rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
25170,SRR25661605,SRX21387413,SRS18627977,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,hand2 FLD+/? 20 hpf CMs rep3,GSM7714404,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD+/? 20 hpf CMs rep3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS,GSM7714404,GSM7714404: hand2 FLD+/? 20 hpf CMs rep3; Danio rerio; RNA Seq,GSM7714404 r1,GSM7714404,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_het_3_R1.fastq.gz,fastq,2441736984.0,34141777.0,GSM7714404 r1,0:71.52,A:706186414;C:496261994;G:526176364;T:713112212;N:0,71,,,,706186414,496261994,526176364,713112212,0,SRX21387413,SRS18627977,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.9026,,0.15816,,0.76278,,0.44042,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25171,SRR25661606,SRX21387412,SRS18627976,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,hand2 FLD+/? 20 hpf CMs rep2,GSM7714403,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD+/? 20 hpf CMs rep2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS,GSM7714403,GSM7714403: hand2 FLD+/? 20 hpf CMs rep2; Danio rerio; RNA Seq,GSM7714403 r1,GSM7714403,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_het_2_R1.fastq.gz,fastq,2185611269.0,30558084.0,GSM7714403 r1,0:71.52,A:612617675;C:458632518;G:474458738;T:639902338;N:0,71,,,,612617675,458632518,474458738,639902338,0,SRX21387412,SRS18627976,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90042,,0.14005,,0.75424,,0.44277,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25172,SRR25661607,SRX21387411,SRS18627975,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,hand2 FLD+/? 20 hpf CMs rep1,GSM7714402,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD+/? 20 hpf CMs rep1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 mutants|treatment:sorted cells by FACS,GSM7714402,GSM7714402: hand2 FLD+/? 20 hpf CMs rep1; Danio rerio; RNA Seq,GSM7714402 r1,GSM7714402,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_het_1_R1.fastq.gz,fastq,2291884894.0,32043147.0,GSM7714402 r1,0:71.52,A:635094975;C:489594953;G:499909828;T:667285138;N:0,71,,,,635094975,489594953,499909828,667285138,0,SRX21387411,SRS18627975,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90883,,0.14288,,0.75331,,0.44459,,71,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25173,SRR25661608,SRX21387410,SRS18627974,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,WT 20 hpf CMs rep3,GSM7714401,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,WT 20 hpf CMs rep3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS,GSM7714401,GSM7714401: WT 20 hpf CMs rep3; Danio rerio; RNA Seq,GSM7714401 r1,GSM7714401,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_CMs_3_R1.fastq.gz,fastq,2268251602.0,31717610.0,GSM7714401 r1,0:71.51,A:637196241;C:477782543;G:497683941;T:655588877;N:0,71,,,,637196241,477782543,497683941,655588877,0,SRX21387410,SRS18627974,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90026,,0.13291,,0.78707,,0.40811,,71,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25174,SRR25661609,SRX21387409,SRS18627973,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,WT 20 hpf CMs rep2,GSM7714400,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,WT 20 hpf CMs rep2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS,GSM7714400,GSM7714400: WT 20 hpf CMs rep2; Danio rerio; RNA Seq,GSM7714400 r1,GSM7714400,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_CMs_2_R1.fastq.gz,fastq,2195524610.0,30700033.0,GSM7714400 r1,0:71.52,A:615401741;C:462686936;G:481135567;T:636300366;N:0,71,,,,615401741,462686936,481135567,636300366,0,SRX21387409,SRS18627973,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90323,,0.1476,,0.78744,,0.41728,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25175,SRR25661610,SRX21387408,SRS18627972,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,WT 20 hpf CMs rep1,GSM7714399,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,WT 20 hpf CMs rep1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:sibling WT of hand2 OE|treatment:sorted cells by FACS,GSM7714399,GSM7714399: WT 20 hpf CMs rep1; Danio rerio; RNA Seq,GSM7714399 r1,GSM7714399,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_WT_CMs_1_R1.fastq.gz,fastq,2258160684.0,31576661.0,GSM7714399 r1,0:71.51,A:641254288;C:471580136;G:491501482;T:653824778;N:0,71,,,,641254288,471580136,491501482,653824778,0,SRX21387408,SRS18627972,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.9,,0.13993,,0.78445,,0.40575,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25176,SRR25661611,SRX21387407,SRS18627971,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,hand2 OE 20 hpf CMs rep3,GSM7714398,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 OE 20 hpf CMs rep3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS,GSM7714398,GSM7714398: hand2 OE 20 hpf CMs rep3; Danio rerio; RNA Seq,GSM7714398 r1,GSM7714398,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_OE_CMs_3_R1.fastq.gz,fastq,1886569909.0,26380170.0,GSM7714398 r1,0:71.51,A:534874421;C:392168718;G:411533838;T:547992932;N:0,71,,,,534874421,392168718,411533838,547992932,0,SRX21387407,SRS18627971,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.89968,,0.14763,,0.77881,,0.42601,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25177,SRR25661612,SRX21387406,SRS18627970,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,hand2 OE 20 hpf CMs rep2,GSM7714397,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 OE 20 hpf CMs rep2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS,GSM7714397,GSM7714397: hand2 OE 20 hpf CMs rep2; Danio rerio; RNA Seq,GSM7714397 r1,GSM7714397,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_OE_CMs_2_R1.fastq.gz,fastq,2197151812.0,30722639.0,GSM7714397 r1,0:71.52,A:617116635;C:461951919;G:481371246;T:636712012;N:0,71,,,,617116635,461951919,481371246,636712012,0,SRX21387406,SRS18627970,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90877,,0.14744,,0.77191,,0.42845,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25178,SRR25661613,SRX21387405,SRS18627969,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,hand2 OE 20 hpf CMs rep1,GSM7714396,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 OE 20 hpf CMs rep1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:overexpression hand2 in myocardium|treatment:sorted cells by FACS,GSM7714396,GSM7714396: hand2 OE 20 hpf CMs rep1; Danio rerio; RNA Seq,GSM7714396 r1,GSM7714396,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_OE_CMs_1_R1.fastq.gz,fastq,1773398936.0,24797998.0,GSM7714396 r1,0:71.51,A:495618212;C:375438077;G:390377060;T:511965587;N:0,71,,,,495618212,375438077,390377060,511965587,0,SRX21387405,SRS18627969,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.90769,,0.1387,,0.7768,,0.42096,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25179,SRR25661614,SRX21387404,SRS18627968,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,hand2 FLD /  20 hpf CMs rep3,GSM7714395,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD /  20 hpf CMs rep3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS,GSM7714395,GSM7714395: hand2 FLD /  20 hpf CMs rep3; Danio rerio; RNA Seq,GSM7714395 r1,GSM7714395,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_Mut_3_R1.fastq.gz,fastq,2179400259.0,30471965.0,GSM7714395 r1,0:71.52,A:600555691;C:468535203;G:483122661;T:627186704;N:0,71,,,,600555691,468535203,483122661,627186704,0,SRX21387404,SRS18627968,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.91581,,0.12256,,0.75209,,0.43413,,71,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25180,SRR25661615,SRX21387403,SRS18627967,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,hand2 FLD /  20 hpf CMs rep2,GSM7714394,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD /  20 hpf CMs rep2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS,GSM7714394,GSM7714394: hand2 FLD /  20 hpf CMs rep2; Danio rerio; RNA Seq,GSM7714394 r1,GSM7714394,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_Mut_2_R1.fastq.gz,fastq,2340991168.0,32733068.0,GSM7714394 r1,0:71.52,A:647423337;C:500120073;G:514803152;T:678644606;N:0,71,,,,647423337,500120073,514803152,678644606,0,SRX21387403,SRS18627967,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.91231,,0.12561,,0.75118,,0.44445,,71,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
25181,SRR25661616,SRX21387402,SRS18627966,SRP455520,PRJNA1006302,The transcriptome of hand2 loss  and gain of function embryonic cardiomyocytes,GSE241049,Transcriptome Analysis,To gain mechanistic insight into how Hand2 regulates cardiac fusion  we performed transcriptomic analyses of  hand2 loss  and gain of function 20 hpf cardiomyocytes. Overall design: 1. hand2 loss of function: hand2 mutant CMs vs WT sibling CMs  each group has 3 replicates. 2. hand2 gain of function: hand2 OE CMs vs WT sibling CMs  each group has 3 replicates.,,pubmed:39658721,,hand2 FLD /  20 hpf CMs rep1,GSM7714393,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS|geo loc name:missing|collection date:missing,hand2 FLD /  20 hpf CMs rep1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q20 in a window of 20 nucleotides. Only reads between 15 and 75 nucleotides were cleared for further analyses. Trimmed and filtered reads were aligned vs. the Ensembl zebrafish genome version danRer11 ensemble release 104 using STAR 2.7.10a with the parameter “–outFilterMismatchNoverLmax 0.1” to increase the maximum ratio of mismatches to mapped length to 10%. The number of reads aligning to genes was counted with featureCounts 2.0.2. tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. Differentially expressed genes were identified using DESeq2 version 1.30.1. Only genes with a minimum fold change of ±1.5 log2 ± 0.59  a maximum Benjamini–Hochberg corrected p value of 0.05  and a minimum combined mean of 5 reads were deemed to be significantly differentially expressed. Assembly: danRer11 Supplementary files format and content: library size normalized counts,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocytes|genotype:hand2 mutant|treatment:sorted cells by FACS,GSM7714393,GSM7714393: hand2 FLD /  20 hpf CMs rep1; Danio rerio; RNA Seq,GSM7714393 r1,GSM7714393,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP455520,,loader:fastq load.py,E22_3458_Yanli_HT_Lib_Mut_1_R1.fastq.gz,fastq,2727863036.0,38140997.0,GSM7714393 r1,0:71.52,A:760867462;C:577539041;G:596986102;T:792470431;N:0,71,,,,760867462,577539041,596986102,792470431,0,SRX21387402,SRS18627966,SRA1694205,MPI for heart and lung research,MPI for heart and lung research,1,0.91175,,0.1342,,0.75282,,0.44063,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-08-17,Segmentation,Embryo,Heart,Cardiovascular System
26483,SRR25930975,SRX21649988,SRS18818460,SRP458853,PRJNA1013567,scRNA seq of 50 hpf and 80 hpf isolated zebrafish hearts,GSE242483,Transcriptome Analysis,Seeking to identify additional transcription factors required for cardiac valve formation  we determined and explored the transcriptional landscape of endocardial cells at the time when key morphogenetic events underlying valve development take place. Overall design: We isolated wild type zebrafish hearts at 50 hpf when valve identity has just been established  and at 80 hpf when forming valves are first observed,,pubmed:38748804,,50hpf,GSM7764481,,source name:heart|tissue:heart|genotype:wild type|age:50hpf|geo loc name:missing|collection date:missing,50hpf,Reads were aligned against the zebrafish genome and counted by StarSolo. Preprocessed counts were further analysed using Scanpy. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed cells that did not express more than 300 genes or had a mitochondrial content greater than 8%. Furthermore  we filtered genes if they were detected in less than 30 cells. Raw counts per cell were normalised to the median count over all cells and transformed into log space to stabilise variance. We initially reduced dimensionality of the dataset using PCA  retaining 50 principal components. Subsequent steps  like low dimensional UMAP embedding and cell clustering  were based on the initial PCA. Final data visualization was done by scanpy and cellxgene packages. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,heart,,Whole hearts were isolated and cardiac cells were dissociated. Dead cells were removed from the final cell isolate by FACs sorting in PBS without xxx and Magnesium and with 0.04% BSA. Each sample was run separately on a lane in a Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3 1 10xGenomics.  scRNA seq library preparation was done using a standard protocol  and sequencing was done on a Nextseq2000,,tissue:heart|genotype:wild type|age:50hpf,GSM7764481,GSM7764481: 50hpf; Danio rerio; RNA Seq,GSM7764481 r1,GSM7764481,1,Whole hearts were isolated and cardiac cells were dissociated. Dead cells were removed from the final cell isolate by FACs sorting in PBS without xxx and Magnesium and with 0.04% BSA. Each sample was run separately on a lane in a Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3 1 10xGenomics.  scRNA seq library preparation was done using a standard protocol  and sequencing was done on a Nextseq2000,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP458853,,,Giulia_50hpf_S1_R2_001.fastq.gz Giulia_50hpf_S1_R1_001.fastq.gz,fastq fastq,19874763820.0,237988724.0,GSM7764481 r1,0:28 1:55.51,A:5320257914;C:4424267230;G:4320623789;T:5708249185;N:101365702,28,55,,,5320257914,4424267230,4320623789,5708249185,101365702,SRX21649988,SRS18818460,SRA1706674,"Bioinformatics, Max-Planck-Institute for Heart and Lung Research","Bioinformatics, Max-Planck-Institute for Heart and Lung Research",2,0.00185,0.94414,0.00087,0.13397,0.99675,0.80172,0.41142,0.51985,28,56,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2023-09-06,Hatching,Embryo,Heart,Cardiovascular System
29089,SRR27015253,SRX22707797,SRS19700098,SRP475323,PRJNA1047551,Identification of genes important during atrial myocardial morphogenesis,GSE249149,Transcriptome Analysis,Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures.  We aimed to identify the genes involved during this process  and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.,,pubmed:39289341,,Wild type zebrafish atrial cardiomyocytes  48 hpf  rep 3,GSM7927518,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing,Wild type zebrafish atrial cardiomyocytes  48 hpf  rep 3,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al.  Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf,GSM7927518,GSM7927518: Wild type zebrafish atrial cardiomyocytes  48 hpf  rep 3; Danio rerio; RNA Seq,GSM7927518 r1,GSM7927518,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP475323,,loader:fastq load.py,dst226_zbrf_clt___ACrdmct-age___48h_b03_t01_m01_R1.fastq.gz,fastq,2161847345.0,35921817.0,GSM7927518 r1,0:60.18,A:505467877;C:418329045;G:416403136;T:483063599;N:338583688,60,,,,505467877,418329045,416403136,483063599,338583688,SRX22707797,SRS19700098,SRA1761360,MPI for heart and lung research,MPI for heart and lung research,1,0.89532,,0.08355,,0.82012,,0.68413,,35,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-12-01,Hatching,Embryo,Heart,Cardiovascular System
29090,SRR27015254,SRX22707796,SRS19700097,SRP475323,PRJNA1047551,Identification of genes important during atrial myocardial morphogenesis,GSE249149,Transcriptome Analysis,Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures.  We aimed to identify the genes involved during this process  and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.,,pubmed:39289341,,Wild type zebrafish atrial cardiomyocytes  48 hpf  rep 2,GSM7927517,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing,Wild type zebrafish atrial cardiomyocytes  48 hpf  rep 2,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al.  Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf,GSM7927517,GSM7927517: Wild type zebrafish atrial cardiomyocytes  48 hpf  rep 2; Danio rerio; RNA Seq,GSM7927517 r1,GSM7927517,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP475323,,loader:fastq load.py,dst226_zbrf_clt___ACrdmct-age___48h_b02_t01_m01_R1.fastq.gz,fastq,2065547064.0,31863833.0,GSM7927517 r1,0:64.82,A:530497695;C:434164388;G:434118538;T:518043928;N:148722515,64,,,,530497695,434164388,434118538,518043928,148722515,SRX22707796,SRS19700097,SRA1761360,MPI for heart and lung research,MPI for heart and lung research,1,0.91772,,0.17863,,0.76828,,0.49567,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-12-01,Hatching,Embryo,Heart,Cardiovascular System
29091,SRR27015255,SRX22707795,SRS19700096,SRP475323,PRJNA1047551,Identification of genes important during atrial myocardial morphogenesis,GSE249149,Transcriptome Analysis,Atrial cardiomyocytes undergo complex cellular behaviours post 72 hpf to build muscle structures.  We aimed to identify the genes involved during this process  and therefore we seqeunced the RNA from 48 hpf and 72 hpf atrial cardiomyocytes to uncover changes in the transcirptome that might regulate or trigger atrial morphogenesis post 72 hpf. Overall design: Comparative gene expression profiling analysis of RNA seq data for 48 hpf and 72 hpf wild type zebrafish atrial cardiomyocytes.,,pubmed:39289341,,Wild type zebrafish atrial cardiomyocytes  48 hpf  rep 1,GSM7927516,,source name:embryonic heart|tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf loc name:missing|collection date:missing,Wild type zebrafish atrial cardiomyocytes  48 hpf  rep 1,Trimmomatic version 0.39 was employed to trim reads post a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides Bolger et al.  Trimmomatic: a flexible trimmer for Illumina sequence data. Reads were aligned versus Ensembl zebrafish genome version danRer11 Ensembl release 104 with STAR 2.7.10a Dobin et al.  STAR: ultrafast universal RNA seq aligner. Alignments were filtered to remove: duplicates with Picard 3.0.0 Picard: A set of tools in Java for working with next generation sequencing data in the BAM format  multi mapping  ribosomal  or mitochondrial reads. Gene counts were established with featureCounts 2.0.4 by aggregating reads overlapping exons excluding those overlapping multiple genes Liao et al.  featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Assembly: danRer11 Supplementary files format and content: count matrix,embryonic heart,,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,tissue:embryonic heart|cell type:cardiomyocyte|genotype:wild type|treatment:48 hpf,GSM7927516,GSM7927516: Wild type zebrafish atrial cardiomyocytes  48 hpf  rep 1; Danio rerio; RNA Seq,GSM7927516 r1,GSM7927516,1,miRNeasy micro Kit Qiagen  using low input DNase protocol Approximately 1ng of total RNA was used as starting material for SMART® Seq HT Kit Takara Bio.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 2000,,SRP475323,,loader:fastq load.py,dst226_zbrf_clt___ACrdmct-age___48h_b01_t01_m01_R1.fastq.gz,fastq,1619268089.0,24941754.0,GSM7927516 r1,0:64.92,A:410578311;C:344485123;G:343852178;T:401558739;N:118793738,64,,,,410578311,344485123,343852178,401558739,118793738,SRX22707795,SRS19700096,SRA1761360,MPI for heart and lung research,MPI for heart and lung research,1,0.91693,,0.13175,,0.77082,,0.47511,,72,,B,,usable mapping rate,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2023-12-01,Hatching,Embryo,Heart,Cardiovascular System
