,0.0,,0.0,,1.0,,,,76,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,United States,2016-05-11,Hatching,Embryo,Endothelium,Cardiovascular System 40982,SRR3498284,SRX1756830,SRS1433361,SRP074848,PRJNA321321,microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues,GSE81340,Transcriptome Analysis,Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate,parent bioproject:PRJNA321317,pubmed:28350988;pubmed:33273096,,Endo 48hpf E1,GSM2150809,,source name:Endothelial cell|developmental stage:48hpf|tissue:Endothelial|stain:GFP,Endo 48hpf E1,Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ...,Endothelial cell,,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473.,developmental stage:48hpf|tissue:Endothelial|stain:GFP,GSM2150809,GSM2150809: Endo 48hpf E1; Danio rerio; miRNA Seq,GSM2150809,,1,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2150809,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer,,SRP074848,,,Endo_48hpf_E1.fastq.gz,fastq,1449497080.0,19072330.0,GSM2150809 r1,0:76,A:362564557;C:370330864;G:364749441;T:351760774;N:91444,76,,,,362564557,370330864,364749441,351760774,91444,SRX1756830,SRS1433361,SRA424808,GEO,"Internal Medicine, Yale University",1,0.0,,0.0,,1.0,,,,76,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,United States,2016-05-11,Hatching,Embryo,Endothelium,Cardiovascular System 40983,SRR3498283,SRX1756829,SRS1433360,SRP074848,PRJNA321321,microRNAs Establish and Maintain Uniform Cellular Phenotypes during the Architecture of Complex Tissues,GSE81340,Transcriptome Analysis,Proper functioning of tissues requires cells to behave in uniform well organized ways. Conversely many diseases involve increased cellular heterogeneity due to genetic and epigenetic alterations. Defining the mechanisms that counteract phenotypic variability is therefore critical to understand how tissues sustain homeostasis. Here we carried out a single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single microRNA miRNA genes and multi gene miRNA families. We found that miRNA mutants exhibit a profound increase in cellular phenotypic variability of specific vascular traits. Genome wide analysis of endothelial miRNA target genes identified antagonistic regulatory nodes of vascular growth and morphogenesis signaling that allow variable cell behaviors when derepressed. Remarkably lack of such miRNA activity greatly sensitized the vascular system to microenvironmental changes induced by pharmacological stress. We uncover a previously unrecognized role of miRNAs as a widespread protective mechanism that limits variability in cellular phenotypes. This discovery marks an important advance in our comprehension of how miRNAs function in the physiology of higher organisms. Overall design: Analysis of differential genes expression in Zebrafish endothelial cells for 4 different developmental stages in duplicate,parent bioproject:PRJNA321317,pubmed:28350988;pubmed:33273096,,Endo 24hpf E1,GSM2150808,,source name:Endothelial cell|developmental stage:24hpf|tissue:Endothelial|stain:GFP,Endo 24hpf E1,Illumina Casava1.7 software used for basecalling. Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence then mapped to Zv9 whole genome using STAR v2.3.0 Fragments Per Kilobase Of Exon Per Million Fragments Mapped FPKM were calculated using Cufflink software Annotation gtf for Zv9 Genome build: Zv9 Supplementary files format and content: tab delimited text files include RPKM values for each Sample ...,Endothelial cell,,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,Zebrafish embryos were raised according standard protocols at 28˚C and according to protocols approved by Yale University Institutional Animal Care and Use Committee # 2015 11473.,developmental stage:24hpf|tissue:Endothelial|stain:GFP,GSM2150808,GSM2150808: Endo 24hpf E1; Danio rerio; miRNA Seq,GSM2150808,,1,Transgenic fish were treated with Liberase to disociate the cells. post FACS sorting the GFP positive cells were lisate and RNA was harvested using Trizol reagent. Illumina TruSeq RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2150808,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina Genome Analyzer,,SRP074848,,,Endo_24hpf_E1.fastq.gz,fastq,1527500440.0,20098690.0,GSM2150808 r1,0:76,A:356712587;C:354608109;G:432977038;T:383106520;N:96186,76,,,,356712587,354608109,432977038,383106520,96186,SRX1756829,SRS1433360,SRA424808,GEO,"Internal Medicine, Yale University",1,0.0,,0.0,,1.0,,,,76,,T,,under 1.2% mapping rate,illumina,early_illumina,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,United States,2016-05-11,Pharyngula,Embryo,Endothelium,Cardiovascular System 41146,SRR3742564,SRX1896783,SRS1539775,SRP077871,PRJNA327749,Gene expression profiles of endothelial cells from mutants and siblings of tsu3994,GSE83987,Transcriptome Analysis,Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994,,pubmed:28003365,,Mt,GSM2224910,,tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells,Mt,HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample,kdrl:GFP+ Endothelial cells,,Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.,,genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells,GSM2224910,GSM2224910: Mt; Danio rerio; RNA Seq,GSM2224910,,1,Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.,GEO Accession:GSM2224910,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP077871,,,160123_I114_FCH52M2BBXX_L2_WHFISoiqRAABRAAPEI-144_1.fq.gz,fastq,262444686.0,5356014.0,GSM2224910 r1,0:49,A:66548564;C:63544339;G:66582385;T:65755749;N:13649,49,,,,66548564,63544339,66582385,65755749,13649,SRX1896783,SRS1539775,SRA437681,GEO,"Anming Meng, School of Lifesciences, Tsinghua University",1,0.92714,,0.05568,,0.73423,,0.48371,,49,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2016-07-04,Pharyngula,Embryo,Endothelium,Cardiovascular System 41147,SRR3742565,SRX1896783,SRS1539775,SRP077871,PRJNA327749,Gene expression profiles of endothelial cells from mutants and siblings of tsu3994,GSE83987,Transcriptome Analysis,Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994,,pubmed:28003365,,Mt,GSM2224910,,tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells,Mt,HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample,kdrl:GFP+ Endothelial cells,,Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.,,genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically mutant embryo|Stage:44 hpf type:Endothelial cells,GSM2224910,GSM2224910: Mt; Danio rerio; RNA Seq,GSM2224910,,1,Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.,GEO Accession:GSM2224910,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP077871,,,160204_I136_FCH55MNBBXX_L6_WHFISoiqRAABRAAPEI-144_1.fq.gz,fastq,448147973.0,9145877.0,GSM2224910 r2,0:49,A:113623842;C:108767789;G:113689061;T:112055179;N:12102,49,,,,113623842,108767789,113689061,112055179,12102,SRX1896783,SRS1539775,SRA437681,GEO,"Anming Meng, School of Lifesciences, Tsinghua University",1,0.91636,,0.05377,,0.73545,,0.48441,,49,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2016-07-04,Pharyngula,Embryo,Endothelium,Cardiovascular System 41148,SRR3742562,SRX1896782,SRS1539774,SRP077871,PRJNA327749,Gene expression profiles of endothelial cells from mutants and siblings of tsu3994,GSE83987,Transcriptome Analysis,Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994,,pubmed:28003365,,Sib,GSM2224909,,tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells,Sib,HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample,kdrl:GFP+ Endothelial cells,,Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.,,genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells,GSM2224909,GSM2224909: Sib; Danio rerio; RNA Seq,GSM2224909,,1,Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.,GEO Accession:GSM2224909,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP077871,,,160123_I114_FCH52M2BBXX_L2_WHFISoiqRAAARAAPEI-100_1.fq.gz,fastq,180708423.0,3687927.0,GSM2224909 r1,0:49,A:45675389;C:44261209;G:46002295;T:44768361;N:1169,49,,,,45675389,44261209,46002295,44768361,1169,SRX1896782,SRS1539774,SRA437681,GEO,"Anming Meng, School of Lifesciences, Tsinghua University",1,0.93956,,0.0479,,0.75276,,0.47889,,49,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2016-07-04,Pharyngula,Embryo,Endothelium,Cardiovascular System 41149,SRR3742563,SRX1896782,SRS1539774,SRP077871,PRJNA327749,Gene expression profiles of endothelial cells from mutants and siblings of tsu3994,GSE83987,Transcriptome Analysis,Through RNA seq we report endothelial cells from mutants had 1063 up regulated and 132 down regulated genes >2.0 fold with false discovery rate <0.001 when compared to siblings. Overall design: Examination of gene exprssion profiles of endothelial cells from siblings and mutants of tsu3994,,pubmed:28003365,,Sib,GSM2224909,,tissue:kdrl:GFP+ Endothelial cells|genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells,Sib,HCS3.3.20 RTA 2.5.2 and bcl2fastq2 v2.16 were used for basecalling. Sequenced reads were remove reads with adaptors and remove reads in which unknown bases are more than 10% remove reads in which unknown bases are more than 10%.We use Bowtie2 with parameters q phred64 sensitive dpad 0 gbar 99999999 mp 1 1 np 1 score min L 0 0.1 p 16 k 200 to map clean reads to reference gene and use BWA with parameters o 1 e 50 i 50 L k 2 l 31 t 4 q 10 to reference genome Danio rerio.GRCz10.dna.toplevel.fa . RSEM is a quantification tool that computed Maximum likelihood abundance estimates using the Expectation Maximization EM algorithm for its statistical model . FPKM fragment Per Kilobase of gene per Megabase of library size method is used in calculated expression level. Genome build: Zv10 Supplementary files format and content: tab delimited text files include FPKM values for each Sample,kdrl:GFP+ Endothelial cells,,Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.,,genetic background:tsu3994;Tgkdrl;GFP cross|genotype/variation:Morphologically normal siblings embryo|Stage:44 hpf type:Endothelial cells,GSM2224909,GSM2224909: Sib; Danio rerio; RNA Seq,GSM2224909,,1,Morphologically normal siblings and mutant embryos from crosses of Tgkdrl:GFP; gbf1tsu3994/+ at 44 hpf were dechorionated and disintegrated completely to prepare single cell suspension. Then kdrl:GFP+ ECs were sorted by flow cytomer FACSAria BD and MoFlo XDP BeckMan and positive cells were confirmed by microscopy. Total mRNAs were extracted with RNeasy Mini Kit QIAGEN. The total RNA samples are first treated with DNase I to degrade any possible DNA contamination. Then the mRNA is enriched by using the oligo dT magnetic beads. Mixed with the fragmentation buffer the mRNA is fragmented into short fragments. Then the first strand of cDNA is synthesized by using random hexamer primer. Buffer dNTPs RNase H and DNA polymerase I are added to synthesize the second strand. The double strand cDNA is purified with magnetic beads. End reparation and 3’ end single nucleotide A adenine addition is then performed. Finally sequencing adaptors are ligated to the fragments. The fragments are enriched by PCR amplification.During the QC step Agilent 2100 Bioanaylzer and ABI StepOnePlus Real Time PCR System are used to qualify and quantify of the sample library. The library products are ready for sequencing via Illumina HiSeqTM 2000 or other sequencer when necessary.,GEO Accession:GSM2224909,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 4000,,SRP077871,,,160204_I136_FCH55MNBBXX_L6_WHFISoiqRAAARAAPEI-100_1.fq.gz,fastq,454459418.0,9274682.0,GSM2224909 r2,0:49,A:114982478;C:111450118;G:115561207;T:112452344;N:13271,49,,,,114982478,111450118,115561207,112452344,13271,SRX1896782,SRS1539774,SRA437681,GEO,"Anming Meng, School of Lifesciences, Tsinghua University",1,0.92536,,0.04644,,0.75103,,0.47559,,49,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2016-07-04,Pharyngula,Embryo,Endothelium,Cardiovascular System 41532,SRR5006039,SRX2337867,SRS1791085,SRP092952,PRJNA352869,The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome,GSE89670,Other,"Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed ""biotagging"" a versatile methodology that uses genetically encoded components to biotinylate target proteins enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our ""biotagging"" toolkit we demonstrate the specificity of our approach at the biochemical cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that ""biotagging"" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.",,pubmed:28402863,,Myl7 