rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 5793,ERR1955208,ERX2020800,ERS1697077,ERP017053,PRJEB15333,Transposon driven transcription is a conserved feature of vertebrate spermatogenesis and transcript evolution,ena-STUDY-EMBL EUROPEAN BIOINFORMATICS INSTITUTE-07-09-2016-10:25:55:499-247,Other,In order to better understand the features associated with male germline transcription we profiled the RNA expression in a number of germline cell types. These include spermatogonial stem cells spermatocytes and round spermatids in mouse and spermatocytes in rat. We also profiled the transcription in zebrafish testes. As a consequence it became apparent that transposable elements are driving considerable lncRNA expression in the later stages of spermatogenesis. This is particularly apparent in the case of endogenous retroviruses in rodents.,ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 05 08,,,Transcriptional profiling of zebrafish testes for analysis of conserved repeat element associations,SAMEA104033184,EMBL EUROPEAN BIOINFORMATICS INSTITUTE,ENA FIRST PUBLIC:2017 05 10T17:01:28Z|ENA LAST UPDATE:2017 04 28T10:34:37Z|External Id:SAMEA104033184|INSDC center name:EMBL EUROPEAN BIOINFORMATICS INSTITUTE|INSDC first public:2017 05 10T17:01:28Z|INSDC last update:2017 04 28T10:34:37Z|INSDC status:public|Submitter Id:Zebrafish.Testis 2|common name:zebrafish|sample name:Zebrafish.Testis 2|scientific name:Danio rerio|strain:AB|tissue type:testis,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,ena EXPERIMENT EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 16,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP017053,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2017 05 10|ENA LAST UPDATE:2018 11 16,zebrafish_testis_2.conserved.1.fastq.gz zebrafish_testis_2.conserved.2.fastq.gz,fastq fastq,46555372886.0,230472143.0,ena RUN EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 16,0:101 1:101,A:12260062264;C:10888457642;G:11605642683;T:11637267744;N:163942553,101,101,,,12260062264,10888457642,11605642683,11637267744,163942553,ERX2020800,ERS1697077,ERA904389,EMBL EUROPEAN BIOINFORMATICS INSTITUTE|European Nucleotide Archive,EMBL EUROPEAN BIOINFORMATICS INSTITUTE,2,0.93165,0.92785,0.29822,0.32141,0.71386,0.71971,0.66173,0.63843,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2017-01-31,Undetermined,Undetermined,Gonad,Reproductive System 5794,ERR1955207,ERX2020799,ERS1697076,ERP017053,PRJEB15333,Transposon driven transcription is a conserved feature of vertebrate spermatogenesis and transcript evolution,ena-STUDY-EMBL EUROPEAN BIOINFORMATICS INSTITUTE-07-09-2016-10:25:55:499-247,Other,In order to better understand the features associated with male germline transcription we profiled the RNA expression in a number of germline cell types. These include spermatogonial stem cells spermatocytes and round spermatids in mouse and spermatocytes in rat. We also profiled the transcription in zebrafish testes. As a consequence it became apparent that transposable elements are driving considerable lncRNA expression in the later stages of spermatogenesis. This is particularly apparent in the case of endogenous retroviruses in rodents.,ENA FIRST PUBLIC:2017 01 31|ENA LAST UPDATE:2017 05 08,,,Transcriptional profiling of zebrafish testes for analysis of conserved repeat element associations,SAMEA104033183,EMBL EUROPEAN BIOINFORMATICS INSTITUTE,ENA FIRST PUBLIC:2017 05 10T17:01:28Z|ENA LAST UPDATE:2017 04 28T10:34:37Z|External Id:SAMEA104033183|INSDC center name:EMBL EUROPEAN BIOINFORMATICS INSTITUTE|INSDC first public:2017 05 10T17:01:28Z|INSDC last update:2017 04 28T10:34:37Z|INSDC status:public|Submitter Id:Zebrafish.Testis 1|common name:zebrafish|sample name:Zebrafish.Testis 1|scientific name:Danio rerio|strain:AB|tissue type:testis,,,,,,,,,Illumina HiSeq 2000 paired end sequencing,ena EXPERIMENT EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 15,unspecified,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP017053,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2017 05 10|ENA LAST UPDATE:2018 11 16,zebrafish_testis_1.conserved.1.fastq.gz zebrafish_testis_1.conserved.2.fastq.gz,fastq fastq,41056086708.0,203247954.0,ena RUN EMBL EUROPEAN BIOINFORMATICS INSTITUTE 03 05 2017 17:32:41:660 15,0:101 1:101,A:10675591750;C:9672762387;G:10139834713;T:10380949257;N:186948601,101,101,,,10675591750,9672762387,10139834713,10380949257,186948601,ERX2020799,ERS1697076,ERA904389,EMBL EUROPEAN BIOINFORMATICS INSTITUTE|European Nucleotide Archive,EMBL EUROPEAN BIOINFORMATICS INSTITUTE,2,0.92308,0.9157,0.30221,0.31293,0.68276,0.68836,0.56114,0.5857,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2017-01-31,Undetermined,Undetermined,Gonad,Reproductive System 24594,SRR25462243,SRX21195038,SRS18453964,SRP452269,PRJNA1000446,Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish,GSE239623,Transcriptome Analysis,Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.,,,,PV M3,GSM7669033,,source name:follicle|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:MT ybx1 / |geo loc name:missing|collection date:missing,PV M3,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file,follicle,,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:MT ybx1 / ,GSM7669033,GSM7669033: PV M3; Danio rerio; RNA Seq,GSM7669033 r1,GSM7669033,1,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP452269,,,PV_M3_R1.fastq.gz PV_M3_R2.fastq.gz,fastq fastq,4644457090.0,23465750.0,GSM7669033 r1,0:98.98 1:98.94,A:1196567358;C:1114203322;G:1109379777;T:1223156356;N:1150277,98,98,,,1196567358,1114203322,1109379777,1223156356,1150277,SRX21195038,SRS18453964,,,"Karp 12006A, Biology of Vascular Program, Boston Children's Hospital",2,0.94849,0.95248,0.02727,0.02708,0.73602,0.73718,0.48396,0.4855,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,United States,2023-07-31,Undetermined,Embryo,Gonad,Reproductive System 24595,SRR25462244,SRX21195037,SRS18453963,SRP452269,PRJNA1000446,Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish,GSE239623,Transcriptome Analysis,Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.,,,,PV M2,GSM7669032,,source name:follicle|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:MT ybx1 / |geo loc name:missing|collection date:missing,PV M2,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file,follicle,,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:MT ybx1 / ,GSM7669032,GSM7669032: PV M2; Danio rerio; RNA Seq,GSM7669032 r1,GSM7669032,1,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP452269,,,PV_M2_R1.fastq.gz PV_M2_R2.fastq.gz,fastq fastq,2464506276.0,12449948.0,GSM7669032 r1,0:98.99 1:98.96,A:632587002;C:593372099;G:591579950;T:646214108;N:753117,98,98,,,632587002,593372099,591579950,646214108,753117,SRX21195037,SRS18453963,,,"Karp 