31528,SRR28423881,SRX24027916,SRS20821688,SRP497294,PRJNA1090898,The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169,GSE262247,Transcriptome Analysis,The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration.  MyD88 is a key component of the innate immune response; however  its role during regeneration remains unclear.  Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations  as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 /  ventricles.  Consistent with these findings  we observed increased myofibroblasts  fibrin abundance  and scarring in myd88 /  ventricles.  Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium.  Moreover  loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area.  Notably  endothelial specific overexpression of myd88 reverses the neutrophil  fibrotic  and scarring phenotypes in cryoinjured myd88 /  ventricles.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis  thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 /  ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq.,parent bioproject:PRJNA1090894,pubmed:39271818,,ventricular cells  myd88 /   24 hpci,GSM8161054,,source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing,ventricular cells  myd88 /   24 hpci,Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al.  doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al.  doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore  we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA  retaining 50 principal components. Subsequent steps  like low dimensional UMAP embedding McInnes & Healy  https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al.  https://arxiv.org/abs/1810.08473  were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,cardiac ventricles,cardiac cryoinjury 24 hours prior to heart extraction,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 /  ventricles for the myd88+/+ and myd88 /  sample  respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min  followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM  Library & Gel Bead Kit v3.1  16 rxns PN 1000121.,,tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88 / |treatment:cardiac cryoinjury,GSM8161054,GSM8161054: ventricular cells  myd88 /   24 hpci; Danio rerio; RNA Seq,GSM8161054 r1,GSM8161054,1,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 /  ventricles for the myd88+/+ and myd88 /  sample  respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min  followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM  Library & Gel Bead Kit v3.1  16 rxns PN 1000121.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP497294,,,Pinelopi_10x_Zebrafish_Mut_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_Mut_Lib_R2.fastq.gz,fastq fastq,31356990530.0,394538049.0,GSM8161054 r1,0:28 1:51.48,A:8573180857;C:6884590114;G:7520784498;T:8220228225;N:158206836,28,51,,,8573180857,6884590114,7520784498,8220228225,158206836,SRX24027916,SRS20821688,SRA1832827,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-03-22,Cleavage,Embryo,Heart,Cardiovascular System
31529,SRR28423882,SRX24027915,SRS20821687,SRP497294,PRJNA1090898,The innate immune regulator MyD88 dampens fibrosis during zebrafish heart regeneration dst169,GSE262247,Transcriptome Analysis,The innate immune system is triggered xxx post injury and its spatiotemporal dynamics are critical for successful regeneration.  MyD88 is a key component of the innate immune response; however  its role during regeneration remains unclear.  Here we show that MyD88 controls not only the inflammatory but also the fibrotic response during zebrafish cardiac regeneration.  Our data reveal a significant reduction in pro inflammatory neutrophil and macrophage populations  as well as the expansion of a collagen rich endocardial population in cryoinjured myd88 /  ventricles.  Consistent with these findings  we observed increased myofibroblasts  fibrin abundance  and scarring in myd88 /  ventricles.  Transcriptomic analyses of endocardial cells and immunostaining experiments reveal compromised PI3K/AKT pathway activation in the myd88 /  endocardium.  Moreover  loss of MyD88 impairs cardiomyocyte proliferation and protrusive activity towards the injured area.  Notably  endothelial specific overexpression of myd88 reverses the neutrophil  fibrotic  and scarring phenotypes in cryoinjured myd88 /  ventricles.  Mechanistically  we identify the endocardial derived chemokine gene cxcl18b as a transcriptional target of the MyD88 signaling axis and using loss  and gain of function tools show that it controls neutrophil recruitment.  Altogether  these findings shed light on the pivotal role of MyD88 in modulating inflammation and fibrosis  thereby emphasizing the strong impact of the innate immune response during tissue regeneration. Overall design: Live zebrafish ventricular cells were isolated at 24 hour post cryoinjury hpci from myd88+/+ and myd88 /  ventricles by Fluorescence activated cell sorting FACS and analyzed using scRNAseq.,parent bioproject:PRJNA1090894,pubmed:39271818,,ventricular cells  myd88+/+  24 hpci,GSM8161053,,source name:cardiac ventricles|tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury|geo loc name:missing|collection date:missing,ventricular cells  myd88+/+  24 hpci,Raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Dobin et al.  doi: 10.1093/bioinformatics/bts635 followed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy Wolf et al.  doi: 10.1186/s13059 017 1382 0. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 32 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 10%. Furthermore  we filtered 7823 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance We initially reduced dimensionality of the dataset using PCA  retaining 50 principal components. Subsequent steps  like low dimensional UMAP embedding McInnes & Healy  https://arxiv.org/abs/1802.03426 and cell clustering via community detection Traag et al.  https://arxiv.org/abs/1810.08473  were based on the initial PCA. Final data visualization was done by CellxGene package DOI 10.5281/zenodo.3235020. Assembly: DanRer11 Supplementary files format and content: starsolo outputs,cardiac ventricles,cardiac cryoinjury 24 hours prior to heart extraction,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 /  ventricles for the myd88+/+ and myd88 /  sample  respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer’s instructions and with the following modifications: Incubation was performed at 30°C for 20 min  followed by resuspension in 1× Hanks’ balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell 3’ GEM  Library & Gel Bead Kit v3.1  16 rxns PN 1000121.,,tissue:cardiac ventricles|cell type:ventricular cells|genotype:myd88+/+|treatment:cardiac cryoinjury,GSM8161053,GSM8161053: ventricular cells  myd88+/+  24 hpci; Danio rerio; RNA Seq,GSM8161053 r1,GSM8161053,1,Ventricular cells were isolated from a pool of 4 myd88+/+ and 4 myd88 /  ventricles for the myd88+/+ and myd88 /  sample  respectively. Cell isolation was performed with the Pierce Primary Cardiomyocyte Isolation Kit Thermo Fisher Scientific following the manufacturer's instructions and with the following modifications: Incubation was performed at 30°C for 20 min  followed by resuspension in 1× Hanks' balanced salt solution Gibco with 0.25% BSA. Suspended cells were sorted using FACSAriaIII sorter BD to exclude dead cells using DAPI Sigma. Library preparation was conducted according to the manufacturer indications Chromium Next GEM Single Cell three prime GEM  Library & Gel Bead Kit v3.1  16 rxns PN 1000121.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP497294,,,Pinelopi_10x_Zebrafish_WT_Lib_R1.fastq.gz Pinelopi_10x_Zebrafish_WT_Lib_R2.fastq.gz,fastq fastq,40672259373.0,511650018.0,GSM8161053 r1,0:28 1:51.49,A:11079272327;C:8809520398;G:9307205642;T:11269370263;N:206890743,28,51,,,11079272327,8809520398,9307205642,11269370263,206890743,SRX24027915,SRS20821687,SRA1832827,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,sc-like readlen,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-03-22,Cleavage,Embryo,Heart,Cardiovascular System
32609,SRR29325925,SRX24842084,SRS21553259,SRP512516,PRJNA1121299,"Gene expression profile of single endocardial cells in 48 hpf and 72 hpf zebrafish embryos/larvae. In the study ""The heart is a niche for hematopoietic stem and progenitor cells in zebrafish.""",GSE269378,Transcriptome Analysis,We used single cell RNA expression to uncover the cellular and molecular heterogeneity of isolated endocardial cells in the heart. From this study  we uncovered the presence of an endocardial hematopoietic cluster  along with other significant clusters including valve endocardial and interstitial cells  and non valve cells. Overall design: Endocardial cells were isolated using FACS from physically extracted Tgkdrl:nls mCherry and Tgcd41:GFP hearts according to presence of mCherry positive cells  and further analyzed using scRNAseq.,,pubmed:39217144,,EC 2d,GSM8314110,,source name:Heart|tissue:Heart|cell type:Endocardial cells|genotype:Tgkdrl:nls mCherry; Tgcd41:GFP|developmental stage:48 hpf loc name:missing|collection date:missing,EC 2d,Sequencing was done on Nextseq2000 and raw reads were aligned against the zebrafish genome DanRer11 and counted by StarSolo Preprocessed counts were further analysed using Scanpy ollowed by secondary analysis in Annotated Data Format. Preprocessed counts were further analyzed using Scanpy. Basic cell quality control was conducted by taking the number of detected genes and mitochondrial content into consideration. We removed 5 cells in total that did not express more than 300 genes or had a mitochondrial content greater than 5%. Furthermore  we filtered 24259 genes if they were detected in less than 30 cells <0.01%. Raw counts per cell were normalized to the median count over all cells and transformed into log space to stabilize variance. We initially reduced dimensionality of the dataset using PCA  retaining 50 principal components. Subsequent steps  like low dimensional UMAP embedding McInnes & Healy  https://arxiv.org/abs/1802.03426 and cell clustering via community detection  were based on the initial PCA. Final data visualization was done by scanpy and cellxgene packages. Assembly: danRer11 Supplementary files format and content: starsolo outputs,Heart,,Embryos were raised in a solution composed of 0.33 Danieau's medium  containing the following concentrations: 17.4 mM NaCl  0.21 mM KCl  0.12 mM MgSO4·H2O  and 0.18 mM CaNO32  while being maintained at a stable temperature of 28°C. To isolate EdCs for the single cell RNA sequencing experiment  hearts from 48  and 72 hpf Tgkdrl:nls mCherry; Tgcd41:GFP larvae were manually dissected in DMEM + 10% FBS.   Hearts were then centrifuged for 60 seconds at 3000 rpm  washed with 1 mL Hanks’ Balanced Salt Solution and dissociated into single cells by incubating in 100 μl Enzyme 1 and 5 μl Enzyme 2 Pierce Cardiomyocyte Dissociation Kit  Thermo Fisher Scientific  Cat#88281 for 20 minutes at 300 rpm in a 30°C shaker 79.  The samples were centrifuged for 5 minutes at 3000 rpm  the supernatant was discarded  and fresh medium was added to the dissociated cells and passed through 40 μM filter polystyrene 5ml tubes.  Negative controls of non fluorescent hearts or single color fluorescent hearts were prepared to define the sorting gates.  Cells were sorted using the BD FACSAria™ III BD Biosciences instrument.   Live cells were selected by exclusion of DAPI using 30mW 405nm excitation paired with 450/50 nm band pass filter.  The software used for sorting and analysis is BD FACSDiva v8.0.1.  Single positive Tgkdrl:nls mCherry+ cells and double positive Tgkdrl:nls mCherry+; Tgcd41:GFP+ cells were sorted and collected into tubes with DMEM + 10% FBS.  Cells from both collected samples were immediately combined and processed for the single cell RNA sequencing.  mCherry fluorescence was measured with 50mW 561nm excitation paired with 610/20nm band pass filter. GFP fluorescence was measured with 50mW 488nm excitation paired with 530/30 band pass filter. The cell suspensions were counted with Moxi cell counter and diluted according to manufacturer’s protocol to obtain 4.000 2d HC and 8.000 3d  10.497 EC  1.569 HC single cell data points per sample  respectively. Each sample was run separately on a lane in Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3.1 10xGenomics. Library preparation was conducted according to the manufacturer indications.,Embryos/larvae were grown in 28 degree incubator until extraction at 48 or 72 hpf,tissue:Heart|cell type:Endocardial cells|genotype:Tgkdrl:nls mCherry; Tgcd41:GFP|developmental stage:48 hpf,GSM8314110,GSM8314110: EC 2d; Danio rerio; RNA Seq,GSM8314110 r1,GSM8314110,1,Embryos were raised in a solution composed of 0.33 Danieau's medium  containing the following concentrations: 17.4 mM NaCl  0.21 mM KCl  0.12 mM MgSO4·H2O  and 0.18 mM CaNO32  while being maintained at a stable temperature of 28°C. To isolate EdCs for the single cell RNA sequencing experiment  hearts from 48  and 72 hpf Tgkdrl:nls mCherry; Tgcd41:GFP larvae were manually dissected in DMEM + 10% FBS.   Hearts were then centrifuged for 60 seconds at 3000 rpm  washed with 1 mL Hanks' Balanced Salt Solution and dissociated into single cells by incubating in 100 μl Enzyme 1 and 5 μl Enzyme 2 Pierce Cardiomyocyte Dissociation Kit  Thermo Fisher Scientific  Cat#88281 for 20 minutes at 300 rpm in a 30°C shaker 79.  The samples were centrifuged for 5 minutes at 3000 rpm  the supernatant was discarded  and fresh medium was added to the dissociated cells and passed through 40 μM filter polystyrene 5ml tubes.  Negative controls of non fluorescent hearts or single color fluorescent hearts were prepared to define the sorting gates.  Cells were sorted using the BD FACSAria™ III BD Biosciences instrument.   Live cells were selected by exclusion of DAPI using 30mW 405nm excitation paired with 450/50 nm band pass filter.  The software used for sorting and analysis is BD FACSDiva v8.0.1.  Single positive Tgkdrl:nls mCherry+ cells and double positive Tgkdrl:nls mCherry+; Tgcd41:GFP+ cells were sorted and collected into tubes with DMEM + 10% FBS.  Cells from both collected samples were immediately combined and processed for the single cell RNA sequencing.  mCherry fluorescence was measured with 50mW 561nm excitation paired with 610/20nm band pass filter. GFP fluorescence was measured with 50mW 488nm excitation paired with 530/30 band pass filter. The cell suspensions were counted with Moxi cell counter and diluted according to manufacturer's protocol to obtain 4.000 2d HC and 8.000 3d  10.497 EC  1.569 HC single cell data points per sample  respectively. Each sample was run separately on a lane in Chromium controller with Chromium Next GEM Single Cell 3ʹ Reagent Kits v3.1 10xGenomics. Library preparation was conducted according to the manufacturer indications.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,cDNA,PAIRED,ILLUMINA,NextSeq 2000,,SRP512516,,,Felix_10x_Lib_EC-2d_R1.fastq.gz Felix_10x_Lib_EC-2d_R2.fastq.gz,fastq fastq,37849382027.0,476135961.0,GSM8314110 r1,0:28 1:51.49,A:10212120425;C:8162504214;G:8573129268;T:10704929378;N:196698742,28,51,,,10212120425,8162504214,8573129268,10704929378,196698742,SRX24842084,SRS21553259,SRA1892449,MPI for heart and lung research,MPI for heart and lung research,,,,,,,,,,,,T,B,mate1 technical by mapping diff,illumina,nextseq_v2,unknown,cdna_unspecified,unknown,sc,single_cell_droplet,10x,,Germany,2024-06-07,Hatching,Embryo,Heart,Cardiovascular System