RNASeq Nuclear 26hpf 2,GSM2386502,,source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse,Myl7 RNASeq Nuclear 26hpf 2,ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files,Myl7 RNASeq Nuclear 26hpf,,Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.,,strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse,GSM2386502,GSM2386502: Myl7 RNASeq Nuclear 26hpf 2; Danio rerio; RNA Seq,GSM2386502,,1,Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.,GEO Accession:GSM2386502,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP092952,,,Myl7_RNASeq_Nuclear_26hpf_2_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_2_R2.fastq.gz,fastq fastq,5163276312.0,50620356.0,GSM2386502 r1,0:51 1:51,A:1144341926;C:1402381884;G:1460666304;T:1155627236;N:258962,51,51,,,1144341926,1402381884,1460666304,1155627236,258962,SRX2337867,SRS1791085,SRA491940,GEO,"Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine",2,0.79148,0.79923,0.1676,0.16851,0.74501,0.74395,0.44104,0.45239,51,51,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2016-11-08,Pharyngula,Embryo,Heart,Cardiovascular System 41533,SRR5006038,SRX2337866,SRS1791086,SRP092952,PRJNA352869,The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome,GSE89670,Other,"Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed ""biotagging"" a versatile methodology that uses genetically encoded components to biotinylate target proteins enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our ""biotagging"" toolkit we demonstrate the specificity of our approach at the biochemical cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that ""biotagging"" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.",,pubmed:28402863,,Myl7 RNASeq Nuclear 26hpf 1,GSM2386501,,source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse,Myl7 RNASeq Nuclear 26hpf 1,ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files,Myl7 RNASeq Nuclear 26hpf,,Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.,,strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse,GSM2386501,GSM2386501: Myl7 RNASeq Nuclear 26hpf 1; Danio rerio; RNA Seq,GSM2386501,,1,Nuclei isolation using biotin tagged outer nuclear envelope adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al. 2013 adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.,GEO Accession:GSM2386501,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP092952,,,Myl7_RNASeq_Nuclear_26hpf_1_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_1_R2.fastq.gz,fastq fastq,4985333334.0,48875817.0,GSM2386501 r1,0:51 1:51,A:1030896260;C:1411954598;G:1508330460;T:1033900255;N:251761,51,51,,,1030896260,1411954598,1508330460,1033900255,251761,SRX2337866,SRS1791086,SRA491940,GEO,"Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine",2,0.7362,0.7434,0.12786,0.12837,0.75952,0.76065,0.47917,0.48384,51,51,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2016-11-08,Pharyngula,Embryo,Heart,Cardiovascular System 41681,SRR5119926,SRX2435201,SRS1870197,SRP095331,PRJNA358009,CXCL8 and CXCR1 Remodel the Vascular Niche to Promote Hematopoietic Stem and Progenitor Cell Colonization and Engraftment [wt vs kdrl:cxcr1],GSE92542,Transcriptome Analysis,The microenvironment is an important regulator of hematopoietic stem and progenitor cell HSPC biology. Interactions between the niche and stem cells have been difficult to track but recent advances marking fluorescent HSPCs have allowed exquisite visualization in the caudal hematopoietic tissue CHT of the developing zebrafish. Sinusoidal endothelial cells interact closely with HSPCs as they colonize this niche. Here we show that the chemokine cxcl8 and its receptor cxcr1 are abundantly expressed by zebrafish endothelial cells and we identify cxcl8/cxcr1 signaling as a positive regulator of HSPC colonization using genetic gain and loss of function techniques. Single cell tracking experiments demonstrated that this effect is due to an increase in HSPC “cuddling” by endothelial cells thereby increasing CHT residency time and allowing more HSPC cell divisions to occur. Enhanced cxcl8/cxcr1 signaling was associated with an increase in the volume of the CHT and induction of cxcl12a expression favoring HSPC colonization. Finally using parabiotic zebrafish we show that cxcr1 acts stem cell non autonomously to improve the efficiency of donor HSPC engraftment. This work identifies a mechanism by which the hematopoietic niche remodels to promote HSPC engraftment and suggests that cxcl8/cxcr1 signaling is a potential therapeutic target in patients undergoing hematopoietic stem cell transplantation. Overall design: Kdrl:mcherry and kdrl:mcherry;kdrl:cxcr1 zebrafish were dissociated and endothelial cells purified by FACS. RNA seq libraries were prepared from endothelial cells purified from two independent clutches of fish four libraries total.,parent bioproject:PRJNA358001,pubmed:28351983,,wt clutch2,GSM2432105,,tissue:endothelial cells|cell type:endothelial cells,wt clutch2,Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using cutadapt then mapped to Ensembl GRCz10 whole genome using Tophat 2.0.11 without xxx splicing form calls Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. FPKM values were used to normalize and quantify each transcripts Genome build: GRCz10 Supplementary files format and content: excel files include RPKM values for each Sample,endothelial cells,,Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories.,Zebrafish embryos were grown under standard conditions in a 28 degree incubator.,cell type:endothelial cells,GSM2432105,GSM2432105: wt clutch2; Danio rerio; RNA Seq,GSM2432105,,1,Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories.,GEO Accession:GSM2432105,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP095331,,,BB-IL8-7_GATCAG_R2.fastq.gz BB-IL8-7_GATCAG_R1.fastq.gz,fastq fastq,6054362200.0,30271811.0,GSM2432105 r1,0:100 1:100,A:1586036726;C:1442511502;G:1449390272;T:1575855416;N:568284,100,100,,,1586036726,1442511502,1449390272,1575855416,568284,SRX2435201,SRS1870197,SRA505250,GEO,"Oncology/Hematology, Boston Children's Hospital",2,0.68659,0.68507,0.22283,0.22137,0.76067,0.76343,0.57225,0.58743,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,random_priming,smarter,bulk,unknown,unknown,,United