12006A, Biology of Vascular Program, Boston Children's Hospital",2,0.94889,0.9522,0.02585,0.02585,0.73669,0.73841,0.48398,0.48486,100,99,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,United States,2023-07-31,Undetermined,Embryo,Gonad,Reproductive System 24596,SRR25462245,SRX21195036,SRS18453962,SRP452269,PRJNA1000446,Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish,GSE239623,Transcriptome Analysis,Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.,,,,PV M1,GSM7669031,,source name:follicle|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:MT ybx1 / |geo loc name:missing|collection date:missing,PV M1,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file,follicle,,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:MT ybx1 / ,GSM7669031,GSM7669031: PV M1; Danio rerio; RNA Seq,GSM7669031 r1,GSM7669031,1,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP452269,,,PV_M1_R1.fastq.gz PV_M1_R2.fastq.gz,fastq fastq,3634173229.0,18461903.0,GSM7669031 r1,0:98.44 1:98.41,A:930322973;C:875929476;G:875710056;T:948595199;N:3615525,98,98,,,930322973,875929476,875710056,948595199,3615525,SRX21195036,SRS18453962,,,"Karp 12006A, Biology of Vascular Program, Boston Children's Hospital",2,0.94787,0.95134,0.02457,0.02445,0.73762,0.73843,0.48244,0.48069,100,98,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,United States,2023-07-31,Undetermined,Embryo,Gonad,Reproductive System 24597,SRR25462246,SRX21195035,SRS18453961,SRP452269,PRJNA1000446,Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish,GSE239623,Transcriptome Analysis,Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.,,,,PV WT3,GSM7669030,,source name:follicle|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT ybx1+/+|geo loc name:missing|collection date:missing,PV WT3,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file,follicle,,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT ybx1+/+,GSM7669030,GSM7669030: PV WT3; Danio rerio; RNA Seq,GSM7669030 r1,GSM7669030,1,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP452269,,,PV_WT3_R2.fastq PV_WT3_R1.fastq,fastq fastq,2965772270.0,14976621.0,GSM7669030 r1,0:99.03 1:98.99,A:759343389;C:716154246;G:713466520;T:775995980;N:812135,99,98,,,759343389,716154246,713466520,775995980,812135,SRX21195035,SRS18453961,,,"Karp 12006A, Biology of Vascular Program, Boston Children's Hospital",2,0.95027,0.95485,0.02356,0.02292,0.74422,0.74554,0.47974,0.48267,100,98,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,United States,2023-07-31,Undetermined,Embryo,Gonad,Reproductive System 24598,SRR25462247,SRX21195034,SRS18453960,SRP452269,PRJNA1000446,Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish,GSE239623,Transcriptome Analysis,Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.,,,,PV WT2,GSM7669029,,source name:follicle|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT ybx1+/+|geo loc name:missing|collection date:missing,PV WT2,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file,follicle,,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT ybx1+/+,GSM7669029,GSM7669029: PV WT2; Danio rerio; RNA Seq,GSM7669029 r1,GSM7669029,1,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP452269,,,PV_WT2_R2.fastq PV_WT2_R1.fastq,fastq fastq,2021387268.0,10195384.0,GSM7669029 r1,0:99.15 1:99.12,A:517788644;C:487363563;G:485168383;T:530550229;N:516449,99,99,,,517788644,487363563,485168383,530550229,516449,SRX21195034,SRS18453960,,,"Karp 12006A, Biology of Vascular Program, Boston Children's Hospital",2,0.95113,0.9544,0.02394,0.02364,0.74168,0.74363,0.47881,0.47499,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,United States,2023-07-31,Undetermined,Embryo,Gonad,Reproductive System 24599,SRR25462248,SRX21195033,SRS18453959,SRP452269,PRJNA1000446,Genetic Evidence for the Gatekeeping Role of Ybx1 in Controlling Follicle Activation and Early Folliculogenesis by Regulation of Cdkn1a in the Zebrafish,GSE239623,Transcriptome Analysis,Y box binding protein 1 YB 1; Ybx1/ybx1 regulates transcription and translation of targeted genes by DNA/RNA binding. Our previous proteomic study demonstrated a dramatic drop in Ybx1 protein during follicle activation in zebrafish ovary. In this study we created an ybx1 mutant with CRISPR/Cas9 and showed that the folliculogenesis in the mutant ovary ybx1 / was blocked at pre vitellogenic PV to early vitellogenic EV transition leading to small ovaries. The mutant females were therefore sub fertile with reduced fecundity. RNA seq and Western blot analyses identified a variety of genes that showed differential expression between mutant ovary ybx1 / and the control ybx1+/ including cdkn1a p21. Disruption of cdkn1a resulted in embryonic lethality. In p21 heterozygous cdkn1a+/ however follicle activation and maturation in the ovary were both enhanced in contrast to ybx1 mutant ybx1 / . Interestingly partial loss of p21 in heterozygous cdkn1a+/ could rescue the phenotype of ybx1 mutant ybx1 / . Folliculogenesis resumed in ybx1 / ;p21+/ females with normal follicle activation in contrast to the PV EV blockade in ybx1 / mutant. Interestingly the follicle cells from the ybx1 / mutant follicles displayed a poor proliferative activity in vitro; however the cells from the ybx1 / p21+/ follicles resumed normal proliferation compared to that from the wildtype fish. In summary we demonstrated in this study that Ybx1 played a gatekeeping role in controlling PV to EV transition and it might act by suppressing the expression of cdkn1a a cell cycle inhibitor. Overall design: Considering our histological PV to EV follicle blockade we further isolated PV follicles from both WT ybx1+/+ and ybx1 / zebrafish. post RNA isolation we then estbalished bulk RNAseq libraries according to NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. post libraries preparation we performed sequencing using the Genomics Bioinformatics and Single Cell Analysis Core at the Univerisity of Macau.,,,,PV WT1,GSM7669028,,source name:follicle|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT ybx1+/+|geo loc name:missing|collection date:missing,PV WT1,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Zebrafish genome version GRCz11 from Ensemble using HiSat2 Stringtie was used to estimate transcript level counts. Bioconductor package tximport was used to import the gene level read counts from StringTie output files. This raw counts data was analyzed for differential gene expression using DESeq2 package. Assembly: GRCz11 Supplementary files format and content: Raw read counts in a TAB delimited file Supplementary files format and content: DESeq2 normalized read counts in a TAB delimited