33805,SRR30670312,SRX26088984,SRS22655387,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,DKOwBF 4,GSM8516797,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing,DKOwBF 4,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62,GSM8516797,GSM8516797: DKOwBF 4; Danio rerio; RNA Seq,GSM8516797 r1,GSM8516797,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,DKOwBF_4_R1_val_1.fq.gz DKOwBF_4_R2_val_2.fq.gz,fastq fastq,2631656843.0,35135298.0,GSM8516797 r1,0:37.47 1:37.43,A:693207862;C:610024232;G:611701090;T:716593105;N:130554,37,37,,,693207862,610024232,611701090,716593105,130554,SRX26088984,SRS22655387,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33806,SRR30670313,SRX26088983,SRS22655386,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,DKOwBF 3,GSM8516796,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing,DKOwBF 3,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62,GSM8516796,GSM8516796: DKOwBF 3; Danio rerio; RNA Seq,GSM8516796 r1,GSM8516796,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,DKOwBF_3_R1_val_1.fq.gz DKOwBF_3_R2_val_2.fq.gz,fastq fastq,2307127989.0,30809808.0,GSM8516796 r1,0:37.48 1:37.40,A:604817176;C:534788281;G:546273175;T:621136766;N:112591,37,37,,,604817176,534788281,546273175,621136766,112591,SRX26088983,SRS22655386,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33807,SRR30670314,SRX26088982,SRS22655385,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,DKOwBF 2,GSM8516795,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing,DKOwBF 2,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62,GSM8516795,GSM8516795: DKOwBF 2; Danio rerio; RNA Seq,GSM8516795 r1,GSM8516795,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,DKOwBF_2_R1_val_1.fq.gz DKOwBF_2_R2_val_2.fq.gz,fastq fastq,2359951661.0,31500054.0,GSM8516795 r1,0:37.48 1:37.44,A:616053500;C:552042916;G:552098980;T:639639620;N:116645,37,37,,,616053500,552042916,552098980,639639620,116645,SRX26088982,SRS22655385,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33808,SRR30670315,SRX26088981,SRS22655384,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,DKOwBF 1,GSM8516794,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62|geo loc name:missing|collection date:missing,DKOwBF 1,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201;cbx7apbb62,GSM8516794,GSM8516794: DKOwBF 1; Danio rerio; RNA Seq,GSM8516794 r1,GSM8516794,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,DKOwBF_1_R1_val_1.fq.gz DKOwBF_1_R2_val_2.fq.gz,fastq fastq,2279765098.0,30432486.0,GSM8516794 r1,0:37.48 1:37.43,A:593961620;C:534035377;G:534433858;T:617220513;N:113730,37,37,,,593961620,534035377,534433858,617220513,113730,SRX26088981,SRS22655384,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33809,SRR30670316,SRX26088980,SRS22655383,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,ccm2 4,GSM8516793,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing,ccm2 4,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201,GSM8516793,GSM8516793: ccm2 4; Danio rerio; RNA Seq,GSM8516793 r1,GSM8516793,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,ccm2_4_R1_val_1.fq.gz ccm2_4_R2_val_2.fq.gz,fastq fastq,1774723235.0,23698743.0,GSM8516793 r1,0:37.48 1:37.40,A:458133535;C:421770768;G:424339889;T:470391262;N:87781,37,37,,,458133535,421770768,424339889,470391262,87781,SRX26088980,SRS22655383,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33810,SRR30670317,SRX26088979,SRS22655382,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,ccm2 3,GSM8516792,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing,ccm2 3,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201,GSM8516792,GSM8516792: ccm2 3; Danio rerio; RNA Seq,GSM8516792 r1,GSM8516792,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,ccm2_3_R1_val_1.fq.gz ccm2_3_R2_val_2.fq.gz,fastq fastq,2785670574.0,37207625.0,GSM8516792 r1,0:37.47 1:37.39,A:733595813;C:647190941;G:651896211;T:752851756;N:135853,37,37,,,733595813,647190941,651896211,752851756,135853,SRX26088979,SRS22655382,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33811,SRR30670318,SRX26088978,SRS22655381,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,ccm2 2,GSM8516791,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing,ccm2 2,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201,GSM8516791,GSM8516791: ccm2 2; Danio rerio; RNA Seq,GSM8516791 r1,GSM8516791,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,ccm2_2_R1_val_1.fq.gz ccm2_2_R2_val_2.fq.gz,fastq fastq,1710862794.0,22847832.0,GSM8516791 r1,0:37.48 1:37.40,A:451866074;C:396308875;G:397143039;T:465461428;N:83378,37,37,,,451866074,396308875,397143039,465461428,83378,SRX26088978,SRS22655381,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33812,SRR30670319,SRX26088977,SRS22655380,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,ccm2 1,GSM8516790,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201|geo loc name:missing|collection date:missing,ccm2 1,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:ccm2m201,GSM8516790,GSM8516790: ccm2 1; Danio rerio; RNA Seq,GSM8516790 r1,GSM8516790,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,ccm2_1_R1_val_1.fq.gz ccm2_1_R2_val_2.fq.gz,fastq fastq,2152186897.0,28739460.0,GSM8516790 r1,0:37.48 1:37.40,A:565328171;C:501524678;G:502042276;T:583186005;N:105767,37,37,,,565328171,501524678,502042276,583186005,105767,SRX26088977,SRS22655380,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33813,SRR30670320,SRX26088976,SRS22655379,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,wt 4,GSM8516789,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing,wt 4,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:wild type,GSM8516789,GSM8516789: wt 4; Danio rerio; RNA Seq,GSM8516789 r1,GSM8516789,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,wt_4_R1_val_1.fq.gz wt_4_R2_val_2.fq.gz,fastq fastq,2115730283.0,28251845.0,GSM8516789 r1,0:37.48 1:37.40,A:554039480;C:497170515;G:497588268;T:566828365;N:103655,37,37,,,554039480,497170515,497588268,566828365,103655,SRX26088976,SRS22655379,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33814,SRR30670321,SRX26088975,SRS22655378,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,wt 3,GSM8516788,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing,wt 3,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:wild type,GSM8516788,GSM8516788: wt 3; Danio rerio; RNA Seq,GSM8516788 r1,GSM8516788,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,wt_3_R1_val_1.fq.gz wt_3_R2_val_2.fq.gz,fastq fastq,1222858943.0,16325477.0,GSM8516788 r1,0:37.47 1:37.44,A:319777234;C:285362000;G:288524099;T:329135216;N:60394,37,37,,,319777234,285362000,288524099,329135216,60394,SRX26088975,SRS22655378,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33815,SRR30670322,SRX26088974,SRS22655377,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,wt 2,GSM8516787,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing,wt 2,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:wild type,GSM8516787,GSM8516787: wt 2; Danio rerio; RNA Seq,GSM8516787 r1,GSM8516787,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,wt_2_R1_val_1.fq.gz wt_2_R2_val_2.fq.gz,fastq fastq,2264925518.0,30237170.0,GSM8516787 r1,0:37.48 1:37.43,A:593545435;C:529227225;G:529813966;T:612227538;N:111354,37,37,,,593545435,529227225,529813966,612227538,111354,SRX26088974,SRS22655377,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
33816,SRR30670323,SRX26088973,SRS22655376,SRP532815,PRJNA1161406,Epigenetic regulation by Polycomb Repressive Complex 1 promotes Cerebral Cavernous Malformations,GSE277234,Transcriptome Analysis,Cerebral cavernous malformations CCMs are anomalies that develop mainly in the cerebral vasculature. They result from mutations in CCM1/KRIT1  CCM2  or CCM3/PDCD10. Loss of CCM proteins triggers a MAPK Krüppel like factor 2 KLF2 signaling cascade  which induces a pathophysiological pattern of gene expression within endothelial cells. The downstream target genes that are activated by KLF2 are mostly unknown. Here we show that Chromobox Protein Homolog 7 CBX7  component of the Polycomb Repressive Complex 1  contributes to pathophysiological KLF2 signaling during zebrafish cardiovascular development. CBX7/cbx7a mRNA is strongly upregulated in lesions of CCM patients  and in human  mouse  and zebrafish CCM deficient endothelial cells. The silencing or pharmacological inhibition of CBX7/Cbx7a suppresses pathological CCM phenotypes in ccm2 zebrafish  CCM2 deficient HUVECs  and in a pre clinical murine CCM3 disease model. Whole transcriptome datasets from zebrafish cardiovascular tissues and human endothelial cells reveal that CBX7/Cbx7a plays a role in the activation of KLF2 targets including genes encoding TEK  Angiopoietin1  WNT9  and endoMT proteins. Our findings uncover an intricate interplay in the regulation of Klf2 dependent biomechanical signaling by CBX7 in CCM. This work also provides insights for therapeutic strategies in the pathogenesis of CCM. Overall design: In this experiment  we want to compare the RNA transcripts of different genetic background of zebrafish heart which is considerred as enriched endothelial tissue. We have pooled heart samples from 56 hpf 59 hpf hour zebrafish embryos with 3 conditions 4 groups: wildtype wt  ccm2 mutant ccm2  double knockout mutant DKOwBF. We prepared 4 biological samples for each group. Each sample consisting of 15 60 heart was RNA extracted  DNase treatment using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with NebNext Ultra II kit  with 30 ng of RNA as starting point.,,pubmed:39402138,,wt 1,GSM8516786,,source name:heart|tissue:heart|cell type:enriched endothelial cells|genotype:wild type|geo loc name:missing|collection date:missing,wt 1,base calling  alignment  filtering  peak calling  generation of normalized counts has been done by staff of sequecing facility using usegalaxy.eu platform Assembly: GRCz10 Supplementary files format and content: bigwig file includes raw count for each sample,heart,,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,2 dpf zebrafish embryo,tissue:heart|cell type:enriched endothelial cells|genotype:wild type,GSM8516786,GSM8516786: wt 1; Danio rerio; RNA Seq,GSM8516786 r1,GSM8516786,1,RNA extraction  DNase treatment was done using Zymo Quick RNA Microprep Kit. RNA later was checked integrity and concentration by D1000 Agilent ScreenTape. Samples with RIN values ranged from 7.2 9.3 were further librarized with 30ng of RNA as starting point. RNA library was prepared using NebNext Ultra II kit following manufacturer's protocol,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 550,,SRP532815,,,wt_1_R1_val_1.fq.gz wt_1_R2_val_2.fq.gz,fastq fastq,2171991020.0,29008519.0,GSM8516786 r1,0:37.49 1:37.39,A:564449762;C:511917485;G:512535386;T:582980181;N:108206,37,37,,,564449762,511917485,512535386,582980181,108206,SRX26088973,SRS22655376,SRA1972600,University of Potsdam,University of Potsdam,,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,full_length,random_priming,nebnext,bulk,unknown,unknown,,Germany,2024-09-15,Hatching,Embryo,Heart,Cardiovascular System
36641,SRR700539,SRX233125,SRS393099,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq15,GSM1081113,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,Seq15,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,GSM1081113,GSM1081113: Seq15; Danio rerio; RNA Seq,GSM1081113 1,,1,,GEO Accession:GSM1081113,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP018538,,,,,1505008521.0,29509971.0,GSM1081113 r1,0:51,A:394410844;C:370013758;G:356489603;T:384055071;N:39245,51,,,,394410844,370013758,356489603,384055071,39245,SRX233125,SRS393099,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.9123,,0.07373,,0.71346,,0.47555,,51,,B,,usable mapping rate,illumina,hiseq_era,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36642,SRR700538,SRX233124,SRS393098,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq14,GSM1081112,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,Seq14,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,GSM1081112,GSM1081112: Seq14; Danio rerio; RNA Seq,GSM1081112 1,,1,,GEO Accession:GSM1081112,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP018538,,,seq14.txt.gz,fastq,3144425502.0,61655402.0,GSM1081112 r1,0:51,A:825172912;C:756354008;G:742919584;T:819897573;N:81425,51,,,,825172912,756354008,742919584,819897573,81425,SRX233124,SRS393098,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.93659,,0.0806,,0.73716,,0.47614,,51,,B,,usable mapping rate,illumina,hiseq_era,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36643,SRR700537,SRX233123,SRS393097,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq11,GSM1081111,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,Seq11,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Gata4 morphant,GSM1081111,GSM1081111: Seq11; Danio rerio; RNA Seq,GSM1081111 1,,1,,GEO Accession:GSM1081111,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP018538,,,,,1364181264.0,37893924.0,GSM1081111 r1,0:36,A:362442341;C:297159061;G:406723961;T:297355968;N:499933,36,,,,362442341,297159061,406723961,297355968,499933,SRX233123,SRS393097,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.67174,,0.07612,,0.74416,,0.48016,,36,,B,,usable mapping rate,illumina,early_illumina,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36644,SRR700536,SRX233122,SRS393096,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq13,GSM1081110,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,Seq13,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,GSM1081110,GSM1081110: Seq13; Danio rerio; RNA Seq,GSM1081110 1,,1,,GEO Accession:GSM1081110,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP018538,,,seq13.txt.gz,fastq,1693675269.0,33209319.0,GSM1081110 r1,0:51,A:443719209;C:411369010;G:404182982;T:434361031;N:43037,51,,,,443719209,411369010,404182982,434361031,43037,SRX233122,SRS393096,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.91781,,0.08107,,0.74976,,0.46528,,51,,B,,usable mapping rate,illumina,hiseq_era,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36645,SRR700535,SRX233121,SRS393095,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq5,GSM1081109,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,Seq5,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,GSM1081109,GSM1081109: Seq5; Danio rerio; RNA Seq,GSM1081109 1,,1,,GEO Accession:GSM1081109,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP018538,,,seq5.txt.gz,fastq,1245644280.0,34601230.0,GSM1081109 r1,0:36,A:334131135;C:287707996;G:288492153;T:334895459;N:417537,36,,,,334131135,287707996,288492153,334895459,417537,SRX233121,SRS393095,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.89495,,0.1058,,0.74247,,0.46422,,36,,B,,usable mapping rate,illumina,early_illumina,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
36646,SRR700534,SRX233120,SRS393094,SRP018538,PRJNA189226,Comparison of cardiomyocyte transcripts post knockdown of Gata4 in zebrafish embryos,GSE44233,Transcriptome Analysis,The Gata4 transcription factor is essential for normal heart development  but the molecular basis for its function remain poorly understood.  We profiled at the whole genome level transcript changes in cardiomyocytes when Gata4 is depleted from zebrafish embryos.  Our objective was to elucidate the cardiomyocyte specific molecular program functioning downstream of Gata4 in order to better understand the role of Gata4 in cardiac morphogenesis. Overall design: Six samples in total are deposited.  Three replicate control samples and three replicate Gata4 morphant samples were analyzed.,,pubmed:23850773,,Seq1,GSM1081108,,tissue:sorted cardiomyocytes|developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,Seq1,Basecalls  demultiplexing  and filtering of reads was  performed using Casava 1.7.0. Read alignment was performed with the BWA alignment algorithm with native goby support using gobyweb  version: development 20110921150240 with the following parameters: Ambiguity threshold = 1  Max Number Gap Opens = 1  Max Number Gap Extensions =  1. Differential expression was generated with the DESEQ package with native goby support using gobyweb  version: development 20110921150240 with the following parameters: q value threshold = 1.0  weight adjustment = none  Gene counts box checked. Data were filtered according to geneID's demonstrating a p adjusted < 0.1  a log2 fold change > 1 for WT/G4  and Average RPKM in the comparison group > 1. Genome build: Zv9.61 Supplementary files format and content: Wig files were generated using gobyweb  version: development20110921150240.  Additional supplementary .xlsx file containing RPKM  counts  and statistical values was exported from gobyweb and processed in excel.,sorted cardiomyocytes,Embryos were injected with morpholino before the 4 cell stage of development.  2nl of a 0.7mM concentration of Gata4 morpholino five prime TCCACAGGTGAGCGATTATTGCTTC three prime were injected per individual embryo.  At 24 hpf  batches of approximately 200 embryos were pooled into 1.5 ml tube.  Embryos were dissociated by manual agitation with a pellet pestle Fisher and trypsinized with pre heated TrypLE Life Technologies at 32C for 15 min on a rotator. Trypsinized samples were pipetted through a 35um cell strainer into a 5ml tube  trypsin inhibited by addition of 4ml FACS buffer L 15 medium supplemented with 1% heat inactivated FCS  0.8mM CaCl2  50U/ml penicillin  and 0.05 mg/ml streptomycin followed by addition of FCS to 7.5% final concentration. Cells were pelleted at 300 RCF for 5 min and then washed with FACS buffer. Dissociated embryonic cells were resuspended at 7.5x106 cells/ml in FACS buffer. FACS was performed on a Vantage cell sorter BD into Trizol LS Life Technologies  and stored at  80C until RNA isolation.,RNA was isolated by Trizol except that post addition of 1.5 volumes of 100% ethanol to the aqueous phase  the solution was transferred to an RNeasy minElute column Qiagen.  On column DNase digestion  subsequent washing  and RNA elution was performed according to the Qiagen's recommended protocol for RNeasy micro kit. 100ng of total RNA was used to prepare the libraries.  Libraries were prepared for RNA sequencing using the mRNA Seq seq1  seq5  and seq11 or TruSeq Kit seq13  seq14  and seq15 according to the Illumina's recommended protocol.,Embryos were grown in 1x E3 buffer for 24 hours at 28.5 degrees Celsius in petri dishes.  25 ml of E3 buffer was used per 50 60 embryos in each dish.,developmental stage:24hpf|transgenic line:tgmyl7::gfp|experimental group:Wildtype,GSM1081108,GSM1081108: Seq1; Danio rerio; RNA Seq,GSM1081108 1,,1,,GEO Accession:GSM1081108,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,,SRP018538,,,seq1.txt.gz,fastq,929284704.0,25813464.0,GSM1081108 r1,0:36,A:244730361;C:220466820;G:213037296;T:250386569;N:663658,36,,,,244730361,220466820,213037296,250386569,663658,SRX233120,SRS393094,SRA066447,GEO,"Todd Evans Lab, Cell and Developmental Biology, Weill Cornell",1,0.87436,,0.11629,,0.73302,,0.46999,,36,,B,,usable mapping rate,illumina,early_illumina,full_length,random_priming,trueseq,bulk,bulk,bulk,,United States,2013-02-11,Pharyngula,Embryo,Heart,Cardiovascular System
37255,SRR1043688,SRX387598,SRS511498,SRP033532,PRJNA230686,Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae,GSE53022,Transcriptome Analysis,We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.,,pubmed:24430697,,kctd10 mut zebrafish heart,GSM1280516,,source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:kctd10  /  kctd10 mutant|tissue:heart,kctd10 mut zebrafish heart,sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat  with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant.,heart,,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen  purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,,strain background:AB|development stage:48 hpf|genotype/variation:kctd10  /  kctd10 mutant|tissue:heart,GSM1280516,GSM1280516: kctd10 mut zebrafish heart; Danio rerio; RNA Seq,GSM1280516,,1,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen  purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,GEO Accession:GSM1280516,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033532,,,s_8_1_1101_qseq.txt.gz,Illumina native,159161750.0,3183235.0,GSM1280516 r1,0:50,A:40560849;C:38239286;G:38051715;T:41572492;N:737408,50,,,,40560849,38239286,38051715,41572492,737408,SRX387598,SRS511498,SRA115339,GEO,"College of Life Sciences, Peking University",1,0.93678,,0.06225,,0.68834,,0.44699,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2013-12-05,Hatching,Embryo,Heart,Cardiovascular System