States,2016-12-19,Undetermined,Embryo,Endothelium,Cardiovascular System 41682,SRR5119925,SRX2435200,SRS1870195,SRP095331,PRJNA358009,CXCL8 and CXCR1 Remodel the Vascular Niche to Promote Hematopoietic Stem and Progenitor Cell Colonization and Engraftment [wt vs kdrl:cxcr1],GSE92542,Transcriptome Analysis,The microenvironment is an important regulator of hematopoietic stem and progenitor cell HSPC biology. Interactions between the niche and stem cells have been difficult to track but recent advances marking fluorescent HSPCs have allowed exquisite visualization in the caudal hematopoietic tissue CHT of the developing zebrafish. Sinusoidal endothelial cells interact closely with HSPCs as they colonize this niche. Here we show that the chemokine cxcl8 and its receptor cxcr1 are abundantly expressed by zebrafish endothelial cells and we identify cxcl8/cxcr1 signaling as a positive regulator of HSPC colonization using genetic gain and loss of function techniques. Single cell tracking experiments demonstrated that this effect is due to an increase in HSPC “cuddling” by endothelial cells thereby increasing CHT residency time and allowing more HSPC cell divisions to occur. Enhanced cxcl8/cxcr1 signaling was associated with an increase in the volume of the CHT and induction of cxcl12a expression favoring HSPC colonization. Finally using parabiotic zebrafish we show that cxcr1 acts stem cell non autonomously to improve the efficiency of donor HSPC engraftment. This work identifies a mechanism by which the hematopoietic niche remodels to promote HSPC engraftment and suggests that cxcl8/cxcr1 signaling is a potential therapeutic target in patients undergoing hematopoietic stem cell transplantation. Overall design: Kdrl:mcherry and kdrl:mcherry;kdrl:cxcr1 zebrafish were dissociated and endothelial cells purified by FACS. RNA seq libraries were prepared from endothelial cells purified from two independent clutches of fish four libraries total.,parent bioproject:PRJNA358001,pubmed:28351983,,wt clutch1,GSM2432104,,tissue:endothelial cells|cell type:endothelial cells,wt clutch1,Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using cutadapt then mapped to Ensembl GRCz10 whole genome using Tophat 2.0.11 without xxx splicing form calls Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. FPKM values were used to normalize and quantify each transcripts Genome build: GRCz10 Supplementary files format and content: excel files include RPKM values for each Sample,endothelial cells,,Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories.,Zebrafish embryos were grown under standard conditions in a 28 degree incubator.,cell type:endothelial cells,GSM2432104,GSM2432104: wt clutch1; Danio rerio; RNA Seq,GSM2432104,,1,Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories.,GEO Accession:GSM2432104,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP095331,,,BB-IL8-3_TGACCA_R1.fastq.gz BB-IL8-3_TGACCA_R2.fastq.gz,fastq fastq,4718160000.0,23590800.0,GSM2432104 r1,0:100 1:100,A:1285175152;C:1075055485;G:1078285328;T:1279202852;N:441183,100,100,,,1285175152,1075055485,1078285328,1279202852,441183,SRX2435200,SRS1870195,SRA505250,GEO,"Oncology/Hematology, Boston Children's Hospital",2,0.79676,0.7947,0.26445,0.26272,0.71652,0.71924,0.55157,0.55957,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,random_priming,smarter,bulk,unknown,unknown,,United States,2016-12-19,Undetermined,Embryo,Endothelium,Cardiovascular System 41683,SRR5119924,SRX2435199,SRS1870196,SRP095331,PRJNA358009,CXCL8 and CXCR1 Remodel the Vascular Niche to Promote Hematopoietic Stem and Progenitor Cell Colonization and Engraftment [wt vs kdrl:cxcr1],GSE92542,Transcriptome Analysis,The microenvironment is an important regulator of hematopoietic stem and progenitor cell HSPC biology. Interactions between the niche and stem cells have been difficult to track but recent advances marking fluorescent HSPCs have allowed exquisite visualization in the caudal hematopoietic tissue CHT of the developing zebrafish. Sinusoidal endothelial cells interact closely with HSPCs as they colonize this niche. Here we show that the chemokine cxcl8 and its receptor cxcr1 are abundantly expressed by zebrafish endothelial cells and we identify cxcl8/cxcr1 signaling as a positive regulator of HSPC colonization using genetic gain and loss of function techniques. Single cell tracking experiments demonstrated that this effect is due to an increase in HSPC “cuddling” by endothelial cells thereby increasing CHT residency time and allowing more HSPC cell divisions to occur. Enhanced cxcl8/cxcr1 signaling was associated with an increase in the volume of the CHT and induction of cxcl12a expression favoring HSPC colonization. Finally using parabiotic zebrafish we show that cxcr1 acts stem cell non autonomously to improve the efficiency of donor HSPC engraftment. This work identifies a mechanism by which the hematopoietic niche remodels to promote HSPC engraftment and suggests that cxcl8/cxcr1 signaling is a potential therapeutic target in patients undergoing hematopoietic stem cell transplantation. Overall design: Kdrl:mcherry and kdrl:mcherry;kdrl:cxcr1 zebrafish were dissociated and endothelial cells purified by FACS. RNA seq libraries were prepared from endothelial cells purified from two independent clutches of fish four libraries total.,parent bioproject:PRJNA358001,pubmed:28351983,,kdrl:cxcr1 clutch2,GSM2432103,,tissue:endothelial cells|cell type:endothelial cells,kdrl:cxcr1 clutch2,Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using cutadapt then mapped to Ensembl GRCz10 whole genome using Tophat 2.0.11 without xxx splicing form calls Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. FPKM values were used to normalize and quantify each transcripts Genome build: GRCz10 Supplementary files format and content: excel files include RPKM values for each Sample,endothelial cells,,Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories.,Zebrafish embryos were grown under standard conditions in a 28 degree incubator.,cell type:endothelial cells,GSM2432103,GSM2432103: kdrl:cxcr1 clutch2; Danio rerio; RNA