file,follicle,,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT ybx1+/+,GSM7669028,GSM7669028: PV WT1; Danio rerio; RNA Seq,GSM7669028 r1,GSM7669028,1,TRIzol reagent for RNA extraction NEBNext Ultra II Directional RNA Library Prep Kit for Illumina,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP452269,,,PV_WT1_R1.fastq PV_WT1_R2.fastq,fastq fastq,3244660111.0,16481925.0,GSM7669028 r1,0:98.44 1:98.42,A:831426044;C:781489498;G:779991004;T:848549246;N:3204319,98,98,,,831426044,781489498,779991004,848549246,3204319,SRX21195033,SRS18453959,,,"Karp 12006A, Biology of Vascular Program, Boston Children's Hospital",2,0.94779,0.95185,0.02328,0.02298,0.74294,0.74391,0.48052,0.47966,95,95,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,nebnext,bulk,bulk,bulk,,United States,2023-07-31,Undetermined,Embryo,Gonad,Reproductive System 25267,SRR25744342,SRX21467662,SRS18702380,SRP456724,PRJNA1008624,RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish,GSE241537,Transcriptome Analysis,The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each,,pubmed:38177902,,Gonad eif4e1b 3,GSM7730282,,source name:Ovary|tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b / |geo loc name:missing|collection date:missing,Gonad eif4e1b 3,RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts,Ovary,,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b / ,GSM7730282,GSM7730282: Gonad eif4e1b 3; Danio rerio; ssRNA seq,GSM7730282 r1,GSM7730282,1,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP456724,,loader:fastq load.py,Ovary_HOM3_1.fastq.gz Ovary_HOM3_2.fastq.gz,fastq fastq,2170738056.0,10746228.0,GSM7730282 r1,0:101 1:101,A:531993767;C:520631008;G:565772072;T:552334154;N:7055,101,101,,,531993767,520631008,565772072,552334154,7055,SRX21467662,SRS18702380,SRA1698764,IMP,IMP,2,0.77665,0.7702,0.14988,0.14284,0.66716,0.66957,0.49991,0.47425,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,rrna_depletion,ribozero,bulk,unknown,unknown,,Austria,2023-08-23,Undetermined,Juvenile,Gonad,Reproductive System 25268,SRR25744343,SRX21467661,SRS18702379,SRP456724,PRJNA1008624,RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish,GSE241537,Transcriptome Analysis,The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each,,pubmed:38177902,,Gonad eif4e1b 2,GSM7730281,,source name:Ovary|tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b / |geo loc name:missing|collection date:missing,Gonad eif4e1b 2,RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts,Ovary,,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b / ,GSM7730281,GSM7730281: Gonad eif4e1b 2; Danio rerio; ssRNA seq,GSM7730281 r1,GSM7730281,1,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP456724,,loader:fastq load.py,Ovary_HOM2_1.fastq.gz Ovary_HOM2_2.fastq.gz,fastq fastq,3459149000.0,17124500.0,GSM7730281 r1,0:101 1:101,A:876732239;C:796603142;G:882912604;T:902886783;N:14232,101,101,,,876732239,796603142,882912604,902886783,14232,SRX21467661,SRS18702379,SRA1698764,IMP,IMP,2,0.81761,0.79589,0.26282,0.24746,0.70607,0.7039,0.50658,0.49236,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,rrna_depletion,ribozero,bulk,unknown,unknown,,Austria,2023-08-23,Undetermined,Juvenile,Gonad,Reproductive System 25269,SRR25744344,SRX21467660,SRS18702381,SRP456724,PRJNA1008624,RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish,GSE241537,Transcriptome Analysis,The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each,,pubmed:38177902,,Gonad eif4e1b 1,GSM7730280,,source name:Ovary|tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b / |geo loc name:missing|collection date:missing,Gonad eif4e1b 1,RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts,Ovary,,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b / ,GSM7730280,GSM7730280: Gonad eif4e1b 1; Danio rerio; ssRNA seq,GSM7730280 r1,GSM7730280,1,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP456724,,loader:fastq load.py,Ovary_HOM1_1.fastq.gz Ovary_HOM1_2.fastq.gz,fastq fastq,2189781202.0,10840501.0,GSM7730280 r1,0:101 1:101,A:537591255;C:525448020;G:568979980;T:557754770;N:7177,101,101,,,537591255,525448020,568979980,557754770,7177,SRX21467660,SRS18702381,SRA1698764,IMP,IMP,2,0.7459,0.74191,0.15778,0.15291,0.65543,0.65841,0.48578,0.48291,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,rrna_depletion,ribozero,bulk,unknown,unknown,,Austria,2023-08-23,Undetermined,Juvenile,Gonad,Reproductive System 25270,SRR25744345,SRX21467659,SRS18702378,SRP456724,PRJNA1008624,RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish,GSE241537,Transcriptome Analysis,The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each,,pubmed:38177902,,Gonad WT 3,GSM7730279,,source name:Ovary|tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b +/+|geo loc name:missing|collection date:missing,Gonad WT 3,RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts,Ovary,,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b +/+,GSM7730279,GSM7730279: Gonad WT 3; Danio rerio; ssRNA seq,GSM7730279 r1,GSM7730279,1,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP456724,,loader:fastq load.py,Ovary_WT3_1.fastq.gz Ovary_WT3_2.fastq.gz,fastq fastq,3674041448.0,18188324.0,GSM7730279 r1,0:101 1:101,A:910831144;C:876967044;G:953299105;T:932928913;N:15242,101,101,,,910831144,876967044,953299105,932928913,15242,SRX21467659,SRS18702378,SRA1698764,IMP,IMP,2,0.89093,0.89038,0.09253,0.09348,0.73892,0.73858,0.47115,0.47218,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,rrna_depletion,ribozero,bulk,unknown,unknown,,Austria,2023-08-23,Undetermined,Juvenile,Gonad,Reproductive System 25271,SRR25744346,SRX21467658,SRS18702377,SRP456724,PRJNA1008624,RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish,GSE241537,Transcriptome Analysis,The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each,,pubmed:38177902,,Gonad WT 2,GSM7730278,,source name:Ovary|tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b +/+|geo loc name:missing|collection date:missing,Gonad WT 2,RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts,Ovary,,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b +/+,GSM7730278,GSM7730278: Gonad WT 2; Danio rerio; ssRNA seq,GSM7730278 r1,GSM7730278,1,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP456724,,loader:fastq load.py,Ovary_WT2_1.fastq.gz Ovary_WT2_2.fastq.gz,fastq fastq,3024886370.0,14974685.0,GSM7730278 r1,0:101 1:101,A:744374909;C:727299396;G:782294774;T:770904797;N:12494,101,101,,,744374909,727299396,782294774,770904797,12494,SRX21467658,SRS18702377,SRA1698764,IMP,IMP,2,0.91806,0.91689,0.06949,0.07178,0.74458,0.74474,0.47548,0.47338,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,rrna_depletion,ribozero,bulk,unknown,unknown,,Austria,2023-08-23,Undetermined,Juvenile,Gonad,Reproductive System 