37256,SRR1104059,SRX387598,SRS511498,SRP033532,PRJNA230686,Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae,GSE53022,Transcriptome Analysis,We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.,,pubmed:24430697,,kctd10 mut zebrafish heart,GSM1280516,,source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:kctd10  /  kctd10 mutant|tissue:heart,kctd10 mut zebrafish heart,sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat  with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant.,heart,,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen  purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,,strain background:AB|development stage:48 hpf|genotype/variation:kctd10  /  kctd10 mutant|tissue:heart,GSM1280516,GSM1280516: kctd10 mut zebrafish heart; Danio rerio; RNA Seq,GSM1280516,,1,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen  purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,GEO Accession:GSM1280516,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033532,,,,,10053590150.0,201071803.0,GSM1280516 r2,0:50,A:2588651143;C:2370219438;G:2396055158;T:2650913003;N:47751408,50,,,,2588651143,2370219438,2396055158,2650913003,47751408,SRX387598,SRS511498,SRA115339,GEO,"College of Life Sciences, Peking University",1,0.92227,,0.06457,,0.69367,,0.45203,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2013-12-05,Hatching,Embryo,Heart,Cardiovascular System
37257,SRR1043687,SRX387597,SRS511497,SRP033532,PRJNA230686,Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae,GSE53022,Transcriptome Analysis,We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.,,pubmed:24430697,,wt zebrafish heart,GSM1280515,,source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart,wt zebrafish heart,sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat  with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant.,heart,,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen  purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,,strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart,GSM1280515,GSM1280515: wt zebrafish heart; Danio rerio; RNA Seq,GSM1280515,,1,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen  purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,GEO Accession:GSM1280515,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033532,,,s_6_1_1101_qseq.txt.gz,Illumina native,155968450.0,3119369.0,GSM1280515 r1,0:50,A:40015379;C:37108086;G:37319547;T:41209982;N:315456,50,,,,40015379,37108086,37319547,41209982,315456,SRX387597,SRS511497,SRA115339,GEO,"College of Life Sciences, Peking University",1,0.92288,,0.06296,,0.69209,,0.4533,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2013-12-05,Hatching,Embryo,Heart,Cardiovascular System
37258,SRR1104058,SRX387597,SRS511497,SRP033532,PRJNA230686,Expression profiling in the heart of wild type and kctd10 mutant zebrafish larvae,GSE53022,Transcriptome Analysis,We sequenced mRNA of hearts from 50 wild type and 50 kctd10 mutant embryos at 48 hpf. Overall design: Examination of mRNA levels in the larvae hearts between the the wt and the kctd10 mutant.,,pubmed:24430697,,wt zebrafish heart,GSM1280515,,source name:heart|strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart,wt zebrafish heart,sequenced by the Illumina Hiseq 2000 platform Around 200 million 50 bp single end reads were obtained per sample. Reads were aligned to zebrafish genome Zv9 using tophat  with up to 2 mismatches allowed. Differential expression analysis was performed using DESeq. Genome build: zebrafish genome Zv9 Supplementary files format and content: excel file of relative gene expression level between the wt and the kctd10 mutant. Supplementary files format and content: tab delimited txt files of gene raw counts and DESeq processed relative gene expression level between the wt and the kctd10 mutant.,heart,,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen  purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,,strain background:AB|development stage:48 hpf|genotype/variation:wt wild type|tissue:heart,GSM1280515,GSM1280515: wt zebrafish heart; Danio rerio; RNA Seq,GSM1280515,,1,Total RNAs from wild type and kctd10 mutant fish hearts were isolated with RNeasy Mini Kit Qiagen  purified with RNeasy columns QIAGEN. Next generation sequencing libraries were prepared with the Illumina TruSeq preparation kit Illumina according to manufacturer's protocol,GEO Accession:GSM1280515,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP033532,,,,,10404769750.0,208095395.0,GSM1280515 r2,0:50,A:2661715782;C:2489013308;G:2484808257;T:2727159333;N:42073070,50,,,,2661715782,2489013308,2484808257,2727159333,42073070,SRX387597,SRS511497,SRA115339,GEO,"College of Life Sciences, Peking University",1,0.93515,,0.0656,,0.68986,,0.45312,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2013-12-05,Hatching,Embryo,Heart,Cardiovascular System
37991,SRR1265766,SRX529160,SRS598857,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish  substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain  gut  liver  ovary  testis  eye  heart and embryo of zebrafish.  In brain  gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs  with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2  we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0%  with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs  respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further  we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as  a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling  novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Heart Replicate 3 sRNAseq,GSM1376649,,source name:Heart|tissue:Heart|genetic background:Wild type   Singapore strain,Heart Replicate 3 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database  finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl  p <zebrafish precursor miRNA fasta file>  m <zebrafish mature miRNA fasta file>  r <unique reads fasta file>  t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Heart,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,tissue:Heart|genetic background:Wild type   Singapore strain,GSM1376649,GSM1376649: Heart Replicate 3 sRNAseq; Danio rerio; miRNA Seq,GSM1376649,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376649,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZH008_GATCAG_L005_R1.fastq.gz,fastq,4401229692.0,57910917.0,GSM1376649 r1,0:76,A:1009381958;C:1130057881;G:1173217392;T:1088123982;N:448479,76,,,,1009381958,1130057881,1173217392,1088123982,448479,SRX529160,SRS598857,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00129,,0.00046,,0.99882,,0.51351,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Heart,Cardiovascular System
37992,SRR1265765,SRX529159,SRS598856,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish  substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain  gut  liver  ovary  testis  eye  heart and embryo of zebrafish.  In brain  gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs  with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2  we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0%  with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs  respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further  we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as  a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling  novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Heart Replicate 2 sRNAseq,GSM1376648,,source name:Heart|tissue:Heart|genetic background:Wild type   Singapore strain,Heart Replicate 2 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database  finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl  p <zebrafish precursor miRNA fasta file>  m <zebrafish mature miRNA fasta file>  r <unique reads fasta file>  t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Heart,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,tissue:Heart|genetic background:Wild type   Singapore strain,GSM1376648,GSM1376648: Heart Replicate 2 sRNAseq; Danio rerio; miRNA Seq,GSM1376648,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376648,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZH007_ACTTGA_L005_R1.fastq.gz,fastq,3202357508.0,42136283.0,GSM1376648 r1,0:76,A:666309720;C:845347679;G:846066601;T:844306103;N:327405,76,,,,666309720,845347679,846066601,844306103,327405,SRX529159,SRS598856,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00042,,3e-05,,0.99924,,0.56521,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Heart,Cardiovascular System
37993,SRR1265764,SRX529158,SRS598855,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish  substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain  gut  liver  ovary  testis  eye  heart and embryo of zebrafish.  In brain  gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs  with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2  we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0%  with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs  respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further  we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as  a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling  novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Heart Replicate 1 sRNAseq,GSM1376647,,source name:Heart|tissue:Heart|genetic background:Wild type   Singapore strain,Heart Replicate 1 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database  finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl  p <zebrafish precursor miRNA fasta file>  m <zebrafish mature miRNA fasta file>  r <unique reads fasta file>  t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Heart,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,tissue:Heart|genetic background:Wild type   Singapore strain,GSM1376647,GSM1376647: Heart Replicate 1 sRNAseq; Danio rerio; miRNA Seq,GSM1376647,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560  Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the  mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using  TruSeq Small RNA Sample Preparation Kit  RS 200 0012  Illumina  Inc.. Libraries were prepared according to manufacturer instructions. Briefly  1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376647,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZH002_CAGATC_L005_R1.fastq.gz,fastq,3777814232.0,49708082.0,GSM1376647 r1,0:76,A:791204432;C:1050679958;G:1001897360;T:933655799;N:376683,76,,,,791204432,1050679958,1001897360,933655799,376683,SRX529158,SRS598855,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00034,,4e-05,,0.99943,,0.62264,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Heart,Cardiovascular System
40737,SRR3290613,SRX1660379,SRS1360338,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts  the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,56hpf con3 ESD 21 N1,GSM2098629,,source name:heart|line:AB|tissue:heart|developmental stage:56hpf,56hpf con3 ESD 21 N1,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of  Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected  staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:56hpf,GSM2098629,GSM2098629: 56hpf con3 ESD 21 N1; Danio rerio; RNA Seq,GSM2098629,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098629,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-21_N1.fastq.gz,fastq,2561571150.0,51231423.0,GSM2098629 r1,0:50,A:738531563;C:525473156;G:523941846;T:773278863;N:345722,50,,,,738531563,525473156,523941846,773278863,345722,SRX1660379,SRS1360338,SRA395278,GEO,IGBMC,1,0.90421,,0.28766,,0.74312,,0.52751,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System
40738,SRR3290612,SRX1660378,SRS1360339,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts  the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,56hpf con2 ESD 20 N8,GSM2098628,,source name:heart|line:AB|tissue:heart|developmental stage:56hpf,56hpf con2 ESD 20 N8,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of  Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected  staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:56hpf,GSM2098628,GSM2098628: 56hpf con2 ESD 20 N8; Danio rerio; RNA Seq,GSM2098628,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098628,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-20_N8.fastq.gz,fastq,2243358450.0,44867169.0,GSM2098628 r1,0:50,A:653175386;C:451218310;G:450082444;T:688620234;N:262076,50,,,,653175386,451218310,450082444,688620234,262076,SRX1660378,SRS1360339,SRA395278,GEO,IGBMC,1,0.90525,,0.27718,,0.74915,,0.53438,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System
40739,SRR3290611,SRX1660377,SRS1360340,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts  the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,56hpf con1 ESD 19 N6,GSM2098627,,source name:heart|line:AB|tissue:heart|developmental stage:56hpf,56hpf con1 ESD 19 N6,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of  Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected  staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:56hpf,GSM2098627,GSM2098627: 56hpf con1 ESD 19 N6; Danio rerio; RNA Seq,GSM2098627,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098627,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-19_N6.fastq.gz,fastq,2100229600.0,42004592.0,GSM2098627 r1,0:50,A:601981170;C:436442080;G:439494399;T:622070663;N:241288,50,,,,601981170,436442080,439494399,622070663,241288,SRX1660377,SRS1360340,SRA395278,GEO,IGBMC,1,0.87598,,0.32196,,0.74146,,0.58008,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System
40740,SRR3290610,SRX1660376,SRS1360341,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts  the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,48hpf con3 ESD 15 N5,GSM2098626,,source name:heart|line:AB|tissue:heart|developmental stage:48hpf,48hpf con3 ESD 15 N5,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of  Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected  staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:48hpf,GSM2098626,GSM2098626: 48hpf con3 ESD 15 N5; Danio rerio; RNA Seq,GSM2098626,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098626,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-15_N5.fastq.gz,fastq,1677511000.0,33550220.0,GSM2098626 r1,0:50,A:515769850;C:312578723;G:314926898;T:534106645;N:128884,50,,,,515769850,312578723,314926898,534106645,128884,SRX1660376,SRS1360341,SRA395278,GEO,IGBMC,1,0.88227,,0.34705,,0.74905,,0.40306,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System
40741,SRR3290609,SRX1660375,SRS1360342,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts  the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,48hpf con2 ESD 14 N3,GSM2098625,,source name:heart|line:AB|tissue:heart|developmental stage:48hpf,48hpf con2 ESD 14 N3,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of  Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected  staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:48hpf,GSM2098625,GSM2098625: 48hpf con2 ESD 14 N3; Danio rerio; RNA Seq,GSM2098625,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098625,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-14_N3.fastq.gz,fastq,3262822450.0,65256449.0,GSM2098625 r1,0:50,A:1003248923;C:599408057;G:606959271;T:1052958480;N:247719,50,,,,1003248923,599408057,606959271,1052958480,247719,SRX1660375,SRS1360342,SRA395278,GEO,IGBMC,1,0.8699,,0.34134,,0.75848,,0.48365,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System
40742,SRR3290608,SRX1660374,SRS1360343,SRP072298,PRJNA316318,Analysis of gene expression during the early stages of zebrafish heart valve development,GSE79585,Transcriptome Analysis,We report changes in the levels of gene expression between 48hpf hearts and 56hpf hearts  the initial stages of valvulogenesis Overall design: 48hpf and 56hpf hearts were dissected and RNA was extracted. RNA profiles were then generated at each stage using Illumina deep sequencing,,pubmed:27221222,,48hpf con1 ESD 13 N1,GSM2098624,,source name:heart|line:AB|tissue:heart|developmental stage:48hpf,48hpf con1 ESD 13 N1,Image analysis and base calling were performed using RTA 1.17.21.3 and CASAVA 1.8.2. Reads were mapped onto the zv9 assembly of  Danio rerio genome using Tophat2.0.10 and bowtie 2 2.1.0. Quantification of gene expression has been performed using HTSeq 0.5.4p3. Normalization was performed using DESeq 1.10.1. Genome build: zv9 Supplementary files format and content: tabulated text file containing normalized read counts.,heart,,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,Embryos were collected  staged and grown under standard conditions,line:AB|tissue:heart|developmental stage:48hpf,GSM2098624,GSM2098624: 48hpf con1 ESD 13 N1; Danio rerio; RNA Seq,GSM2098624,,1,Dissected hearts were lysed and the RNA extracted using a Nucleospin XS kit from Machinery Nagel  according to the manufacturers instructions Amplified cDNA was prepared from 5 ng of total RNA using the Ovation RNA seq system V2 NuGEN Technologies  Inc. following manufacturer's instructions. Briefly  total RNA were reverse transcribed into first strand cDNA using a combination of random and poly T DNA/RNA chimeric SPIA primers. Priming sites created by a heating fragmentation of mRNA within the cDNA/mRNA complex were then used to synthesize the second strand cDNA using a DNA polymerase. The resulting double stranded cDNA with a unique RNA/DNA heteroduplex at one end were purified using Agencourt RNAClean XP beads Beckman Coulter Inc. and used  as substrate in the linear amplification process  SPIA single primer isothermal amplification. Amplified cDNA was purified using AMPure XP beads Beckman Coulter Inc. and 500 ng was fragmented by sonication using a Covaris E210 instrument with duty cycle: 10X  intensity: 5 and cycle/burst: 200 for 180 seconds. The next steps of RNA Seq Library preparation were performed on the Mondrian™ SP Workstation using Ovation® SP Ultralow Library Systems kit NuGEN Technologies  Inc. according to manufacturer's instructions. Briefly  100 ng of amplified cDNA were blunted  phosphorylated and ligated to indexed adapter dimers. The libraries were then enriched by PCR amplification 2 min at 72 degrees Celsius; [30 sec at 94 degrees Celsius  30 sec at 60 degrees Celsius  1 min at 72 degrees Celsius] x 8 cycles; 5 min at 72 degrees Celsius and surplus PCR primers were removed by purification using AMPure XP beads. DNA libraries were checked for quality using 2100 Bioanalyzer Agilent and quantified using Kapa Sybr Fast Light Cycler 480 qPCR Kit Kapa Biosystems according to manufacturer's recommendations. The libraries were loaded in the flow cell at 7pM concentration and sequenced in the Illumina Hiseq 2500 as single end 50 base reads following Illumina’s instructions.,GEO Accession:GSM2098624,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2500,,SRP072298,,,ESD-13_N1.fastq.gz,fastq,1560642600.0,31212852.0,GSM2098624 r1,0:50,A:451261879;C:320132595;G:321545848;T:467582692;N:119586,50,,,,451261879,320132595,321545848,467582692,119586,SRX1660374,SRS1360343,SRA395278,GEO,IGBMC,1,0.8654,,0.30695,,0.74286,,0.54249,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,random_priming,unknown,bulk,unknown,unknown,,France,2016-03-24,Hatching,Embryo,Heart,Cardiovascular System