Seq,GSM2432103,,1,Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories.,GEO Accession:GSM2432103,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP095331,,,BB-IL8-5_GCCAAT_R1.fastq.gz BB-IL8-5_GCCAAT_R2.fastq.gz,fastq fastq,4575871400.0,22879357.0,GSM2432103 r1,0:100 1:100,A:1212272291;C:1077863805;G:1079802103;T:1205507838;N:425363,100,100,,,1212272291,1077863805,1079802103,1205507838,425363,SRX2435199,SRS1870196,SRA505250,GEO,"Oncology/Hematology, Boston Children's Hospital",2,0.79788,0.79581,0.25639,0.25339,0.74888,0.75195,0.55512,0.56401,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,random_priming,smarter,bulk,unknown,unknown,,United States,2016-12-19,Undetermined,Embryo,Endothelium,Cardiovascular System 41684,SRR5119923,SRX2435198,SRS1870193,SRP095331,PRJNA358009,CXCL8 and CXCR1 Remodel the Vascular Niche to Promote Hematopoietic Stem and Progenitor Cell Colonization and Engraftment [wt vs kdrl:cxcr1],GSE92542,Transcriptome Analysis,The microenvironment is an important regulator of hematopoietic stem and progenitor cell HSPC biology. Interactions between the niche and stem cells have been difficult to track but recent advances marking fluorescent HSPCs have allowed exquisite visualization in the caudal hematopoietic tissue CHT of the developing zebrafish. Sinusoidal endothelial cells interact closely with HSPCs as they colonize this niche. Here we show that the chemokine cxcl8 and its receptor cxcr1 are abundantly expressed by zebrafish endothelial cells and we identify cxcl8/cxcr1 signaling as a positive regulator of HSPC colonization using genetic gain and loss of function techniques. Single cell tracking experiments demonstrated that this effect is due to an increase in HSPC “cuddling” by endothelial cells thereby increasing CHT residency time and allowing more HSPC cell divisions to occur. Enhanced cxcl8/cxcr1 signaling was associated with an increase in the volume of the CHT and induction of cxcl12a expression favoring HSPC colonization. Finally using parabiotic zebrafish we show that cxcr1 acts stem cell non autonomously to improve the efficiency of donor HSPC engraftment. This work identifies a mechanism by which the hematopoietic niche remodels to promote HSPC engraftment and suggests that cxcl8/cxcr1 signaling is a potential therapeutic target in patients undergoing hematopoietic stem cell transplantation. Overall design: Kdrl:mcherry and kdrl:mcherry;kdrl:cxcr1 zebrafish were dissociated and endothelial cells purified by FACS. RNA seq libraries were prepared from endothelial cells purified from two independent clutches of fish four libraries total.,parent bioproject:PRJNA358001,pubmed:28351983,,kdrl:cxcr1 clutch1,GSM2432102,,tissue:endothelial cells|cell type:endothelial cells,kdrl:cxcr1 clutch1,Sequenced reads were trimmed for adaptor sequence and masked for low complexity or low quality sequence using cutadapt then mapped to Ensembl GRCz10 whole genome using Tophat 2.0.11 without xxx splicing form calls Transcript abundance and differential expression were calculated with Cufflinks 2.2.1. FPKM values were used to normalize and quantify each transcripts Genome build: GRCz10 Supplementary files format and content: excel files include RPKM values for each Sample,endothelial cells,,Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories.,Zebrafish embryos were grown under standard conditions in a 28 degree incubator.,cell type:endothelial cells,GSM2432102,GSM2432102: kdrl:cxcr1 clutch1; Danio rerio; RNA Seq,GSM2432102,,1,Freshly sorted cells were lysed in Trizol LS and total RNA was extracted by isopropanol precipitation. Libraries were prepared using the SMARTer Universal Low Input RNA kit followed by the Low Input Library Prep Kit for Illumina Clontech Laboratories.,GEO Accession:GSM2432102,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP095331,,,BB-IL8-1_ATCACG_R1.fastq.gz BB-IL8-1_ATCACG_R2.fastq.gz,fastq fastq,5384509000.0,26922545.0,GSM2432102 r1,0:100 1:100,A:1457197772;C:1237507818;G:1239484699;T:1449819489;N:499222,100,100,,,1457197772,1237507818,1239484699,1449819489,499222,SRX2435198,SRS1870193,SRA505250,GEO,"Oncology/Hematology, Boston Children's Hospital",2,0.80446,0.79238,0.24797,0.24691,0.72423,0.72681,0.57301,0.46021,100,100,B,B,biological fallback assumption,illumina,hiseq_era,full_length,random_priming,smarter,bulk,unknown,unknown,,United States,2016-12-19,Undetermined,Embryo,Endothelium,Cardiovascular System 41827,SRR5251446,SRX2557171,SRS1974564,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR139 B1,nicoli mutmir AG01645,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR139 B1,AG01645.1,AG01645.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01645.1_R1.fastq.gz,fastq,1574284140.0,20714265.0,AG01645.1 R1.fastq.gz,0:76,A:485471345;C:270854124;G:374164721;T:443766613;N:27337,76,,,,485471345,270854124,374164721,443766613,27337,SRX2557171,SRS1974564,SRA537606,Yale University|Genetics,Yale University,1,0.82142,,0.14068,,0.8002,,0.5444,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-27,Undetermined,Embryo,Endothelium,Cardiovascular System 41828,SRR5251445,SRX2557170,SRS1974563,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR139 B2,nicoli mutmir AG01646,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR139 B2,AG01646.1,AG01646.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01646.1_R1.fastq.gz,fastq,1484740104.0,19536054.0,AG01646.1 R1.fastq.gz,0:76,A:453388316;C:246477203;G:365031959;T:419816346;N:26280,76,,,,453388316,246477203,365031959,419816346,26280,SRX2557170,SRS1974563,SRA537606,Yale University|Genetics,Yale University,1,0.82649,,0.1897,,0.79862,,0.52759,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41829,SRR5251444,SRX2557169,SRS1974562,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR139 B3,nicoli mutmir AG01647,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR139 B3,AG01647.1,AG01647.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01647.1_R1.fastq.gz,fastq,881298660.0,11596035.0,AG01647.1 R1.fastq.gz,0:76,A:270675838;C:160127586;G:228157662;T:222301246;N:36328,76,,,,270675838,160127586,228157662,222301246,36328,SRX2557169,SRS1974562,SRA537606,Yale University|Genetics,Yale University,1,0.76133,,0.15034,,0.83341,,0.56596,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41830,SRR5251443,SRX2557168,SRS1974561,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR139 B1,nicoli mutmir AG01648,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR139 B1,AG01648.1,AG01648.