25272,SRR25744347,SRX21467657,SRS18702376,SRP456724,PRJNA1008624,RNA seq of female gonads isolated from juvenile eif4e1b mutant and wild type zebrafish,GSE241537,Transcriptome Analysis,The mRNA cap binding protein eIF4E1b is critical for female germline development in zebrafish. To study the effect of eIF4E1b loss in zebrafish we isolated gonads with a high expression of ziwi:GFP female germline marker from wild type and eif4e1b mutant juveniles and performed RNA seq. Overall design: We performed differential expression gene analyses of wild type and eif4e1b mutant gonads n = 3 biological replicates containing 3 gonads each,,pubmed:38177902,,Gonad WT 1,GSM7730277,,source name:Ovary|tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b +/+|geo loc name:missing|collection date:missing,Gonad WT 1,RNA seq reads were trimmed using trim galore v0.5.0 and reads mapping to abundant sequences Dr mitochondrial chromosome SILVA Dr ribosomal RNA phiX174 genome were removed using bowtie2 v2.3.4.1 alignment. Remaining reads were analyzed using genome and gene annotation for the GRCz11 assembly obtained from Danio rerio Ensembl release 104. Reads were aligned to the genome using star v2.6.0c and reads in genes were counted with featureCounts subread v1.6.2. Differential gene expression analysis on raw counts and variance stabilized transformation of count data for heatmap visualization were performed using DESeq2 v1.18.1. Functional annotation enrichment analysis of differentially expressed genes was conducted using clusterprofiler v3.6.0 in R v3.4.1. Assembly: GRCz11 Supplementary files format and content: Tab delimited text files with per gene read counts,Ovary,,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,tissue:Ovary|Sex:female|cell type:Gonad|genotype:tgziwi:GFP eif4e1b +/+,GSM7730277,GSM7730277: Gonad WT 1; Danio rerio; ssRNA seq,GSM7730277 r1,GSM7730277,1,RNeasy Mini Kit Qiagen SMARTerStrandedRNA library Ribo Zero,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP456724,,loader:fastq load.py,Ovary_WT1_2.fastq.gz Ovary_WT1_1.fastq.gz,fastq fastq,3571638356.0,17681378.0,GSM7730277 r1,0:101 1:101,A:876280472;C:856417516;G:935896746;T:903028845;N:14777,101,101,,,876280472,856417516,935896746,903028845,14777,SRX21467657,SRS18702376,SRA1698764,IMP,IMP,2,0.89559,0.89353,0.09223,0.09423,0.73052,0.73012,0.47772,0.47408,101,101,B,B,biological fallback assumption,illumina,novaseq_era,full_length,rrna_depletion,ribozero,bulk,unknown,unknown,,Austria,2023-08-23,Undetermined,Juvenile,Gonad,Reproductive System 30556,SRR27836071,SRX23499420,SRS20351177,SRP487485,PRJNA1072072,Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios,GSE254850,Transcriptome Analysis,Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential Gene Expression Analysis.,,pubmed:38898112,,Rbpms2 mApple crosslinked SR3,GSM8059038,,source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing,Rbpms2 mApple crosslinked SR3,Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample,Gonad,,RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589,,tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype,GSM8059038,GSM8059038: Rbpms2 mApple crosslinked SR3; Danio rerio; RNA Seq,GSM8059038 r1,GSM8059038,1,RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP487485,,,SR-3_S4_L001_R1_001.fastq.gz SR-3_S4_L001_R2_001.fastq.gz,fastq fastq,588252864.0,3949222.0,GSM8059038 r1,0:74.42 1:74.53,A:116383167;C:176622592;G:176850622;T:118306997;N:89486,74,74,,,116383167,176622592,176850622,118306997,89486,SRX23499420,SRS20351177,SRA1796363,"Marlow, CDRB, Icahn School of Medicine Mount Sinai","Marlow, CDRB, Icahn School of Medicine Mount Sinai",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-02-01,Undetermined,Undetermined,Gonad,Reproductive System 30557,SRR27836072,SRX23499419,SRS20351178,SRP487485,PRJNA1072072,Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios,GSE254850,Transcriptome Analysis,Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential Gene Expression Analysis.,,pubmed:38898112,,Rbpms2 mApple uncrosslinked SR2,GSM8059037,,source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing,Rbpms2 mApple uncrosslinked SR2,Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample,Gonad,,RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589,,tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype,GSM8059037,GSM8059037: Rbpms2 mApple uncrosslinked SR2; Danio rerio; RNA Seq,GSM8059037 r1,GSM8059037,1,RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP487485,,,SR-2_S3_L001_R1_001.fastq.gz SR-2_S3_L001_R2_001.fastq.gz,fastq fastq,547329260.0,3670350.0,GSM8059037 r1,0:74.51 1:74.61,A:109193152;C:163365002;G:162344228;T:112378069;N:48809,74,74,,,109193152,163365002,162344228,112378069,48809,SRX23499419,SRS20351178,SRA1796363,"Marlow, CDRB, Icahn School of Medicine Mount Sinai","Marlow, CDRB, Icahn School of Medicine Mount Sinai",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-02-01,Undetermined,Undetermined,Gonad,Reproductive System 30558,SRR27836073,SRX23499418,SRS20351176,SRP487485,PRJNA1072072,Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios,GSE254850,Transcriptome Analysis,Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential Gene Expression Analysis.,,pubmed:38898112,,mApple control crosslinked SR8,GSM8059036,,source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing,mApple control crosslinked SR8,Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample,Gonad,,RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589,,tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype,GSM8059036,GSM8059036: mApple control crosslinked SR8; Danio rerio; RNA Seq,GSM8059036 r1,GSM8059036,1,RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP487485,,,SR-8_S6_L001_R1_001.fastq.gz SR-8_S6_L001_R2_001.fastq.gz,fastq fastq,474378287.0,3180744.0,GSM8059036 r1,0:74.52 1:74.62,A:90310344;C:145884340;G:146185172;T:91942086;N:56345,74,74,,,90310344,145884340,146185172,91942086,56345,SRX23499418,SRS20351176,SRA1796363,"Marlow, CDRB, Icahn School of Medicine Mount Sinai","Marlow, CDRB, Icahn School of Medicine Mount Sinai",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-02-01,Undetermined,Undetermined,Gonad,Reproductive System 30559,SRR27836074,SRX23499417,SRS20351175,SRP487485,PRJNA1072072,Rbpms2 promotes female fate upstream of the nutrient sensing Gator2 complex component Mios,GSE254850,Transcriptome Analysis,Reproductive success relies on proper establishment and maintenance of biological sex. In many animals including mammals the primary gonad is initially ovary in character. We previously showed the RNA binding protein RNAbp Rbpms2 is required for ovary fate in zebrafish. Here we identified Rbpms2 targets in