41532,SRR5006039,SRX2337867,SRS1791085,SRP092952,PRJNA352869,The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome,GSE89670,Other,"Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types  as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies  we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed ""biotagging""  a versatile methodology that uses genetically encoded components to biotinylate target proteins  enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our ""biotagging"" toolkit  we demonstrate the specificity of our approach at the biochemical  cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus  we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity  embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that ""biotagging"" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.",,pubmed:28402863,,Myl7 RNASeq Nuclear 26hpf 2,GSM2386502,,source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse,Myl7 RNASeq Nuclear 26hpf 2,ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files,Myl7 RNASeq Nuclear 26hpf,,Nuclei isolation using biotin tagged outer nuclear envelope  adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein  adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker  following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al.  2013  adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module  NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre  directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.,,strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse,GSM2386502,GSM2386502: Myl7 RNASeq Nuclear 26hpf 2; Danio rerio; RNA Seq,GSM2386502,,1,Nuclei isolation using biotin tagged outer nuclear envelope  adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein  adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker  following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al.  2013  adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module  NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre  directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.,GEO Accession:GSM2386502,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP092952,,,Myl7_RNASeq_Nuclear_26hpf_2_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_2_R2.fastq.gz,fastq fastq,5163276312.0,50620356.0,GSM2386502 r1,0:51 1:51,A:1144341926;C:1402381884;G:1460666304;T:1155627236;N:258962,51,51,,,1144341926,1402381884,1460666304,1155627236,258962,SRX2337867,SRS1791085,SRA491940,GEO,"Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine",2,0.79148,0.79923,0.1676,0.16851,0.74501,0.74395,0.44104,0.45239,51,51,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2016-11-08,Pharyngula,Embryo,Heart,Cardiovascular System
41533,SRR5006038,SRX2337866,SRS1791086,SRP092952,PRJNA352869,The Biotagging toolkit for analysis of specific cell populations in zebrafish reveals gene regulatory logic encoded in the nuclear transcriptome,GSE89670,Other,"Interrogation of gene regulatory circuits in complex organisms requires precise tools for the selection of individual cell types  as well as robust methods for tissue specific labeling and biochemical profiling of target proteins. By exploiting multiple transgenesis strategies  we have developed a tissue specific binary in vivo biotinylation system in zebrafish termed ""biotagging""  a versatile methodology that uses genetically encoded components to biotinylate target proteins  enabling in depth genome wide analyses of their molecular interactions. Using tissue specific transgenic drivers and individual cell compartment effector lines from our ""biotagging"" toolkit  we demonstrate the specificity of our approach at the biochemical  cellular and transcriptional levels. By characterizing the in vivo transcriptional landscape of migratory neural crest and myocardial cells in two different cellular compartments ribosomes and nucleus  we identify a comprehensive network of protein coding and non coding RNAs and uncover cis regulatory modules and regulatory logic conferring cell specific identity  embedded in the complexity of the non coding nuclear transcriptomes. Our study demonstrates that ""biotagging"" eliminates background inherent to complex embryonic environments and allows analyses of molecular interactions in any cellular context at highest resolution. Overall design: Examination of RNA seq and ATAC seq using in vivo biotinylated nuclei and polysomes.",,pubmed:28402863,,Myl7 RNASeq Nuclear 26hpf 1,GSM2386501,,source name:Myl7 RNASeq Nuclear 26hpf|strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse,Myl7 RNASeq Nuclear 26hpf 1,ATAC seq reads were trimmed for quality using sickle v 1.33 and mapped using bowtie v.1.0.0. Smoothened bigWig files were generated using an enhanced Perl script courtesy of Jim Hughes. RNA seq reads were mapped using STAR v.2.4.2a. BAM files incorporating reads belonging to either DNA strand were generated using custom python script. Genome build: danRer7 Zv9 Supplementary files format and content: bigWig files,Myl7 RNASeq Nuclear 26hpf,,Nuclei isolation using biotin tagged outer nuclear envelope  adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein  adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker  following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al.  2013  adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module  NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre  directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.,,strain/background:AB/TU|tissue:myocardium|developmental stage:26hpf|assay:RNA seq stranded|cellular comp1nt:nuclear|ribodepleted:ribodepleted|isolation method:InVivoBiotinylatedNuclei|strand:reverse,GSM2386501,GSM2386501: Myl7 RNASeq Nuclear 26hpf 1; Danio rerio; RNA Seq,GSM2386501,,1,Nuclei isolation using biotin tagged outer nuclear envelope  adapted from INTACT procedure. Polyribosome isolation using biotin tagged Rpl10 protein  adapted from TRAP procedure. FACS procedure using cell specific fluorescent marker  following gentle dissociation of embryonic tissue. ATAC procedure adapted from Buenostro et al.  2013  adapted for FACS sorted embryonic cells. RNA pools extracted using RNAqueous Micro Scale Total RNA Isolation Kit. Non directional sequencing libraries post polyA selection of RNA transcripts NEBNext® PolyA mRNA Magnetic Isolation Module  NEB were built using NEBnext Ultra RNA library kit for Illumina NEB. Following ribodepletion using Ribo ZeroTM Magnetic Kit Epicentre  directional RNA seq libraries were constructed using Stranded RNA Seq Library Preparation Kit KAPABiosystems.,GEO Accession:GSM2386501,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP092952,,,Myl7_RNASeq_Nuclear_26hpf_1_R1.fastq.gz Myl7_RNASeq_Nuclear_26hpf_1_R2.fastq.gz,fastq fastq,4985333334.0,48875817.0,GSM2386501 r1,0:51 1:51,A:1030896260;C:1411954598;G:1508330460;T:1033900255;N:251761,51,51,,,1030896260,1411954598,1508330460,1033900255,251761,SRX2337866,SRS1791086,SRA491940,GEO,"Sauka-Spengler lab, University of Oxford, MRC Weatherall Institute of Molecular Medicine",2,0.7362,0.7434,0.12786,0.12837,0.75952,0.76065,0.47917,0.48384,51,51,B,B,biological fallback assumption,illumina,hiseq_era,unknown,poly_a,nebnext,bulk,unknown,unknown,,United Kingdom,2016-11-08,Pharyngula,Embryo,Heart,Cardiovascular System
42936,SRR5855244,SRX3024526,SRS2373779,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   bbs6 over expression,bbs6 over expression 4,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue bbs6 over expression,bbs6 overexpression 4,bbs6 overexpression 4,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,12_lane5_20161102000_S92_L005_R2_001.fastq.gz 12_lane5_20161102000_S92_L005_R1_001.fastq.gz,fastq fastq,4734224072.0,31146211.0,12 lane5 20161102000 S92 L005 R2 001.fastq.gz,0:76 1:76,A:1191205496;C:1178247460;G:1168255635;T:1196060624;N:454857,76,76,,,1191205496,1178247460,1168255635,1196060624,454857,SRX3024526,SRS2373779,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95177,0.95131,0.0383,0.03726,0.72243,0.72243,0.42289,0.42266,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42937,SRR5855245,SRX3024525,SRS2373778,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   bbs6 over expression,bbs6 over expression 2,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue bbs6 over expression,bbs6 overexpression 3,bbs6 overexpression 3,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,11_lane5_20161102000_S91_L005_R1_001.fastq.gz 11_lane5_20161102000_S91_L005_R2_001.fastq.gz,fastq fastq,5015265232.0,32995166.0,11 lane5 20161102000 S91 L005 R1 001.fastq.gz,0:76 1:76,A:1267139647;C:1242816272;G:1232034679;T:1272800227;N:474407,76,76,,,1267139647,1242816272,1232034679,1272800227,474407,SRX3024525,SRS2373778,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95103,0.95218,0.04923,0.04847,0.69402,0.69518,0.45437,0.44772,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42938,SRR5855246,SRX3024524,SRS2373777,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   smarcc1a knockdown,smarcc1a knockdown 3,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue smarcc1a knockdown,smarcc1a knockdown 4,smarcc1a knockdown 4,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,8_lane5_20161102000_S88_L005_R1_001.fastq.gz 8_lane5_20161102000_S88_L005_R2_001.fastq.gz,fastq fastq,4324972280.0,28453765.0,8 lane5 20161102000 S88 L005 R2 001.fastq.gz,0:76 1:76,A:1070408444;C:1094152744;G:1085295832;T:1074702140;N:413120,76,76,,,1070408444,1094152744,1085295832,1074702140,413120,SRX3024524,SRS2373777,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95733,0.95767,0.03174,0.0306,0.72028,0.72072,0.44362,0.45159,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42939,SRR5855247,SRX3024523,SRS2373776,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   smarcc1a knockdown,smarcc1a knockdown 4,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue smarcc1a knockdown,smarcc1a knockdown 3,smarcc1a knockdown 3,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,7_lane5_20161102000_S87_L005_R1_001.fastq.gz 7_lane5_20161102000_S87_L005_R2_001.fastq.gz,fastq fastq,4491938656.0,29552228.0,7 lane5 20161102000 S87 L005 R1 001.fastq.gz,0:76 1:76,A:1116707304;C:1130163592;G:1126483942;T:1118152345;N:431473,76,76,,,1116707304,1130163592,1126483942,1118152345,431473,SRX3024523,SRS2373776,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95348,0.95449,0.03796,0.03772,0.72529,0.72618,0.46052,0.46096,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42940,SRR5855248,SRX3024522,SRS2373775,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   smarcc1a knockdown,smarcc1a knockdown 2,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue smarcc1a knockdown,smarcc1a knockdown 2,smarcc1a knockdown 2,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,6_lane5_20161102000_S86_L005_R1_001.fastq.gz 6_lane5_20161102000_S86_L005_R2_001.fastq.gz,fastq fastq,4303477960.0,28312355.0,6 lane5 20161102000 S86 L005 R1 001.fastq.gz,0:76 1:76,A:1060357621;C:1096114267;G:1081075677;T:1065519253;N:411142,76,76,,,1060357621,1096114267,1081075677,1065519253,411142,SRX3024522,SRS2373775,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95716,0.95787,0.03128,0.03077,0.7304,0.73097,0.43343,0.4406,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42941,SRR5855249,SRX3024521,SRS2373774,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   smarcc1a knockdown,smarcc1a knockdown 1,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue smarcc1a knockdown,smarcc1a knockdown 1,smarcc1a knockdown 1,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,5_lane5_20161102000_S85_L005_R1_001.fastq.gz 5_lane5_20161102000_S85_L005_R2_001.fastq.gz,fastq fastq,4299406944.0,28285572.0,5 lane5 20161102000 S85 L005 R2 001.fastq.gz,0:76 1:76,A:1055648741;C:1094443792;G:1091483902;T:1057416779;N:413730,76,76,,,1055648741,1094443792,1091483902,1057416779,413730,SRX3024521,SRS2373774,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95809,0.95937,0.02908,0.02878,0.732,0.7321,0.44577,0.44584,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42942,SRR5855250,SRX3024520,SRS2373773,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   control,wildtype control 4,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue control,wildtype control 4,wildtype control 4,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,4_lane5_20161102000_S84_L005_R1_001.fastq.gz 4_lane5_20161102000_S84_L005_R2_001.fastq.gz,fastq fastq,4018059352.0,26434601.0,4 lane5 20161102000 S84 L005 R2 001.fastq.gz,0:76 1:76,A:1008156233;C:1001737182;G:997296042;T:1010483320;N:386575,76,76,,,1008156233,1001737182,997296042,1010483320,386575,SRX3024520,SRS2373773,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95095,0.95159,0.04934,0.04855,0.6858,0.68676,0.47468,0.47043,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42943,SRR5855251,SRX3024519,SRS2373772,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   control,wildtype control 3,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue control,wildtype control 3,wildtype control 3,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,3_lane5_20161102000_S83_L005_R2_001.fastq.gz 3_lane5_20161102000_S83_L005_R1_001.fastq.gz,fastq fastq,4233495032.0,27851941.0,3 lane5 20161102000 S83 L005 R1 001.fastq.gz,0:76 1:76,A:1061234768;C:1061677848;G:1044744764;T:1065439420;N:398232,76,76,,,1061234768,1061677848,1044744764,1065439420,398232,SRX3024519,SRS2373772,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95404,0.95547,0.04316,0.04198,0.70741,0.70717,0.43949,0.44585,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42944,SRR5855252,SRX3024518,SRS2373771,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   control,wildtype control 2,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue control,wildtype control 2,wildtype control 2,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,2_lane5_20161102000_S82_L005_R1_001.fastq.gz 2_lane5_20161102000_S82_L005_R2_001.fastq.gz,fastq fastq,4865250352.0,32008226.0,2 lane5 20161102000 S82 L005 R2 001.fastq.gz,0:76 1:76,A:1217698162;C:1217336292;G:1210023632;T:1219728654;N:463612,76,76,,,1217698162,1217336292,1210023632,1219728654,463612,SRX3024518,SRS2373771,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95521,0.95457,0.03943,0.0382,0.70285,0.7037,0.45131,0.45255,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42945,SRR5855253,SRX3024517,SRS2373769,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   control,wildtype control 1,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue control,wildtype control 1,wildtype control 1,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,1_lane5_20161102000_S81_L005_R1_001.fastq.gz 1_lane5_20161102000_S81_L005_R2_001.fastq.gz,fastq fastq,3946454432.0,25963516.0,1 lane5 20161102000 S81 L005 R2 001.fastq.gz,0:76 1:76,A:991404923;C:986313010;G:975620653;T:992743977;N:371869,76,76,,,991404923,986313010,975620653,992743977,371869,SRX3024517,SRS2373769,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95282,0.95458,0.05035,0.04915,0.69702,0.6967,0.4678,0.46722,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42946,SRR5855254,SRX3024516,SRS2373770,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   bbs6 over expression,bbs6 over expression 3,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue bbs6 over expression,bbs6 overexpression 2,bbs6 overexpression 2,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,10_lane5_20161102000_S90_L005_R1_001.fastq.gz 10_lane5_20161102000_S90_L005_R2_001.fastq.gz,fastq fastq,4315321344.0,28390272.0,10 lane5 20161102000 S90 L005 R2 001.fastq.gz,0:76 1:76,A:1086545039;C:1075002584;G:1059308862;T:1094053688;N:411171,76,76,,,1086545039,1075002584,1059308862,1094053688,411171,SRX3024516,SRS2373770,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95328,0.95349,0.04449,0.04409,0.69546,0.69641,0.44932,0.44783,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
42947,SRR5855255,SRX3024515,SRS2373768,SRP113255,PRJNA395216,mRNA sequencing of larval zebrafish heart tissue,PRJNA395216,Other,Heart tissue was enriched from 48hpf zebrafish larvae from different experimental conditions. Approximately 200 hearts were collected for each sample. The goals of the study were to profile transcriptional outputs in the cardiac tissue which affects heart development between two different experimental conditions.,,,,Zebrafish 48hpf heart mRNA sequencing   bbs6 over expression,bbs6 over expression 1,,strain:WT|dev stage:48 hpf determined|tissue:heart|BioSampleModel:Model organism or animal,,,,,,,,,zebrafish mRNA seq of heart tissue bbs6 over expression,bbs6 overexpression 1,bbs6 overexpression 1,hearts encriched from whole animal tissue and mRNA isolated,,,RNA-Seq,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP113255,,,9_lane5_20161102000_S89_L005_R1_001.fastq.gz 9_lane5_20161102000_S89_L005_R2_001.fastq.gz,fastq fastq,3745789808.0,24643354.0,9 lane5 20161102000 S89 L005 R2 001.fastq.gz,0:76 1:76,A:935401240;C:938927873;G:932061106;T:939042073;N:357516,76,76,,,935401240,938927873,932061106,939042073,357516,SRX3024515,SRS2373768,SRA589703,University of Iowa|Biology,University of Iowa,2,0.95454,0.955,0.03772,0.03653,0.71001,0.71052,0.43385,0.43347,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,other,unknown,bulk,unknown,unknown,,United States,2017-07-20,Hatching,Embryo,Heart,Cardiovascular System