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01648.1_R1.fastq.gz,fastq,637896880.0,8393380.0,AG01648.1 R1.fastq.gz,0:76,A:192829278;C:112701153;G:153321271;T:179019095;N:26083,76,,,,192829278,112701153,153321271,179019095,26083,SRX2557168,SRS1974561,SRA537606,Yale University|Genetics,Yale University,1,0.75971,,0.1181,,0.82171,,0.56797,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41831,SRR5251442,SRX2557167,SRS1974560,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR139 B2,nicoli mutmir AG01649,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR139 B2,AG01649.1,AG01649.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01649.1_R1.fastq.gz,fastq,849868328.0,11182478.0,AG01649.1 R1.fastq.gz,0:76,A:258225905;C:148467172;G:205165181;T:237974100;N:35970,76,,,,258225905,148467172,205165181,237974100,35970,SRX2557167,SRS1974560,SRA537606,Yale University|Genetics,Yale University,1,0.75096,,0.14506,,0.81507,,0.5545,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41832,SRR5251441,SRX2557166,SRS1974559,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR139 B3,nicoli mutmir AG01650,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR139 B3,AG01650.1,AG01650.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01650.1_R1.fastq.gz,fastq,998464668.0,13137693.0,AG01650.1 R1.fastq.gz,0:76,A:311526420;C:176545041;G:251852786;T:258497630;N:42791,76,,,,311526420,176545041,251852786,258497630,42791,SRX2557166,SRS1974559,SRA537606,Yale University|Genetics,Yale University,1,0.76479,,0.11192,,0.82674,,0.54621,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41833,SRR5251440,SRX2557165,SRS1974558,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR24 B1,nicoli mutmir AG01651,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR24 B1,AG01651.1,AG01651.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01651.1_R1.fastq.gz,fastq,570492252.0,7506477.0,AG01651.1 R1.fastq.gz,0:76,A:162512811;C:104071716;G:135730697;T:168149427;N:27601,76,,,,162512811,104071716,135730697,168149427,27601,SRX2557165,SRS1974558,SRA537606,Yale University|Genetics,Yale University,1,0.73988,,0.10157,,0.86647,,0.54252,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41834,SRR5251439,SRX2557164,SRS1974557,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR24 B2,nicoli mutmir AG01652,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR24 B2,AG01652.1,AG01652.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01652.1_R1.fastq.gz,fastq,1072886148.0,14116923.0,AG01652.1 R1.fastq.gz,0:76,A:338399596;C:192703439;G:242960887;T:298769761;N:52465,76,,,,338399596,192703439,242960887,298769761,52465,SRX2557164,SRS1974557,SRA537606,Yale University|Genetics,Yale University,1,0.76456,,0.11024,,0.89197,,0.59214,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41835,SRR5251438,SRX2557163,SRS1974556,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR24 B3,nicoli mutmir AG01653,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR24 B3,AG01653.1,AG01653.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01653.1_R1.fastq.gz,fastq,1016374144.0,13373344.0,AG01653.1 R1.fastq.gz,0:76,A:310958343;C:168702106;G:223420046;T:313241363;N:52286,76,,,,310958343,168702106,223420046,313241363,52286,SRX2557163,SRS1974556,SRA537606,Yale University|Genetics,Yale University,1,0.75735,,0.12224,,0.79756,,0.55136,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-02-13,Undetermined,Embryo,Endothelium,Cardiovascular System 41836,SRR5251437,SRX2557162,SRS1974555,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR24 B1,nicoli mutmir AG01654,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR24 B1,AG01654.1,AG01654.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01654.1_R1.fastq.gz,fastq,782170112.0,10291712.0,AG01654.1 R1.fastq.gz,0:76,A:238316720;C:132163709;G:179301544;T:232350598;N:37541,76,,,,238316720,132163709,179301544,232350598,37541,SRX2557162,SRS1974555,SRA537606,Yale University|Genetics,Yale University,1,0.7683,,0.10712,,0.80034,,0.55804,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41837,SRR5251436,SRX2557161,SRS1974554,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR24 B2,nicoli mutmir AG01655,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR24 B2,AG01655.1,AG01655.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01655.1_R1.fastq.gz,fastq,1053946340.0,13867715.0,AG01655.1 R1.fastq.gz,0:76,A:318351311;C:191163031;G:240348413;T:304030367;N:53218,76,,,,318351311,191163031,240348413,304030367,53218,SRX2557161,SRS1974554,SRA537606,Yale University|Genetics,Yale University,1,0.77588,,0.07983,,0.83934,,0.56228,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41838,SRR5251435,SRX2557160,SRS1974553,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR24 B3,nicoli mutmir AG01656,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR24 B3,AG01656.1,AG01656.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01656.1_R1.fastq.gz,fastq,1182467736.0,15558786.0,AG01656.1 R1.fastq.gz,0:76,A:344465226;C:204677242;G:269228338;T:364036735;N:60195,76,,,,344465226,204677242,269228338,364036735,60195,SRX2557160,SRS1974553,SRA537606,Yale University|Genetics,Yale University,1,0.78956,,0.13495,,0.81517,,0.56342,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-02-13,Undetermined,Embryo,Endothelium,Cardiovascular System 41839,SRR5251434,SRX2557159,SRS1974552,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR223 B1,nicoli mutmir AG01657,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR223 B1,AG01657.1,AG01657.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01657.1_R1.fastq.gz,fastq,536336712.0,7057062.0,AG01657.1 R1.fastq.gz,0:76,A:158301607;C:93070120;G:121382262;T:163555487;N:27236,76,,,,158301607,93070120,121382262,163555487,27236,SRX2557159,SRS1974552,SRA537606,Yale University|Genetics,Yale University,1,0.76425,,0.1278,,0.84222,,0.55305,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-02-13,Undetermined,Embryo,Endothelium,Cardiovascular System 41840,SRR5251433,SRX2557158,SRS1974551,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR223 B2,nicoli mutmir AG01658,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR223 B2,AG01658.1,AG01658.