oocytesRbpms2 bound oocyte RNAs; rboRNAs. We identify Rbpms2 as a translational regulator ofrboRNAs which include testis factors and ribosome biogenesis factors. Further genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway specifically through the mTorc1 activating Gap activity towards Rags 2 Gator2 component Missing oocyte Mios. Cumulatively our findings indicate that early gonocytes are in a dual poised bipotential state in which Rbpms2 acts as a binary fate switch. Specifically Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2 mediated checkpoint thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis. Overall design: To determine the RNA targets of Rbpms2 we generated wildtype female zebrafish expressing Rbpms2 mApple or mApple alone fusion proteins exclusively in the germline. Immunoprecipitation was performed in 2 adult female ovaries per transgene. Crosslinked and uncrosslinked samples for Rbpms2 mApple expressing fish and crosslined and uncrosslinked samples for mApple expressing fish were sequenced. RNAs found in the Rbpms2 mApple crosslinked and the mApple crosslinked and uncrosslinked datasets that were also present in the Rbpms2 mApple uncrosslinked dataset were excluded. RNAs present only in the uncrosslinked datasets were counted as RNA targets of Rbpms2. To characterize the transcriptional differences of rbpms2 mutants vs wildtype fish prior to sex determination 21 dpf we performed bulk RNA sequencing on n=3 dpf 21 dpf wildtype and n=3 rbpms2 mutant fish. DESeq was then performed for Differential Gene Expression Analysis.,,pubmed:38898112,,mApple control uncrosslinked SR6,GSM8059035,,source name:Gonad|tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype|geo loc name:missing|collection date:missing,mApple control uncrosslinked SR6,Basespace illumina platform was used and reads were mapped using tophate2 aligner. Estimation of reference genes and transcript was done using cufflinks and reads were mapped to the genome GRCz10. Reads were aligned with the TopHat Alignment App. GRCz10 CSV file that compiled includes tracking ids gene loci and FPKMs for each samples CSV files include tracking and gene id gene short name tss id locus and FPKM for each sample,Gonad,,RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589,,tissue:Gonad|cell type:Germline and somatic|genotype:Wildtype,GSM8059035,GSM8059035: mApple control uncrosslinked SR6; Danio rerio; RNA Seq,GSM8059035 r1,GSM8059035,1,RNA was extracted with an Rneasy Mini Kit Qiagen 74104 Libraries were generated with an Illumina Truseq RNA Library Prep kit Illumina 20020589,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP487485,,,SR-6_S5_L001_R1_001.fastq.gz SR-6_S5_L001_R2_001.fastq.gz,fastq fastq,1667210566.0,11187841.0,GSM8059035 r1,0:74.46 1:74.56,A:348153529;C:480420209;G:474792496;T:363567978;N:276354,74,74,,,348153529,480420209,474792496,363567978,276354,SRX23499417,SRS20351175,SRA1796363,"Marlow, CDRB, Icahn School of Medicine Mount Sinai","Marlow, CDRB, Icahn School of Medicine Mount Sinai",,,,,,,,,,,,B,B,biological fallback assumption,illumina,novaseq_era,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,United States,2024-02-01,Undetermined,Undetermined,Gonad,Reproductive System 32476,SRR29270149,SRX24787634,SRS21505104,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Mut 20 1,,strain:AB|age:20|collection date:2023 06 10|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Mut 20 1,E10,E10,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Mut-20-1_S162_R1.fastq.gz foxl2l_Mut-20-1_S162_R2.fastq.gz,fastq fastq,8940963680.0,29605840.0,foxl2l Mut 20 1 S162 R1.fastq.gz,0:151 1:151,A:2232167098;C:2229744850;G:2271326718;T:2207692629;N:32385,151,151,,,2232167098,2229744850,2271326718,2207692629,32385,SRX24787634,SRS21505104,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32477,SRR29270150,SRX24787633,SRS21505103,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Het 20 3,,strain:AB|age:20|collection date:2023 06 09|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Het 20 3,E9,E9,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Het-20-3_S161_R1.fastq.gz foxl2l_Het-20-3_S161_R2.fastq.gz,fastq fastq,7038409282.0,23305991.0,foxl2l Het 20 3 S161 R1.fastq.gz,0:151 1:151,A:1766863186;C:1740008639;G:1787471686;T:1744039429;N:26342,151,151,,,1766863186,1740008639,1787471686,1744039429,26342,SRX24787633,SRS21505103,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32478,SRR29270151,SRX24787632,SRS21505102,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Het 20 2,,strain:AB|age:20|collection date:2023 06 08|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Het 20 2,E8,E8,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Het-20-2_S160_R1.fastq.gz foxl2l_Het-20-2_S160_R2.fastq.gz,fastq fastq,6772505832.0,22425516.0,foxl2l Het 20 2 S160 R1.fastq.gz,0:151 1:151,A:1704124986;C:1673138074;G:1713003931;T:1682214009;N:24832,151,151,,,1704124986,1673138074,1713003931,1682214009,24832,SRX24787632,SRS21505102,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32479,SRR29270152,SRX24787631,SRS21505101,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Het 20 1,,strain:AB|age:20|collection date:2023 06 07|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Het 20 1,E7,E7,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Het-20-1_S159_R1.fastq.gz foxl2l_Het-20-1_S159_R2.fastq.gz,fastq fastq,11685740812.0,38694506.0,foxl2l Het 20 1 S159 R1.fastq.gz,0:151 1:151,A:2939618668;C:2888861085;G:2958173208;T:2899044704;N:43147,151,151,,,2939618668,2888861085,2958173208,2899044704,43147,SRX24787631,SRS21505101,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32480,SRR29270153,SRX24787630,SRS21505100,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Mut 15 3,,strain:AB|age:15|collection date:2023 06 06|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Mut 15 3,E6,E6,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Mut-15-3_S158_R1.fastq.gz foxl2l_Mut-15-3_S158_R2.fastq.gz,fastq fastq,9503789604.0,31469502.0,foxl2l Mut 15 3 S158 R1.fastq.gz,0:151 1:151,A:2393052443;C:2340958111;G:2411502428;T:2358240313;N:36309,151,151,,,2393052443,2340958111,2411502428,2358240313,36309,SRX24787630,SRS21505100,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32481,SRR29270154,SRX24787629,SRS21505099,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Mut 15 2,,strain:AB|age:15|collection date:2023 06 05|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Mut 15 2,E5,E5,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Mut-15-2_S157_R1.fastq.gz foxl2l_Mut-15-2_S157_R2.fastq.gz,fastq fastq,7416837026.0,24559063.0,foxl2l Mut 15 2 S157 R1.fastq.gz,0:151 