43654,SRR5984242,SRX3140238,SRS2473002,SRP116311,PRJNA400391,Multiple roles for Wwtr1 in cardiac wall maturation,GSE103169,Transcriptome Analysis,Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle.  The Hippo signaling pathway has been implicated in cardiac development but many questions remain.  We investigated the role of Wwtr1  a nuclear effector of the Hippo pathway  in zebrafish and find that its loss results in hearts with reduced trabeculation.  However  in mosaic animals  wwtr1 /  cardiomyocytes contribute more frequently than wwtr1+/  cardiomyocytes to the trabecular layer of wild type hearts.  To investigate this paradox  we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture  as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions.  The mutant compact wall is not able to support trabeculation as  in mosaic animals  wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts.  Therefore  we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf.  A total of 23 hearts per biological replicate was collected.  RNA sequencing was performed on three biological replicates for each genotype.,,pubmed:29773645,,mutant3,GSM2756549,,source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts,mutant3,"Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “  outFilterMismatchNoverLmax 0.1"" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample",larval hearts,,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,,developmental stage:57 hpf 59 hpf|tissue:whole hearts,GSM2756549,GSM2756549: mutant3; Danio rerio; RNA Seq,GSM2756549,,1,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,GEO Accession:GSM2756549,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP116311,,,jason_heart_Mut3_R1.fastq.gz,fastq,2318935255.0,32714908.0,GSM2756549 r1,0:70.88 1:0,A:531252689;C:641587621;G:685109185;T:460794150;N:191610,70,0,,,531252689,641587621,685109185,460794150,191610,SRX3140238,SRS2473002,SRA603246,GEO,MPI for heart and lung research,1,0.91412,,0.26371,,0.81046,,0.70894,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2017-08-28,Hatching,Embryo,Heart,Cardiovascular System
43655,SRR5984241,SRX3140237,SRS2473000,SRP116311,PRJNA400391,Multiple roles for Wwtr1 in cardiac wall maturation,GSE103169,Transcriptome Analysis,Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle.  The Hippo signaling pathway has been implicated in cardiac development but many questions remain.  We investigated the role of Wwtr1  a nuclear effector of the Hippo pathway  in zebrafish and find that its loss results in hearts with reduced trabeculation.  However  in mosaic animals  wwtr1 /  cardiomyocytes contribute more frequently than wwtr1+/  cardiomyocytes to the trabecular layer of wild type hearts.  To investigate this paradox  we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture  as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions.  The mutant compact wall is not able to support trabeculation as  in mosaic animals  wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts.  Therefore  we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf.  A total of 23 hearts per biological replicate was collected.  RNA sequencing was performed on three biological replicates for each genotype.,,pubmed:29773645,,mutant2,GSM2756548,,source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts,mutant2,"Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “  outFilterMismatchNoverLmax 0.1"" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample",larval hearts,,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,,developmental stage:57 hpf 59 hpf|tissue:whole hearts,GSM2756548,GSM2756548: mutant2; Danio rerio; RNA Seq,GSM2756548,,1,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,GEO Accession:GSM2756548,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP116311,,,jason_heart_Mut2_R1.fastq.gz,fastq,2276667269.0,31589401.0,GSM2756548 r1,0:72.07 1:0,A:523522795;C:629721285;G:668815033;T:454506503;N:101653,72,0,,,523522795,629721285,668815033,454506503,101653,SRX3140237,SRS2473000,SRA603246,GEO,MPI for heart and lung research,1,0.93959,,0.27725,,0.81213,,0.72099,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2017-08-28,Hatching,Embryo,Heart,Cardiovascular System
43656,SRR5984240,SRX3140236,SRS2473001,SRP116311,PRJNA400391,Multiple roles for Wwtr1 in cardiac wall maturation,GSE103169,Transcriptome Analysis,Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle.  The Hippo signaling pathway has been implicated in cardiac development but many questions remain.  We investigated the role of Wwtr1  a nuclear effector of the Hippo pathway  in zebrafish and find that its loss results in hearts with reduced trabeculation.  However  in mosaic animals  wwtr1 /  cardiomyocytes contribute more frequently than wwtr1+/  cardiomyocytes to the trabecular layer of wild type hearts.  To investigate this paradox  we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture  as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions.  The mutant compact wall is not able to support trabeculation as  in mosaic animals  wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts.  Therefore  we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf.  A total of 23 hearts per biological replicate was collected.  RNA sequencing was performed on three biological replicates for each genotype.,,pubmed:29773645,,mutant1,GSM2756547,,source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts,mutant1,"Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “  outFilterMismatchNoverLmax 0.1"" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample",larval hearts,,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,,developmental stage:57 hpf 59 hpf|tissue:whole hearts,GSM2756547,GSM2756547: mutant1; Danio rerio; RNA Seq,GSM2756547,,1,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,GEO Accession:GSM2756547,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP116311,,,jason_heart_Mut1_R1.fastq.gz,fastq,2433699187.0,33884585.0,GSM2756547 r1,0:71.82 1:0,A:566703318;C:666284055;G:710377903;T:490161679;N:172232,71,0,,,566703318,666284055,710377903,490161679,172232,SRX3140236,SRS2473001,SRA603246,GEO,MPI for heart and lung research,1,0.92785,,0.26891,,0.80848,,0.71469,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2017-08-28,Hatching,Embryo,Heart,Cardiovascular System
43657,SRR5984239,SRX3140235,SRS2473003,SRP116311,PRJNA400391,Multiple roles for Wwtr1 in cardiac wall maturation,GSE103169,Transcriptome Analysis,Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle.  The Hippo signaling pathway has been implicated in cardiac development but many questions remain.  We investigated the role of Wwtr1  a nuclear effector of the Hippo pathway  in zebrafish and find that its loss results in hearts with reduced trabeculation.  However  in mosaic animals  wwtr1 /  cardiomyocytes contribute more frequently than wwtr1+/  cardiomyocytes to the trabecular layer of wild type hearts.  To investigate this paradox  we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture  as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions.  The mutant compact wall is not able to support trabeculation as  in mosaic animals  wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts.  Therefore  we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf.  A total of 23 hearts per biological replicate was collected.  RNA sequencing was performed on three biological replicates for each genotype.,,pubmed:29773645,,WT3,GSM2756546,,source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts,WT3,"Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “  outFilterMismatchNoverLmax 0.1"" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample",larval hearts,,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,,developmental stage:57 hpf 59 hpf|tissue:whole hearts,GSM2756546,GSM2756546: WT3; Danio rerio; RNA Seq,GSM2756546,,1,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,GEO Accession:GSM2756546,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP116311,,,jason_heart_WT3_R1.fastq.gz,fastq,2595563546.0,36205665.0,GSM2756546 r1,0:71.69 1:0,A:596821525;C:717114315;G:763367649;T:518112169;N:147888,71,0,,,596821525,717114315,763367649,518112169,147888,SRX3140235,SRS2473003,SRA603246,GEO,MPI for heart and lung research,1,0.94302,,0.26879,,0.80732,,0.68295,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2017-08-28,Hatching,Embryo,Heart,Cardiovascular System
43658,SRR5984238,SRX3140234,SRS2472998,SRP116311,PRJNA400391,Multiple roles for Wwtr1 in cardiac wall maturation,GSE103169,Transcriptome Analysis,Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle.  The Hippo signaling pathway has been implicated in cardiac development but many questions remain.  We investigated the role of Wwtr1  a nuclear effector of the Hippo pathway  in zebrafish and find that its loss results in hearts with reduced trabeculation.  However  in mosaic animals  wwtr1 /  cardiomyocytes contribute more frequently than wwtr1+/  cardiomyocytes to the trabecular layer of wild type hearts.  To investigate this paradox  we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture  as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions.  The mutant compact wall is not able to support trabeculation as  in mosaic animals  wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts.  Therefore  we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf.  A total of 23 hearts per biological replicate was collected.  RNA sequencing was performed on three biological replicates for each genotype.,,pubmed:29773645,,WT2,GSM2756545,,source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts,WT2,"Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “  outFilterMismatchNoverLmax 0.1"" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample",larval hearts,,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,,developmental stage:57 hpf 59 hpf|tissue:whole hearts,GSM2756545,GSM2756545: WT2; Danio rerio; RNA Seq,GSM2756545,,1,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,GEO Accession:GSM2756545,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP116311,,,jason_heart_WT2_R1.fastq.gz,fastq,2428761873.0,34256225.0,GSM2756545 r1,0:70.90 1:0,A:548982414;C:680177405;G:725438417;T:473983208;N:180429,70,0,,,548982414,680177405,725438417,473983208,180429,SRX3140234,SRS2472998,SRA603246,GEO,MPI for heart and lung research,1,0.92891,,0.26633,,0.81742,,0.68958,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2017-08-28,Hatching,Embryo,Heart,Cardiovascular System
43659,SRR5984237,SRX3140233,SRS2472997,SRP116311,PRJNA400391,Multiple roles for Wwtr1 in cardiac wall maturation,GSE103169,Transcriptome Analysis,Cardiac trabeculation is a highly regulated process that starts with the delamination of cardiomyocytes from the compact wall to form stereotypical muscular ridges in the developing ventricle.  The Hippo signaling pathway has been implicated in cardiac development but many questions remain.  We investigated the role of Wwtr1  a nuclear effector of the Hippo pathway  in zebrafish and find that its loss results in hearts with reduced trabeculation.  However  in mosaic animals  wwtr1 /  cardiomyocytes contribute more frequently than wwtr1+/  cardiomyocytes to the trabecular layer of wild type hearts.  To investigate this paradox  we examined the myocardial wall at early stages and find that loss of Wwtr1 leads to disruption of the compact wall architecture  as evidenced by the disorganized cortical actin structure and abnormal cell cell junctions.  The mutant compact wall is not able to support trabeculation as  in mosaic animals  wild type cardiomyocytes are more frequently in the compact layer of mutant than heterozygous hearts.  Therefore  we propose that Wwtr1 establishes the compact wall architecture necessary for trabeculation and that it also modulates a cardiomyocyte's decision to enter the trabecular layer. Overall design: larval hearts from mutants and WT siblings were manuall dissected out at 57 hpf 59 hpf.  A total of 23 hearts per biological replicate was collected.  RNA sequencing was performed on three biological replicates for each genotype.,,pubmed:29773645,,WT1,GSM2756544,,source name:larval hearts|developmental stage:57 hpf 59 hpf|tissue:whole hearts,WT1,"Basecalls with RTA v2 Illumina Reaper version 13 100 was employed to trim reads post a quality drop below a mean of Q20 in a window of 10 nucleotides. Only reads between 30 and 150 nucleotides were cleared for further analyses. Mapping: alignment versus the Ensembl Zebrafish genome version DanRer10 GRCz10.87 using STAR 2.4.0a with the parameter “  outFilterMismatchNoverLmax 0.1"" The number of reads aligning to genes was counted with featureCounts 1.4.5 p1 tool from the Subread package. Only reads mapping at least partially inside exons were admitted and aggregated per gene. Reads overlapping multiple genes or aligning to multiple regions were excluded. The Ensemble annotation was enriched with UniProt data release 06.06.2014 based on Ensembl gene identifiers. Genome build: DanRer10 Supplementary files format and content: library size normalized counts per sample",larval hearts,,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,,developmental stage:57 hpf 59 hpf|tissue:whole hearts,GSM2756544,GSM2756544: WT1; Danio rerio; RNA Seq,GSM2756544,,1,RNA extraction was performed with Qiagen miRNeasy kit Clontech Pico Input Mammalian Takara Clontech. Briefly  6.5ng of total RNA was used as input for Pico Input Mammalian Takara Clontech. Sequencing was performed on the NextSeq500 instrument Illumina using v2 chemistry  resulting in minimum of 30M reads per library with 1x75bp single end setup.,GEO Accession:GSM2756544,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP116311,,,jason_heart_WT1_R1.fastq.gz,fastq,2421918694.0,33333637.0,GSM2756544 r1,0:72.66 1:0,A:575214961;C:656270777;G:695610013;T:494755729;N:67214,72,0,,,575214961,656270777,695610013,494755729,67214,SRX3140233,SRS2472997,SRA603246,GEO,MPI for heart and lung research,1,0.93965,,0.26938,,0.80415,,0.70681,,75,,B,,usable mapping rate,illumina,nextseq,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Germany,2017-08-28,Hatching,Embryo,Heart,Cardiovascular System
43725,SRR6039671,SRX3187843,SRS2515291,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,C60,,time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:60 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,C60,C60,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X22_130410_SN141_0670_AD228RACXX_8.txt.gz,fastq,1364849650.0,27296993.0,9499X22 130410 SN141 0670 AD228RACXX 8.txt.gz,0:50,A:348009842;C:323199527;G:329155973;T:364266750;N:217558,50,,,,348009842,323199527,329155973,364266750,217558,SRX3187843,SRS2515291,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.86007,,0.19896,,0.76869,,0.64585,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43726,SRR6039672,SRX3187842,SRS2515290,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,C54,,time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:54 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,C54,C54,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X21_130410_SN141_0670_AD228RACXX_8.txt.gz,fastq,1605351050.0,32107021.0,9499X21 130410 SN141 0670 AD228RACXX 8.txt.gz,0:50,A:417861250;C:375199783;G:380695354;T:431338259;N:256404,50,,,,417861250,375199783,380695354,431338259,256404,SRX3187842,SRS2515290,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.85615,,0.205,,0.75268,,0.68959,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43728,SRR6039674,SRX3187840,SRS2515288,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,C66,,time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:66 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,C66,C66,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X23_130410_SN141_0670_AD228RACXX_8.txt.gz,fastq,1223124200.0,24462484.0,9499X23 130410 SN141 0670 AD228RACXX 8.txt.gz,0:50,A:314863383;C:287048667;G:292205645;T:328811745;N:194760,50,,,,314863383,287048667,292205645,328811745,194760,SRX3187840,SRS2515288,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.87141,,0.18418,,0.76167,,0.70405,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43729,SRR6039675,SRX3187839,SRS2515287,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,B30,,time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,B30,B30,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X9_130405_SN141_0668_AD2154ACXX_8.txt.gz,fastq,1120008050.0,22400161.0,9499X9 130405 SN141 0668 AD2154ACXX 8.txt.gz,0:50,A:276093341;C:277073909;G:281519716;T:285221666;N:99418,50,,,,276093341,277073909,281519716,285221666,99418,SRX3187839,SRS2515287,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.88679,,0.20435,,0.77185,,0.58996,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Pharyngula,Embryo,Heart,Cardiovascular System
43730,SRR6039676,SRX3187838,SRS2515286,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,B36,,time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,B36,B36,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X10_130405_SN141_0668_AD2154ACXX_8.txt.gz,fastq,1568417300.0,31368346.0,9499X10 130405 SN141 0668 AD2154ACXX 8.txt.gz,0:50,A:387419891;C:388387212;G:394030807;T:398440283;N:139107,50,,,,387419891,388387212,394030807,398440283,139107,SRX3187838,SRS2515286,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.89157,,0.18037,,0.76286,,0.63654,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Pharyngula,Embryo,Heart,Cardiovascular System
43731,SRR6039677,SRX3187837,SRS2515285,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,A30,,time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,A30,A30,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X1_130405_SN141_0668_AD2154ACXX_7.txt.gz,fastq,1591462700.0,31829254.0,9499X1 130405 SN141 0668 AD2154ACXX 7.txt.gz,0:50,A:340306422;C:441595911;G:442592098;T:366852440;N:115829,50,,,,340306422,441595911,442592098,366852440,115829,SRX3187837,SRS2515285,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.4932,,0.13089,,0.90962,,0.7432,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Pharyngula,Embryo,Heart,Cardiovascular System