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01658.1_R1.fastq.gz,fastq,798581856.0,10507656.0,AG01658.1 R1.fastq.gz,0:76,A:241352089;C:134327379;G:183394123;T:239469845;N:38420,76,,,,241352089,134327379,183394123,239469845,38420,SRX2557158,SRS1974551,SRA537606,Yale University|Genetics,Yale University,1,0.76221,,0.13398,,0.82459,,0.55228,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41841,SRR5251432,SRX2557157,SRS1974550,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR223 B3,nicoli mutmir AG01659,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR223 B3,AG01659.1,AG01659.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01659.1_R1.fastq.gz,fastq,1093998948.0,14394723.0,AG01659.1 R1.fastq.gz,0:76,A:330741822;C:186325335;G:249557623;T:327320449;N:53719,76,,,,330741822,186325335,249557623,327320449,53719,SRX2557157,SRS1974550,SRA537606,Yale University|Genetics,Yale University,1,0.77108,,0.14674,,0.80955,,0.55819,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41842,SRR5251431,SRX2557156,SRS1974549,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR223 B1,nicoli mutmir AG01660,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 223 ya304/ya304|molecule:mRNA|condition:miR 223|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR223 B1,AG01660.1,AG01660.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01660.1_R1.fastq.gz,fastq,849905492.0,11182967.0,AG01660.1 R1.fastq.gz,0:76,A:250953875;C:146191904;G:190040699;T:262674911;N:44103,76,,,,250953875,146191904,190040699,262674911,44103,SRX2557156,SRS1974549,SRA537606,Yale University|Genetics,Yale University,1,0.7687,,0.14192,,0.82842,,0.5344,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-02-13,Undetermined,Embryo,Endothelium,Cardiovascular System 41843,SRR5251430,SRX2557155,SRS1974548,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR223 B2,nicoli mutmir AG01661,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 223 ya304/ya304|molecule:mRNA|condition:miR 223|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR223 B2,AG01661.1,AG01661.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01661.1_R1.fastq.gz,fastq,840115400.0,11054150.0,AG01661.1 R1.fastq.gz,0:76,A:257057495;C:141775085;G:188281166;T:252960590;N:41064,76,,,,257057495,141775085,188281166,252960590,41064,SRX2557155,SRS1974548,SRA537606,Yale University|Genetics,Yale University,1,0.74292,,0.10759,,0.83615,,0.55136,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 42141,SRR5443688,SRX2733020,SRS2120917,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 3,GSM2574373,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 3,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574373,GSM2574373: 48hpf zebrafish FAC sorted endothelial cell mutant 3; Danio rerio; RNA Seq,GSM2574373,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574373,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M3_S6_L001_R1_001.fastq.gz,fastq,1290470348.0,17096427.0,GSM2574373 r1,0:75.48 1:0,A:320847705;C:319435806;G:300073193;T:350044923;N:68721,75,0,,,320847705,319435806,300073193,350044923,68721,SRX2733020,SRS2120917,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.94339,,0.05762,,0.72232,,0.50799,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42142,SRR5443689,SRX2733020,SRS2120917,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 3,GSM2574373,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 3,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574373,GSM2574373: 48hpf zebrafish FAC sorted endothelial cell mutant 3; Danio rerio; RNA Seq,GSM2574373,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574373,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M3_S6_L002_R1_001.fastq.gz,fastq,1274417413.0,16883601.0,GSM2574373 r2,0:75.48 1:0,A:316659737;C:315517172;G:296527344;T:345645123;N:68037,75,0,,,316659737,315517172,296527344,345645123,68037,SRX2733020,SRS2120917,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.94193,,0.05753,,0.7236,,0.50991,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42143,SRR5443690,SRX2733020,SRS2120917,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 3,GSM2574373,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 3,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574373,GSM2574373: 48hpf zebrafish FAC sorted endothelial cell mutant 3; Danio rerio; RNA Seq,GSM2574373,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574373,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M3_S6_L003_R1_001.fastq.gz,fastq,1267650302.0,16794051.0,GSM2574373 r3,0:75.48 1:0,A:316851687;C:313922763;G:294562163;T:342271337;N:42352,75,0,,,316851687,313922763,294562163,342271337,42352,SRX2733020,SRS2120917,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.93935,,0.05711,,0.72421,,0.51344,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42144,SRR5443691,SRX2733020,SRS2120917,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 3,GSM2574373,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 3,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574373,GSM2574373: 48hpf zebrafish FAC sorted endothelial cell mutant 3; Danio rerio; RNA Seq,GSM2574373,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574373,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M3_S6_L004_R1_001.fastq.gz,fastq,1272371755.0,16856553.0,GSM2574373 r4,0:75.48 1:0,A:317627046;C:315030569;G:295859300;T:343808592;N:46248,75,0,,,317627046,315030569,295859300,343808592,46248,SRX2733020,SRS2120917,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.94038,,0.05657,,0.72391,,0.5115,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42145,SRR5443684,SRX2733019,SRS2120916,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 2,GSM2574372,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 2,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574372,GSM2574372: 48hpf zebrafish FAC sorted endothelial cell mutant 2; Danio rerio; RNA Seq,GSM2574372,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574372,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M2_S4_L001_R1_001.fastq.gz,fastq,1110761224.0,14715439.0,GSM2574372 