1:151,A:1865711045;C:1830489703;G:1881612508;T:1838995980;N:27790,151,151,,,1865711045,1830489703,1881612508,1838995980,27790,SRX24787629,SRS21505099,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32482,SRR29270155,SRX24787628,SRS21505098,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Mut 15 1,,strain:AB|age:15|collection date:2023 06 04|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Mut 15 1,E4,E4,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Mut-15-1_S156_R1.fastq.gz foxl2l_Mut-15-1_S156_R2.fastq.gz,fastq fastq,7092721868.0,23485834.0,foxl2l Mut 15 1 S156 R1.fastq.gz,0:151 1:151,A:1764166761;C:1770534219;G:1820397492;T:1737597123;N:26273,151,151,,,1764166761,1770534219,1820397492,1737597123,26273,SRX24787628,SRS21505098,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32483,SRR29270156,SRX24787627,SRS21505097,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Het 15 3,,strain:AB|age:15|collection date:2023 06 03|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Het 15 3,E3,E3,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Het-15-3_S155_R1.fastq.gz foxl2l_Het-15-3_S155_R2.fastq.gz,fastq fastq,8083606820.0,26766910.0,foxl2l Het 15 3 S155 R1.fastq.gz,0:151 1:151,A:2028557443;C:2001113164;G:2050610840;T:2003295953;N:29420,151,151,,,2028557443,2001113164,2050610840,2003295953,29420,SRX24787627,SRS21505097,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32484,SRR29270157,SRX24787626,SRS21505096,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Mut 20 3,,strain:AB|age:20|collection date:2023 06 12|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Mut 20 3,E12,E12,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Mut-20-3_S164_R1.fastq.gz foxl2l_Mut-20-3_S164_R2.fastq.gz,fastq fastq,7474861796.0,24751198.0,foxl2l Mut 20 3 S164 R1.fastq.gz,0:151 1:151,A:1878881650;C:1849512621;G:1891142525;T:1855296720;N:28280,151,151,,,1878881650,1849512621,1891142525,1855296720,28280,SRX24787626,SRS21505096,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32485,SRR29270158,SRX24787625,SRS21505095,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Mut 20 2,,strain:AB|age:20|collection date:2023 06 11|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Mut 20 2,E11,E11,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Mut-20-2_S163_R1.fastq.gz foxl2l_Mut-20-2_S163_R2.fastq.gz,fastq fastq,8203704066.0,27164583.0,foxl2l Mut 20 2 S163 R1.fastq.gz,0:151 1:151,A:2061693689;C:2030126562;G:2072980952;T:2038873198;N:29665,151,151,,,2061693689,2030126562,2072980952,2038873198,29665,SRX24787625,SRS21505095,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32486,SRR29270159,SRX24787624,SRS21505094,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Het 15 2,,strain:AB|age:15|collection date:2023 06 02|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Het 15 2,E2,E2,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Het-15-2_S154_R1.fastq.gz foxl2l_Het-15-2_S154_R2.fastq.gz,fastq fastq,7868286860.0,26053930.0,foxl2l Het 15 2 S154 R1.fastq.gz,0:151 1:151,A:1972210357;C:1946891859;G:2008091153;T:1941064817;N:28674,151,151,,,1972210357,1946891859,2008091153,1941064817,28674,SRX24787624,SRS21505094,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 32487,SRR29270160,SRX24787623,SRS21505093,SRP511487,PRJNA1119569,RNA seq of zebrafish foxl2l mutant,PRJNA1119569,Other,Bulk seq of zebrafish foxl2l mutant at 15 dpf and 20 dpf. Each time point contain 3 heterozygous and 3 homozygous.,,,,,foxl2l Het 15 1,,strain:AB|age:15|collection date:2023 06 01|geo loc name:China|sex:hermaphrodite|tissue:gonad|BioSampleModel:Model organism or animal,,,,,,,,,foxl2l Het 15 1,E1,E1,50 ng of RNA was used to prepare VAHTS RNA seq Library using Universal V6 RNA seq Library Prep Kit for Illumina Vazeme NR604 01,,,RNA-Seq,TRANSCRIPTOMIC,PCR,PAIRED,ILLUMINA,NextSeq 500,,SRP511487,,,foxl2l_Het-15-1_S153_R1.fastq.gz foxl2l_Het-15-1_S153_R2.fastq.gz,fastq fastq,7117391946.0,23567523.0,foxl2l Het 15 1 S153 R1.fastq.gz,0:151 1:151,A:1795668098;C:1752824783;G:1793720116;T:1775153584;N:25365,151,151,,,1795668098,1752824783,1793720116,1775153584,25365,SRX24787623,SRS21505093,SRA1887976,"Institute of Hydrobiology, Chinese Academy of Sciences|Center for Fish Biology and Fishery Biotechnology","Institute of Hydrobiology, Chinese Academy of Sciences",,,,,,,,,,,,B,B,biological fallback assumption,illumina,nextseq,unknown,random_priming,unknown,bulk,bulk,bulk,,China,2024-06-03,Undetermined,Undetermined,Gonad,Reproductive System 36285,SRR363985,SRX105298,SRS270141,SRP009275,PRJNA148581,Hen1 analysis in zebrafish,GSE33582,Transcriptome Analysis,small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.,,pubmed:20859253,,wildtype ligation,GSM830247,,source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation,wildtype ligation,three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8,testis,,Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.,,strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:adapter ligation,GSM830247,GSM830247: wildtype ligation,GSM830247: wildtype ligation,GSM830247: wildtype ligation,1,,GEO Accession:GSM830247,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,460Application ReadForward1,SRP009275,,read name barcode proc directive:ignore,WTTESTIS.fastq,fastq,395791130.0,8604155.0,GSM830247 1,0:46,A:79045664;C:90489917;G:99082007;T:127024229;N:149313,46,,,,79045664,90489917,99082007,127024229,149313,SRX105298,SRS270141,SRA047996,GEO,"European Research Institute for the Biology of Ageing, University Medical Center Groningen",1,0.00021,,0.00015,,0.99989,,0.0,,46,,T,,under 1.2% mapping rate,illumina,early_illumina,5prime,poly_a,unknown,bulk,unknown,unknown,,Netherlands,2011-11-09,Undetermined,Undetermined,Gonad,Reproductive System 36286,SRR363984,SRX105297,SRS270140,SRP009275,PRJNA148581,Hen1 analysis in zebrafish,GSE33582,Transcriptome Analysis,small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.,,pubmed:20859253,,hen1 mutant ligation,GSM830246,,source name:testis|strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation,hen1 mutant ligation,three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8,testis,,Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. Adaptors were ligated to the five prime and three prime ends of the isolated RNA and the product was converted to cDNA using a primer on the three prime adaptor. post 15 cycles PCR amplification of the library the product was gel purified and sequenced on a Solexa platform.,,strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:adapter ligation,GSM830246,GSM830246: hen1 mutant ligation,GSM830246: hen1 mutant ligation,GSM830246: hen1 mutant ligation,1,,GEO Accession:GSM830246,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,460Application ReadForward1,SRP009275,,read