43732,SRR6039678,SRX3187836,SRS2515284,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,A36,,time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,A36,A36,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X2_130405_SN141_0668_AD2154ACXX_7.txt.gz,fastq,1328412500.0,26568250.0,9499X2 130405 SN141 0668 AD2154ACXX 7.txt.gz,0:50,A:307478316;C:349102549;G:350562927;T:321170451;N:98257,50,,,,307478316,349102549,350562927,321170451,98257,SRX3187836,SRS2515284,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.51716,,0.15839,,0.86642,,0.61201,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Pharyngula,Embryo,Heart,Cardiovascular System
43733,SRR6039679,SRX3187835,SRS2515283,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,A42,,time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,A42,A42,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X3_130405_SN141_0668_AD2154ACXX_7.txt.gz,fastq,1101079300.0,22021586.0,9499X3 130405 SN141 0668 AD2154ACXX 7.txt.gz,0:50,A:258171407;C:286688991;G:285879983;T:270258877;N:80042,50,,,,258171407,286688991,285879983,270258877,80042,SRX3187835,SRS2515283,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.35588,,0.10785,,0.88116,,0.69861,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Pharyngula,Embryo,Heart,Cardiovascular System
43734,SRR6039680,SRX3187834,SRS2515282,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,A48,,time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:48 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,A48,A48,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X4_130405_SN141_0668_AD2154ACXX_7.txt.gz,fastq,1163964850.0,23279297.0,9499X4 130405 SN141 0668 AD2154ACXX 7.txt.gz,0:50,A:267571170;C:307087585;G:308621634;T:280598211;N:86250,50,,,,267571170,307087585,308621634,280598211,86250,SRX3187834,SRS2515282,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.59745,,0.16497,,0.85563,,0.71862,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43735,SRR6039681,SRX3187833,SRS2515281,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,A54,,time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:54 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,A54,A54,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X5_130405_SN141_0668_AD2154ACXX_7.txt.gz,fastq,1655394200.0,33107884.0,9499X5 130405 SN141 0668 AD2154ACXX 7.txt.gz,0:50,A:385028150;C:432655363;G:431802199;T:405785458;N:123030,50,,,,385028150,432655363,431802199,405785458,123030,SRX3187833,SRS2515281,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.29511,,0.0811,,0.90873,,0.74416,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43736,SRR6039682,SRX3187832,SRS2515280,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,A60,,time point hpf group:A|multiplex group:1|strain:cmlc2::gfp reporter line|dev stage:60 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,A60,A60,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X6_130405_SN141_0668_AD2154ACXX_7.txt.gz,fastq,1644194800.0,32883896.0,9499X6 130405 SN141 0668 AD2154ACXX 7.txt.gz,0:50,A:384925336;C:429204709;G:426105707;T:403838669;N:120379,50,,,,384925336,429204709,426105707,403838669,120379,SRX3187832,SRS2515280,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.21132,,0.06222,,0.92161,,0.73478,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43737,SRR6039683,SRX3187831,SRS2515279,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,A66,,time point hpf group:A|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:66 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,A66,A66,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X7_130405_SN141_0668_AD2154ACXX_8.txt.gz,fastq,1263286950.0,25265739.0,9499X7 130405 SN141 0668 AD2154ACXX 8.txt.gz,0:50,A:295405537;C:327487531;G:330022830;T:310260331;N:110721,50,,,,295405537,327487531,330022830,310260331,110721,SRX3187831,SRS2515279,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.26001,,0.08486,,0.89751,,0.68587,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43739,SRR6039685,SRX3187829,SRS2515277,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,C42,,time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,C42,C42,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X19_130410_SN141_0670_AD228RACXX_8.txt.gz,fastq,1404005750.0,28080115.0,9499X19 130410 SN141 0670 AD228RACXX 8.txt.gz,0:50,A:363329939;C:325066287;G:334263296;T:381124430;N:221798,50,,,,363329939,325066287,334263296,381124430,221798,SRX3187829,SRS2515277,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.84646,,0.20569,,0.75856,,0.66427,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Pharyngula,Embryo,Heart,Cardiovascular System
43740,SRR6039686,SRX3187828,SRS2515276,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,C48,,time point hpf group:C|multiplex group:4|strain:cmlc2::gfp reporter line|dev stage:48 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,C48,C48,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X20_130410_SN141_0670_AD228RACXX_8.txt.gz,fastq,1667261150.0,33345223.0,9499X20 130410 SN141 0670 AD228RACXX 8.txt.gz,0:50,A:435179346;C:386019872;G:392704941;T:453092337;N:264654,50,,,,435179346,386019872,392704941,453092337,264654,SRX3187828,SRS2515276,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.84372,,0.18152,,0.76112,,0.69534,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43741,SRR6039687,SRX3187827,SRS2515274,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,B66,,time point hpf group:B|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:66 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,B66,B66,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X15_130410_SN141_0670_AD228RACXX_7.txt.gz,fastq,1736299000.0,34725980.0,9499X15 130410 SN141 0670 AD228RACXX 7.txt.gz,0:50,A:408694669;C:446311098;G:454700615;T:426319811;N:272807,50,,,,408694669,446311098,454700615,426319811,272807,SRX3187827,SRS2515274,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.86249,,0.21214,,0.81184,,0.74585,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43743,SRR6039689,SRX3187825,SRS2515273,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,C30,,time point hpf group:C|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:30 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,C30,C30,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X17_130410_SN141_0670_AD228RACXX_7.txt.gz,fastq,1261245200.0,25224904.0,9499X17 130410 SN141 0670 AD228RACXX 7.txt.gz,0:50,A:319419875;C:303300361;G:307895242;T:330428818;N:200904,50,,,,319419875,303300361,307895242,330428818,200904,SRX3187825,SRS2515273,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.87549,,0.23233,,0.77325,,0.65489,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Pharyngula,Embryo,Heart,Cardiovascular System
43744,SRR6039690,SRX3187824,SRS2515272,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,C36,,time point hpf group:C|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:36 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,C36,C36,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X18_130410_SN141_0670_AD228RACXX_7.txt.gz,fastq,1263613900.0,25272278.0,9499X18 130410 SN141 0670 AD228RACXX 7.txt.gz,0:50,A:310002055;C:309104393;G:317720866;T:326586067;N:200519,50,,,,310002055,309104393,317720866,326586067,200519,SRX3187824,SRS2515272,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.84147,,0.2007,,0.78839,,0.61872,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Pharyngula,Embryo,Heart,Cardiovascular System
43745,SRR6039691,SRX3187823,SRS2515271,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,B42,,time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:42 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,B42,B42,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X11_130405_SN141_0668_AD2154ACXX_8.txt.gz,fastq,1714029850.0,34280597.0,9499X11 130405 SN141 0668 AD2154ACXX 8.txt.gz,0:50,A:341571294;C:484054132;G:501201310;T:387056138;N:146976,50,,,,341571294,484054132,501201310,387056138,146976,SRX3187823,SRS2515271,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.72224,,0.18688,,0.92151,,0.71808,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Pharyngula,Embryo,Heart,Cardiovascular System
43746,SRR6039692,SRX3187822,SRS2515270,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,B48,,time point hpf group:B|multiplex group:2|strain:cmlc2::gfp reporter line|dev stage:48 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,B48,B48,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X12_130405_SN141_0668_AD2154ACXX_8.txt.gz,fastq,1343863300.0,26877266.0,9499X12 130405 SN141 0668 AD2154ACXX 8.txt.gz,0:50,A:332436047;C:330255043;G:335051133;T:346001738;N:119339,50,,,,332436047,330255043,335051133,346001738,119339,SRX3187822,SRS2515270,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.86424,,0.22149,,0.77348,,0.69794,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43747,SRR6039693,SRX3187821,SRS2515269,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,B54,,time point hpf group:B|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:54 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,B54,B54,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X13_130410_SN141_0670_AD228RACXX_7.txt.gz,fastq,1430967650.0,28619353.0,9499X13 130410 SN141 0670 AD228RACXX 7.txt.gz,0:50,A:337603977;C:367587663;G:373587156;T:351960226;N:228628,50,,,,337603977,367587663,373587156,351960226,228628,SRX3187821,SRS2515269,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.86614,,0.25063,,0.81061,,0.71973,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43748,SRR6039694,SRX3187820,SRS2515268,SRP117696,PRJNA407368,RNA seq timecourse analysis during zebrafish heart looping morphogenesis,PRJNA407368,Other,During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks GRNs driving this phase of heart development  during which many congenital heart disease malformations likely arise  we conducted an RNA seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern  identified transcription factor binding motifs enriched in each cluster  and generated a model GRN for the major gene batteries in heart morphogenesis.,,,,,B60,,time point hpf group:B|multiplex group:3|strain:cmlc2::gfp reporter line|dev stage:60 hpf organism or animal,,,,,,,,,RNA Seq of Danio rerio heart tissue: Time series during heart looping 30   72 hpf,B60,B60,For each replicate  approximately 1600 zebrafish embryos were collected 200 each at 30  36  42  48  54  60  66  72 hpf Hearts were mechanically separated from the embryos and manually pipetted from the media. Isolated hearts were centrifuged briefly and the supernatant removed. 400 ul of Trizol was then added to the pellet and homogenized before storing at  80C. RNA was isolated by phenol chloroform extraction followed by ethanol precipitation. A total of 6 replicate experiments were performed. To ensure sufficient material for library preparation  each of the 3 replicate groups was formed by pooling 2 of the 6 experiments. RNA Seq libraries were constructed from total RNA using the NuGEN Ovation RNA Seq System v2 ultra low input kit.,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP117696,,,9499X14_130410_SN141_0670_AD228RACXX_7.txt.gz,fastq,1746861850.0,34937237.0,9499X14 130410 SN141 0670 AD228RACXX 7.txt.gz,0:50,A:414399803;C:445933587;G:454277059;T:431977310;N:274091,50,,,,414399803,445933587,454277059,431977310,274091,SRX3187820,SRS2515268,SRA608458,University of Utah|Neurobiology and Anatomy,University of Utah,1,0.85546,,0.23134,,0.80521,,0.73018,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United States,2017-09-14,Hatching,Embryo,Heart,Cardiovascular System
43755,SRR6054093,SRX3201032,SRS2528004,SRP118319,PRJNA408129,Spatially resolved RNA sequencing of the embryonic zebrafish heart,GSE104057,Transcriptome Analysis,Development of specialized cell types and structures in the vertebrate heart is regulated by spatially restricted molecular pathways. Disruptions in these pathways can cause severe congenital cardiac malformations or functional defects. To better understand these pathways and how they regulate cardiac development and function we used tomo seq  combining high throughput RNA sequencing with tissue sectioning  to establish a genome wide expression dataset with high spatial resolution for the developing zebrafish heart. Analysis of the dataset revealed over 1100 genes differentially expressed in sub compartments. Pacemaker cells in the sinoatrial region induce heart contractions  but little is known about the mechanisms underlying their development and function. Using our transcriptome map  we identified spatially restricted Wnt/ß catenin signaling activity in pacemaker cells  which was controlled by Islet 1 activity. Moreover  Wnt/ß catenin signaling at a specific developmental stage in the myocardium controls heart rate by regulating pacemaker cellular response to parasympathetic stimuli. Thus  this high resolution transcriptome map incorporating all cell types in the embryonic heart can expose spatially restricted molecular pathways critical for specific cardiac functions. Overall design: To generate spatially resolved RNA seq data for the developing zebrafish hearts 2 dpf  we cryosectioned 3 hearts  extracted RNA from the individual sections  amplified and barcoded mRNA using the CEL seq protocol Hashimshony et al.  Cell Reports  2012 with a few modifications. Libraries were sequenced on Illumina NextSeq using 75bp paired end sequencing. Sample Heart #1 is the primary sample. Heart #2 and #3 are biological replicates used for comparison.,,pubmed:29400650,,heart3 2dpf wt,GSM2788520,,source name:isolated embryonic heart|tissue:embryonic heart|developmental stage:48 hpf direction:posterior/inflow tract to anterior/outflow tract; located in sections #11   #39|section thickness:10µm sections,heart3 2dpf wt,Paired end reads were aligned to the transcriptome using bwa version 0.6.2 with default parameters. The zebrafish transcriptome was based on genome release zv9 and contained improved gene annotations as described in Junker et al. 2014 Cell. The right mate of each read pair was mapped to the ensemble of all transcripts and to the set of 92 ERCC spike ins in sense direction. Reads mapping equally to multiple loci were discarded. Mapped reads were assigned to sections based on barcodes according to the CEL seq protocol Hashimshony et al.  Cell Reports  2012 processed data files contain transcript read counts normalized against spike in read count and total read count per section Genome build: zv9 with improved three prime annotation  see Junker et al 2014 Cell Supplementary files format and content: csv file containing transcript counts per gene rows and section columns,isolated embryonic heart,Unfixed embryonic hearts were dissected and embedded in tissue freezing medium. Blocks were cryosectioned  and individual sections were transferred to Eppendorf tubes on dry ice. For extended experimental procedure see also Junker et al. 2014 Cell.,Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al.  Cell Reports  2012  see also: Junker et al.  2014  Cell CEL seq protocol Hashimshony et al.  Cell Reports  2012; also  see: Junker et al.  2014  Cell,,tissue:embryonic heart|developmental stage:48 hpf direction:posterior/inflow tract to anterior/outflow tract; located in sections #11   #39|section thickness:10µm sections,GSM2788520,GSM2788520: heart3 2dpf wt; Danio rerio; RNA Seq,GSM2788520,,1,Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al.  Cell Reports  2012  see also: Junker et al.  2014  Cell CEL seq protocol Hashimshony et al.  Cell Reports  2012; also  see: Junker et al.  2014  Cell,GEO Accession:GSM2788520,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP118319,,,heart_03_SB032dpfwt_R1.fastq.gz heart_03_SB032dpfwt_R2.fastq.gz,fastq fastq,2662906147.0,17670214.0,GSM2788520 r1,0:75.39 1:75.31,A:828280216;C:376671462;G:437493213;T:1019745554;N:715702,75,75,,,828280216,376671462,437493213,1019745554,715702,SRX3201032,SRS2528004,SRA610777,GEO,"Jeroen Bakkers lab, Cardiac Development and Genetics, Hubrecht Institute",2,0.04145,0.36579,0.03839,0.09603,0.99912,0.89623,0.41379,0.5674,76,75,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,cdna_unspecified,unknown,sc,single_cell_plate,celseq,,Netherlands,2017-09-20,Hatching,Embryo,Heart,Cardiovascular System