r1,0:75.48 1:0,A:275638341;C:274879264;G:260426963;T:299738013;N:78643,75,0,,,275638341,274879264,260426963,299738013,78643,SRX2733019,SRS2120916,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.93377,,0.0583,,0.73697,,0.503,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42146,SRR5443685,SRX2733019,SRS2120916,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 2,GSM2574372,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 2,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574372,GSM2574372: 48hpf zebrafish FAC sorted endothelial cell mutant 2; Danio rerio; RNA Seq,GSM2574372,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574372,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M2_S4_L002_R1_001.fastq.gz,fastq,1096460187.0,14525794.0,GSM2574372 r2,0:75.48 1:0,A:271912949;C:271463678;G:257186071;T:295823949;N:73540,75,0,,,271912949,271463678,257186071,295823949,73540,SRX2733019,SRS2120916,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.9322,,0.05825,,0.74054,,0.50344,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42147,SRR5443686,SRX2733019,SRS2120916,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 2,GSM2574372,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 2,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574372,GSM2574372: 48hpf zebrafish FAC sorted endothelial cell mutant 2; Danio rerio; RNA Seq,GSM2574372,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574372,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M2_S4_L003_R1_001.fastq.gz,fastq,1091010366.0,14453885.0,GSM2574372 r3,0:75.48 1:0,A:272182496;C:270174883;G:255585422;T:293013773;N:53792,75,0,,,272182496,270174883,255585422,293013773,53792,SRX2733019,SRS2120916,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.93152,,0.05837,,0.74168,,0.50083,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42148,SRR5443687,SRX2733019,SRS2120916,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 2,GSM2574372,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 2,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574372,GSM2574372: 48hpf zebrafish FAC sorted endothelial cell mutant 2; Danio rerio; RNA Seq,GSM2574372,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574372,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M2_S4_L004_R1_001.fastq.gz,fastq,1094982987.0,14506489.0,GSM2574372 r4,0:75.48 1:0,A:272880331;C:271041484;G:256630523;T:294374054;N:56595,75,0,,,272880331,271041484,256630523,294374054,56595,SRX2733019,SRS2120916,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.93087,,0.05679,,0.73791,,0.51669,,74,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42149,SRR5443680,SRX2733018,SRS2120918,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 1,GSM2574371,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 1,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574371,GSM2574371: 48hpf zebrafish FAC sorted endothelial cell mutant 1; Danio rerio; RNA Seq,GSM2574371,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574371,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M1_S2_L001_R1_001.fastq.gz,fastq,1191104867.0,15788220.0,GSM2574371 r1,0:75.44 1:0,A:291253611;C:297887900;G:280714676;T:321180057;N:68623,75,0,,,291253611,297887900,280714676,321180057,68623,SRX2733018,SRS2120918,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.93937,,0.05486,,0.73841,,0.50505,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42150,SRR5443681,SRX2733018,SRS2120918,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 1,GSM2574371,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 1,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574371,GSM2574371: 48hpf zebrafish FAC sorted endothelial cell mutant 1; Danio rerio; RNA Seq,GSM2574371,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574371,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M1_S2_L002_R1_001.fastq.gz,fastq,1175231750.0,15577911.0,GSM2574371 r2,0:75.44 1:0,A:287141469;C:293942288;G:277159611;T:316919071;N:69311,75,0,,,287141469,293942288,277159611,316919071,69311,SRX2733018,SRS2120918,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.93883,,0.05461,,0.73841,,0.50615,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System 42151,SRR5443682,SRX2733018,SRS2120918,SRP103805,PRJNA382558,mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish.,GSE97649,Transcriptome Analysis,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate with 6 brains used per samples. Overall design: wild type vs mutant,,pubmed:26253536,,48hpf zebrafish FAC sorted endothelial cell mutant 1,GSM2574371,,tissue:purified endothelial cell|transgene:kdrl eGFP|genotype:mafba uq4bh mutant,48hpf zebrafish FAC sorted endothelial cell mutant 1,adaptor trimming done by bcl2fastq2 Reads were mapped against the reference genome danRer7/Zv9 using STAR Dobin et al. 2013 and read counts for each gene in the Ensembl annotation were generated using htseq count in the HTSeq python package Anders et al. 2015. Genome build: danRer7/Zv9 Supplementary files format and content: Tab delimited text files include yugene normalised data for each sample,purified endothelial cell,,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,,transgene:kdrl eGFP|genotype:mafba uq4bh mutant,GSM2574371,GSM2574371: 48hpf zebrafish FAC sorted endothelial cell mutant 1; Danio rerio; RNA Seq,GSM2574371,,1,48hpf kdrl:egfp zebrafish brains were dissociated using Liberase and pdgfr beta egfp postive cells FAC sorted into Trizol LS. RNA was extracted and amplified before sequencing. Samples were prepared in triplicate. libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2574371,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP103805,,,M1_S2_L003_R1_001.fastq.gz,fastq,1170671016.0,15517791.0,GSM2574371 r3,0:75.44 1:0,A:287726896;C:292922993;G:275775803;T:314197498;N:47826,75,0,,,287726896,292922993,275775803,314197498,47826,SRX2733018,SRS2120918,SRA553927,GEO,Australian Institute for Bioengineering and Nanotechnology,1,0.93571,,0.05459,,0.74168,,0.50894,,76,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Australia,2017-04-11,Hatching,Embryo,Endothelium,Cardiovascular System