name barcode proc directive:ignore,HEN1TESTIS.fastq,fastq,440876374.0,9584269.0,GSM830246 1,0:46,A:91693980;C:99515953;G:105634029;T:143841954;N:190458,46,,,,91693980,99515953,105634029,143841954,190458,SRX105297,SRS270140,SRA047996,GEO,"European Research Institute for the Biology of Ageing, University Medical Center Groningen",1,0.00039,,0.00033,,0.99995,,0.0,,46,,T,,under 1.2% mapping rate,illumina,early_illumina,5prime,poly_a,unknown,bulk,unknown,unknown,,Netherlands,2011-11-09,Undetermined,Undetermined,Gonad,Reproductive System 36287,SRR363983,SRX105296,SRS270139,SRP009275,PRJNA148581,Hen1 analysis in zebrafish,GSE33582,Transcriptome Analysis,small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.,,pubmed:20859253,,wildtype polyA,GSM830245,,source name:testis|strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing,wildtype polyA,three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8,testis,,Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform.,,strain:TL|genotype/variation:Hen1 wildtype|tissue:testis|small rna library prep method:polyA tailing,GSM830245,GSM830245: wildtype polyA,GSM830245: wildtype polyA,GSM830245: wildtype polyA,1,,GEO Accession:GSM830245,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer II,440Application ReadForward1,SRP009275,,read name barcode proc directive:ignore,VASAGFPHEN1plusMALE.fastq,fastq,167344144.0,3803276.0,GSM830245 1,0:44,A:87935982;C:21182538;G:19081938;T:34474815;N:4668871,44,,,,87935982,21182538,19081938,34474815,4668871,SRX105296,SRS270139,SRA047996,GEO,"European Research Institute for the Biology of Ageing, University Medical Center Groningen",1,0.06642,,0.05042,,0.99226,,0.38346,,44,,B,,usable mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,Netherlands,2011-11-09,Undetermined,Undetermined,Gonad,Reproductive System 36288,SRR363982,SRX105295,SRS270138,SRP009275,PRJNA148581,Hen1 analysis in zebrafish,GSE33582,Transcriptome Analysis,small RNA libraries from wild type and Hen1 mutant testes were made with either polyA tailing VASAGFPHen1minus/plus or adapter ligation Hen1Testis and WTTestis and sequenced on an Illumina GAII platform. Overall design: RNA was isolated from total testis tissue of both Hen1 wildtype and Hen1 mutant animals. post size selection from gel the small RNA libraries wre made.,,pubmed:20859253,,hen1 mutant polyA,GSM830244,,source name:testis|strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:polyA tailing,hen1 mutant polyA,three prime adapter sequences were trimmed and inserts longer than 18 nt were mapped to the zebrafish genome Zv8,testis,,Small RNAs in the size range of 19 31 bases were excised from a denaturing gel. RNA was polyA tailed using polyA polymerase followed by ligation of a RNA adaptor to the five prime phosphate of the small RNAs. First strand cDNA synthesis was performed using an oligodT linker primer and M MLV RNase H reverse transcriptase. post amplification the cDNA was sent for sequencing on an Illumina/Solexa platform.,,strain:TL|genotype/variation:Hen1 mutant|tissue:testis|small rna library prep method:polyA tailing,GSM830244,GSM830244: hen1 mutant polyA,GSM830244: hen1 mutant polyA,GSM830244: hen1 mutant polyA,1,,GEO Accession:GSM830244,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina Genome Analyzer II,440Application ReadForward1,SRP009275,,read name barcode proc directive:ignore,VASAGFPHEN1minusMALE.fastq,fastq,267208964.0,6072931.0,GSM830244 1,0:44,A:143478691;C:30051676;G:33682677;T:59883224;N:112696,44,,,,143478691,30051676,33682677,59883224,112696,SRX105295,SRS270138,SRA047996,GEO,"European Research Institute for the Biology of Ageing, University Medical Center Groningen",1,0.01616,,0.01033,,0.99381,,0.76337,,44,,B,,usable mapping rate,illumina,early_illumina,unknown,poly_a,unknown,bulk,unknown,unknown,,Netherlands,2011-11-09,Undetermined,Undetermined,Gonad,Reproductive System 37997,SRR1265760,SRX529154,SRS598851,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Testis Replicate 3 sRNAseq,GSM1376643,,source name:Testis|gender:male|tissue:Testis|genetic background:Wild type Singapore strain,Testis Replicate 3 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Testis,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,gender:Male|tissue:Testis|genetic background:Wild type Singapore strain,GSM1376643,GSM1376643: Testis Replicate 3 sRNAseq; Danio rerio; miRNA Seq,GSM1376643,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376643,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZT004_GCCAAT_L004_R1.fastq.gz,fastq,1096387628.0,14426153.0,GSM1376643 r1,0:76,A:268706118;C:286539627;G:262643519;T:278353167;N:145197,76,,,,268706118,286539627,262643519,278353167,145197,SRX529154,SRS598851,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00659,,0.00333,,0.99845,,0.7331,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Gonad,Reproductive System 37998,SRR1265759,SRX529153,SRS598850,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Testis Replicate 2 sRNAseq,GSM1376642,,source name:Testis|gender:male|tissue:Testis|genetic background:Wild type Singapore strain,Testis Replicate 2 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Testis,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,gender:Male|tissue:Testis|genetic background:Wild type Singapore strain,GSM1376642,GSM1376642: Testis Replicate 2 sRNAseq; Danio rerio; miRNA Seq,GSM1376642,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376642,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZT003_ACAGTG_L004_R1.fastq.gz,fastq,1562745896.0,20562446.0,GSM1376642 r1,0:76,A:381752411;C:387452090;G:395892335;T:397438930;N:210130,76,,,,381752411,387452090,395892335,397438930,210130,SRX529153,SRS598850,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.01222,,0.00651,,0.99788,,0.69591,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Gonad,Reproductive System 37999,SRR1265758,SRX529152,SRS598849,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Testis Replicate 1 sRNAseq,GSM1376641,,source name:Testis|gender:male|tissue:Testis|genetic background:Wild type Singapore strain,Testis Replicate 1 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Testis,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,gender:Male|tissue:Testis|genetic background:Wild type Singapore strain,GSM1376641,GSM1376641: Testis Replicate 1 sRNAseq; Danio rerio; miRNA Seq,GSM1376641,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376641,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZT001_TGACCA_L004_R1.fastq.gz,fastq,1368892316.0,18011741.0,GSM1376641 r1,0:76,A:335715713;C:358829703;G:326742789;T:347419137;N:184974,76,,,,335715713,358829703,326742789,347419137,184974,SRX529152,SRS598849,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00032,,3e-05,,0.99943,,0.69387,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Gonad,Reproductive