43756,SRR6054092,SRX3201031,SRS2528003,SRP118319,PRJNA408129,Spatially resolved RNA sequencing of the embryonic zebrafish heart,GSE104057,Transcriptome Analysis,Development of specialized cell types and structures in the vertebrate heart is regulated by spatially restricted molecular pathways. Disruptions in these pathways can cause severe congenital cardiac malformations or functional defects. To better understand these pathways and how they regulate cardiac development and function we used tomo seq  combining high throughput RNA sequencing with tissue sectioning  to establish a genome wide expression dataset with high spatial resolution for the developing zebrafish heart. Analysis of the dataset revealed over 1100 genes differentially expressed in sub compartments. Pacemaker cells in the sinoatrial region induce heart contractions  but little is known about the mechanisms underlying their development and function. Using our transcriptome map  we identified spatially restricted Wnt/ß catenin signaling activity in pacemaker cells  which was controlled by Islet 1 activity. Moreover  Wnt/ß catenin signaling at a specific developmental stage in the myocardium controls heart rate by regulating pacemaker cellular response to parasympathetic stimuli. Thus  this high resolution transcriptome map incorporating all cell types in the embryonic heart can expose spatially restricted molecular pathways critical for specific cardiac functions. Overall design: To generate spatially resolved RNA seq data for the developing zebrafish hearts 2 dpf  we cryosectioned 3 hearts  extracted RNA from the individual sections  amplified and barcoded mRNA using the CEL seq protocol Hashimshony et al.  Cell Reports  2012 with a few modifications. Libraries were sequenced on Illumina NextSeq using 75bp paired end sequencing. Sample Heart #1 is the primary sample. Heart #2 and #3 are biological replicates used for comparison.,,pubmed:29400650,,heart2 2dpf wt,GSM2788519,,source name:isolated embryonic heart|tissue:embryonic heart|developmental stage:48 hpf direction:posterior/inflow tract to anterior/outflow tract; located in sections #49   #96|section thickness:10µm sections,heart2 2dpf wt,Paired end reads were aligned to the transcriptome using bwa version 0.6.2 with default parameters. The zebrafish transcriptome was based on genome release zv9 and contained improved gene annotations as described in Junker et al. 2014 Cell. The right mate of each read pair was mapped to the ensemble of all transcripts and to the set of 92 ERCC spike ins in sense direction. Reads mapping equally to multiple loci were discarded. Mapped reads were assigned to sections based on barcodes according to the CEL seq protocol Hashimshony et al.  Cell Reports  2012 processed data files contain transcript read counts normalized against spike in read count and total read count per section Genome build: zv9 with improved three prime annotation  see Junker et al 2014 Cell Supplementary files format and content: csv file containing transcript counts per gene rows and section columns,isolated embryonic heart,Unfixed embryonic hearts were dissected and embedded in tissue freezing medium. Blocks were cryosectioned  and individual sections were transferred to Eppendorf tubes on dry ice. For extended experimental procedure see also Junker et al. 2014 Cell.,Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al.  Cell Reports  2012  see also: Junker et al.  2014  Cell CEL seq protocol Hashimshony et al.  Cell Reports  2012; also  see: Junker et al.  2014  Cell,,tissue:embryonic heart|developmental stage:48 hpf direction:posterior/inflow tract to anterior/outflow tract; located in sections #49   #96|section thickness:10µm sections,GSM2788519,GSM2788519: heart2 2dpf wt; Danio rerio; RNA Seq,GSM2788519,,1,Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al.  Cell Reports  2012  see also: Junker et al.  2014  Cell CEL seq protocol Hashimshony et al.  Cell Reports  2012; also  see: Junker et al.  2014  Cell,GEO Accession:GSM2788519,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP118319,,,heart_02_SB-150707_R1.fastq.gz heart_02_SB-150707_R2.fastq.gz,fastq fastq,5482437730.0,36337096.0,GSM2788519 r1,0:75.41 1:75.47,A:1859596349;C:686627791;G:950285046;T:1980208127;N:5720417,75,75,,,1859596349,686627791,950285046,1980208127,5720417,SRX3201031,SRS2528003,SRA610777,GEO,"Jeroen Bakkers lab, Cardiac Development and Genetics, Hubrecht Institute",2,0.14301,0.55835,0.12504,0.16935,0.99285,0.86334,0.46837,0.58661,76,74,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,cdna_unspecified,unknown,sc,single_cell_plate,celseq,,Netherlands,2017-09-20,Hatching,Embryo,Heart,Cardiovascular System
43757,SRR6054091,SRX3201030,SRS2528002,SRP118319,PRJNA408129,Spatially resolved RNA sequencing of the embryonic zebrafish heart,GSE104057,Transcriptome Analysis,Development of specialized cell types and structures in the vertebrate heart is regulated by spatially restricted molecular pathways. Disruptions in these pathways can cause severe congenital cardiac malformations or functional defects. To better understand these pathways and how they regulate cardiac development and function we used tomo seq  combining high throughput RNA sequencing with tissue sectioning  to establish a genome wide expression dataset with high spatial resolution for the developing zebrafish heart. Analysis of the dataset revealed over 1100 genes differentially expressed in sub compartments. Pacemaker cells in the sinoatrial region induce heart contractions  but little is known about the mechanisms underlying their development and function. Using our transcriptome map  we identified spatially restricted Wnt/ß catenin signaling activity in pacemaker cells  which was controlled by Islet 1 activity. Moreover  Wnt/ß catenin signaling at a specific developmental stage in the myocardium controls heart rate by regulating pacemaker cellular response to parasympathetic stimuli. Thus  this high resolution transcriptome map incorporating all cell types in the embryonic heart can expose spatially restricted molecular pathways critical for specific cardiac functions. Overall design: To generate spatially resolved RNA seq data for the developing zebrafish hearts 2 dpf  we cryosectioned 3 hearts  extracted RNA from the individual sections  amplified and barcoded mRNA using the CEL seq protocol Hashimshony et al.  Cell Reports  2012 with a few modifications. Libraries were sequenced on Illumina NextSeq using 75bp paired end sequencing. Sample Heart #1 is the primary sample. Heart #2 and #3 are biological replicates used for comparison.,,pubmed:29400650,,heart1 2dpf wt,GSM2788518,,source name:isolated embryonic heart|tissue:embryonic heart|developmental stage:48 hpf direction:anterior/outflow tract to posterior/inflow tract; located in sections #2   #41|section thickness:10µm sections,heart1 2dpf wt,Paired end reads were aligned to the transcriptome using bwa version 0.6.2 with default parameters. The zebrafish transcriptome was based on genome release zv9 and contained improved gene annotations as described in Junker et al. 2014 Cell. The right mate of each read pair was mapped to the ensemble of all transcripts and to the set of 92 ERCC spike ins in sense direction. Reads mapping equally to multiple loci were discarded. Mapped reads were assigned to sections based on barcodes according to the CEL seq protocol Hashimshony et al.  Cell Reports  2012 processed data files contain transcript read counts normalized against spike in read count and total read count per section Genome build: zv9 with improved three prime annotation  see Junker et al 2014 Cell Supplementary files format and content: csv file containing transcript counts per gene rows and section columns,isolated embryonic heart,Unfixed embryonic hearts were dissected and embedded in tissue freezing medium. Blocks were cryosectioned  and individual sections were transferred to Eppendorf tubes on dry ice. For extended experimental procedure see also Junker et al. 2014 Cell.,Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al.  Cell Reports  2012  see also: Junker et al.  2014  Cell CEL seq protocol Hashimshony et al.  Cell Reports  2012; also  see: Junker et al.  2014  Cell,,tissue:embryonic heart|developmental stage:48 hpf direction:anterior/outflow tract to posterior/inflow tract; located in sections #2   #41|section thickness:10µm sections,GSM2788518,GSM2788518: heart1 2dpf wt; Danio rerio; RNA Seq,GSM2788518,,1,Total RNA was isolated by TRIzol extraction. mRNA was barcoded and amplified using the CEL seq protocol Hashimshony et al.  Cell Reports  2012  see also: Junker et al.  2014  Cell CEL seq protocol Hashimshony et al.  Cell Reports  2012; also  see: Junker et al.  2014  Cell,GEO Accession:GSM2788518,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,NextSeq 500,,SRP118319,,,heart_01_SB-06-2dpf_wt_R2.fastq.gz heart_01_SB-06-2dpf_wt_R1.fastq.gz,fastq fastq,8152229052.0,54104958.0,GSM2788518 r1,0:75.41 1:75.27,A:2955268830;C:1118145970;G:1152323290;T:2924136690;N:2354272,75,75,,,2955268830,1118145970,1152323290,2924136690,2354272,SRX3201030,SRS2528002,SRA610777,GEO,"Jeroen Bakkers lab, Cardiac Development and Genetics, Hubrecht Institute",2,0.02706,0.26955,0.01984,0.05871,0.99675,0.93194,0.37979,0.63172,76,76,T,B,mate1 technical by mapping diff,illumina,nextseq,unknown,cdna_unspecified,unknown,sc,single_cell_plate,celseq,,Netherlands,2017-09-20,Hatching,Embryo,Heart,Cardiovascular System
48199,SRR7119866,SRX4041509,SRS3258988,SRP144601,PRJNA459724,The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis,GSE114038,Other,Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively,,pubmed:30867528,,Danio rerio RNAseq singleHeart 2dpf mut 35,GSM3131257,,tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,Danio rerio RNAseq singleHeart 2dpf mut 35,RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format,heart,,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,Zebrafish Danio rerio  were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.,strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,GSM3131257,GSM3131257: Danio rerio RNAseq singleHeart 2dpf mut 35; Danio rerio; RNA Seq,GSM3131257,,1,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,GEO Accession:GSM3131257,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP144601,,,NDCII_1_35_NDCII_sample_0035.fastq.gz,fastq,137582100.0,1834428.0,GSM3131257 r1,0:75,A:42420010;C:23366189;G:30187957;T:41528798;N:79146,75,,,,42420010,23366189,30187957,41528798,79146,SRX4041509,SRS3258988,SRA699717,GEO,"Molecular Biology, Radboud University",1,0.69634,,0.15154,,0.85827,,0.50259,,75,,B,,usable mapping rate,illumina,nextseq,unknown,rrna_depletion,ribozero,sc,single_cell_plate,celseq,,Netherlands,2018-05-04,Hatching,Embryo,Heart,Cardiovascular System
48200,SRR7119865,SRX4041508,SRS3258987,SRP144601,PRJNA459724,The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis,GSE114038,Other,Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively,,pubmed:30867528,,Danio rerio RNAseq singleHeart 2dpf mut 34,GSM3131256,,tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,Danio rerio RNAseq singleHeart 2dpf mut 34,RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format,heart,,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,Zebrafish Danio rerio  were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.,strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,GSM3131256,GSM3131256: Danio rerio RNAseq singleHeart 2dpf mut 34; Danio rerio; RNA Seq,GSM3131256,,1,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,GEO Accession:GSM3131256,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP144601,,,NDCII_1_34_NDCII_sample_0034.fastq.gz,fastq,115231725.0,1536423.0,GSM3131256 r1,0:75,A:36189151;C:19748534;G:25280516;T:33944039;N:69485,75,,,,36189151,19748534,25280516,33944039,69485,SRX4041508,SRS3258987,SRA699717,GEO,"Molecular Biology, Radboud University",1,0.65755,,0.14147,,0.8635,,0.53314,,75,,B,,usable mapping rate,illumina,nextseq,unknown,rrna_depletion,ribozero,sc,single_cell_plate,celseq,,Netherlands,2018-05-04,Hatching,Embryo,Heart,Cardiovascular System
48201,SRR7119864,SRX4041507,SRS3258986,SRP144601,PRJNA459724,The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis,GSE114038,Other,Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively,,pubmed:30867528,,Danio rerio RNAseq singleHeart 2dpf mut 33,GSM3131255,,tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,Danio rerio RNAseq singleHeart 2dpf mut 33,RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format,heart,,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,Zebrafish Danio rerio  were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.,strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,GSM3131255,GSM3131255: Danio rerio RNAseq singleHeart 2dpf mut 33; Danio rerio; RNA Seq,GSM3131255,,1,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,GEO Accession:GSM3131255,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP144601,,,NDCII_1_33_NDCII_sample_0033.fastq.gz,fastq,86985525.0,1159807.0,GSM3131255 r1,0:75,A:27397325;C:14512545;G:19080050;T:25941403;N:54202,75,,,,27397325,14512545,19080050,25941403,54202,SRX4041507,SRS3258986,SRA699717,GEO,"Molecular Biology, Radboud University",1,0.63426,,0.16676,,0.87568,,0.5457,,75,,B,,usable mapping rate,illumina,nextseq,unknown,rrna_depletion,ribozero,sc,single_cell_plate,celseq,,Netherlands,2018-05-04,Hatching,Embryo,Heart,Cardiovascular System
48202,SRR7119863,SRX4041506,SRS3258985,SRP144601,PRJNA459724,The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis,GSE114038,Other,Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively,,pubmed:30867528,,Danio rerio RNAseq singleHeart 2dpf mut 32,GSM3131254,,tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,Danio rerio RNAseq singleHeart 2dpf mut 32,RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format,heart,,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,Zebrafish Danio rerio  were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.,strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,GSM3131254,GSM3131254: Danio rerio RNAseq singleHeart 2dpf mut 32; Danio rerio; RNA Seq,GSM3131254,,1,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,GEO Accession:GSM3131254,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP144601,,,NDCII_1_32_NDCII_sample_0032.fastq.gz,fastq,64224375.0,856325.0,GSM3131254 r1,0:75,A:20154725;C:11180349;G:13983116;T:18869397;N:36788,75,,,,20154725,11180349,13983116,18869397,36788,SRX4041506,SRS3258985,SRA699717,GEO,"Molecular Biology, Radboud University",1,0.65978,,0.16164,,0.8775,,0.54741,,75,,B,,usable mapping rate,illumina,nextseq,unknown,rrna_depletion,ribozero,sc,single_cell_plate,celseq,,Netherlands,2018-05-04,Hatching,Embryo,Heart,Cardiovascular System
48203,SRR7119862,SRX4041505,SRS3258984,SRP144601,PRJNA459724,The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis,GSE114038,Other,Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively,,pubmed:30867528,,Danio rerio RNAseq singleHeart 2dpf mut 31,GSM3131253,,tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,Danio rerio RNAseq singleHeart 2dpf mut 31,RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format,heart,,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,Zebrafish Danio rerio  were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.,strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,GSM3131253,GSM3131253: Danio rerio RNAseq singleHeart 2dpf mut 31; Danio rerio; RNA Seq,GSM3131253,,1,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,GEO Accession:GSM3131253,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP144601,,,NDCII_1_31_NDCII_sample_0031.fastq.gz,fastq,159901350.0,2132018.0,GSM3131253 r1,0:75,A:50993443;C:26156045;G:34865968;T:47792042;N:93852,75,,,,50993443,26156045,34865968,47792042,93852,SRX4041505,SRS3258984,SRA699717,GEO,"Molecular Biology, Radboud University",1,0.6343,,0.22382,,0.84707,,0.44037,,75,,B,,usable mapping rate,illumina,nextseq,unknown,rrna_depletion,ribozero,sc,single_cell_plate,celseq,,Netherlands,2018-05-04,Hatching,Embryo,Heart,Cardiovascular System
48204,SRR7119861,SRX4041504,SRS3258983,SRP144601,PRJNA459724,The Polycomb Group protein Rnf2/Ring1b is essential for zebrafish development and cardiogenesis,GSE114038,Other,Goal of the experiment was to assess the differences in gene expression between zygotic rnf2 mutant zebrafish embryos and wildtype embryos at 3 dpf. The goal of ChIP sequencing of wildtype embryos at 3 dpf is to link deregulation in gene expression to the Rnf2 occupancy in the wildtype situation and check the overlap between Rnf2 and H3K27me3. The RNA sequencing of single hearts was performed to assess differences in gene expression between zygotic rn2 mutants hearts and wildtype hearts at 3 different stages 1  2  3 dpf Overall design: RNAseq of 3dpf Danio rerio whole embyos  wild types and rnf2 mutants 8 and 7 replicates  respectively; ChIPseq for rnf2 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in;  ChIPseq for H327me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 2 replicates embryos; ChIPseq for H3K27me3 in 3dpf Danio rerio wild type 2 replicates and rnf2 mutant 1 sample embryos all 3 with Drosophila spike in; RNAseq of 1  2 dpf and 3 dpf Danio rerio dissected hearts  wild types 9  13 and 10 replicates  respectively and rnf2 mutants 8  9 and 9 replicates  respectively,,pubmed:30867528,,Danio rerio RNAseq singleHeart 2dpf mut 29,GSM3131252,,tissue:heart|strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,Danio rerio RNAseq singleHeart 2dpf mut 29,RNA seq reads from whole embryos were mapped to genome GRCz10 + transcriptome v87 from ensembl using STAR version 2.5.2b with   quantMode geneCounts Batch effect was removed with R package RUVseq version 1.10.0 obtaining final normalized counts with DESeq2 version 1.16.1 ChIPseq reads were aligned to the genome GRCz10 using bwa version 0.7.15 with default parameters Aligned reads were further processed removing multimappers and duplicated reads using Picard MarkDuplicates 2.8.2 ChIP seq peaks were called using macs2 version 2.1.1 with qvalue cutoff=1e 02 relative to respective ChIP input track. RNAseq reads from dissected hearts were demultiplexed and processed following the CEL Seq pipeline https://github.com/yanailab/CEL Seq pipeline Normalized counts were obtained with Monocle version 2.4.0 Genome build: GRCz10 Supplementary files format and content: Gene counts .txt; peak files in BED format,heart,,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,Zebrafish Danio rerio  were housed at 27.5°C in a 14/10h light/dark cycle. The evening before spawning  one male and one female were placed into a tank with a divider and merged the following morning. Spontaneous spawning occurred when the male and female were put together at the moment the light turned on. Embryos were collected and staged according to Kimmel et al. Kimmel et al.  1995.,strain:TU/TLF mixed background|cell type:heart|age:2dpf|genotype:myl7:GFP rnf2 / ,GSM3131252,GSM3131252: Danio rerio RNAseq singleHeart 2dpf mut 29; Danio rerio; RNA Seq,GSM3131252,,1,RNA seq: Embryos of 3 dpf were homogenized in TRIzol and the ZYMO RNA microprep kit was used to isolate RNA and treat the samples with DNAseI. rRNA was depleted using the illumina RiboZero kit RNA seq: extraction was followed by fragmentation  cDNA synthesis  and KAPA HYPERprep library preparation,GEO Accession:GSM3131252,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,NextSeq 500,,SRP144601,,,NDCII_1_29_NDCII_sample_0029.fastq.gz,fastq,205405950.0,2738746.0,GSM3131252 r1,0:75,A:64163069;C:34538013;G:45210194;T:61373525;N:121149,75,,,,64163069,34538013,45210194,61373525,121149,SRX4041504,SRS3258983,SRA699717,GEO,"Molecular Biology, Radboud University",1,0.65436,,0.20449,,0.84831,,0.52226,,75,,B,,usable mapping rate,illumina,nextseq,unknown,rrna_depletion,ribozero,sc,single_cell_plate,celseq,,Netherlands,2018-05-04,Hatching,Embryo,Heart,Cardiovascular System