System 38000,SRR1265757,SRX529151,SRS598848,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Ovary Replicate 3 sRNAseq,GSM1376640,,source name:Ovary|gender:female|tissue:Ovary|genetic background:Wild type Singapore strain,Ovary Replicate 3 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Ovary,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,gender:Female|tissue:Ovary|genetic background:Wild type Singapore strain,GSM1376640,GSM1376640: Ovary Replicate 3 sRNAseq; Danio rerio; miRNA Seq,GSM1376640,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376640,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZO006_GATCAG_L008_R1.fastq.gz,fastq,1411005984.0,27666784.0,GSM1376640 r1,0:51,A:326542153;C:314421825;G:411019622;T:358847379;N:175005,51,,,,326542153,314421825,411019622,358847379,175005,SRX529151,SRS598848,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00638,,0.00068,,0.99513,,0.75483,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Gonad,Reproductive System 38001,SRR1265756,SRX529150,SRS598847,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Ovary Replicate 2 sRNAseq,GSM1376639,,source name:Ovary|gender:female|tissue:Ovary|genetic background:Wild type Singapore strain,Ovary Replicate 2 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Ovary,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,gender:Female|tissue:Ovary|genetic background:Wild type Singapore strain,GSM1376639,GSM1376639: Ovary Replicate 2 sRNAseq; Danio rerio; miRNA Seq,GSM1376639,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376639,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZO005_ACTTGA_L008_R1.fastq.gz,fastq,765419424.0,15008224.0,GSM1376639 r1,0:51,A:179455664;C:170237021;G:221342071;T:194287721;N:96947,51,,,,179455664,170237021,221342071,194287721,96947,SRX529150,SRS598847,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.02512,,0.00355,,0.98212,,0.67744,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Gonad,Reproductive System 38002,SRR1265755,SRX529149,SRS598846,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Ovary Replicate 1 sRNAseq,GSM1376638,,source name:Ovary|gender:female|tissue:Ovary|genetic background:Wild type Singapore strain,Ovary Replicate 1 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Ovary,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,gender:Female|tissue:Ovary|genetic background:Wild type Singapore strain,GSM1376638,GSM1376638: Ovary Replicate 1 sRNAseq; Danio rerio; miRNA Seq,GSM1376638,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376638,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZO004_CAGATC_L008_R1.fastq.gz,fastq,487558674.0,9559974.0,GSM1376638 r1,0:51,A:114833813;C:108951811;G:140408702;T:123302557;N:61791,51,,,,114833813,108951811,140408702,123302557,61791,SRX529149,SRS598846,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.00298,,0.0004,,0.99644,,0.84584,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Gonad,Reproductive System 39861,SRR2177451,SRX1161443,SRS1042406,SRP062686,PRJNA293487,Danio rerio Digital Gene Expression Sequencing,PRJNA293487,Other,Differential expression between WT and CD82a from Morpholino treated embyro of Danio rerio,,,Differential expression between WT and CD82a Morpholino treated embyro of Danio rerio,,control,,isolate:Danio rerio embyro|dev stage:embyro|sex:missing|tissue:ovary|BioSampleModel:Model organism or animal,,,,,,,,,Danio rerio Digital Gene Expression Sequencing,control,1,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,SRP062686,,,control_R1.fastq.gz control_R2.fastq.gz,fastq fastq,1381289200.0,6906446.0,control,0:100 1:100,A:362182510;C:331106787;G:327770778;T:360198909;N:30216,100,100,,,362182510,331106787,327770778,360198909,30216,SRX1161443,SRS1042406,SRA290388,Shanghai Ocean University|Department of Biology and Biotechnology,Shanghai Ocean University,2,0.95634,0.95016,0.06922,0.06922,0.7013,0.70368,0.46985,0.47013,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2016-08-21,Undetermined,Embryo,Gonad,Reproductive System 39862,SRR2177447,SRX1161442,SRS1042404,SRP062686,PRJNA293487,Danio rerio Digital Gene Expression Sequencing,PRJNA293487,Other,Differential expression between WT and CD82a from Morpholino treated embyro of Danio rerio,,,Differential expression between WT and CD82a Morpholino treated embyro of Danio rerio,,ATG,,isolate:Danio rerio embyro|dev stage:embyro|sex:missing|tissue:ovary|BioSampleModel:Model organism or animal,,,,,,,,,Danio rerio Digital Gene Expression Sequencing,ATG,1,1,,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,2000Application ReadForward11Application ReadReverse101,SRP062686,,,ATG_R1.fastq.gz ATG_R2.fastq.gz,fastq fastq,1278088000.0,6390440.0,ATG,0:100 1:100,A:335532626;C:305947212;G:302508524;T:334072046;N:27592,100,100,,,335532626,305947212,302508524,334072046,27592,SRX1161442,SRS1042404,SRA290388,Shanghai Ocean University|Department of Biology and Biotechnology,Shanghai Ocean University,2,0.95535,0.94653,0.07264,0.07271,0.70402,0.7082,0.46712,0.46962,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2016-08-21,Undetermined,Embryo,Gonad,Reproductive System 42465,SRR5605448,SRX2858036,SRS2228760,SRP108050,PRJNA388086,Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish,GSE99308,Transcriptome Analysis,Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles,,pubmed:30364302,,PV WT3,GSM2640960,,source name:PV WT3|strain:AB|tissue:follice|developmental stage:pre vitellogenin|genotype:WT,PV WT3,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.,PV WT3,,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain:AB|tissue:follice|developmental stage:pre vitellogenin|genotype:WT,GSM2640960,GSM2640960: PV WT3; Danio rerio; RNA Seq,GSM2640960,,1,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2640960,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP108050,,,PV_WT3_R1.fastq.gz PV_WT3_R2.fastq.gz,fastq fastq,2965772270.0,14976621.0,GSM2640960 r1,0:99.03 1:98.99,A:759343389;C:716154246;G:713466520;T:775995980;N:812135,99,98,,,759343389,716154246,713466520,775995980,812135,SRX2858036,SRS2228760,SRA566530,GEO,"Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau",2,0.95025,0.95484,0.02351,0.02292,0.74403,0.74566,0.48148,0.48254,100,98,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2017-05-25,Undetermined,Undetermined,Gonad,Reproductive System 42466,SRR5605447,SRX2858035,SRS2228759,SRP108050,PRJNA388086,Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish,GSE99308,Transcriptome Analysis,Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles,,pubmed:30364302,,PV WT2,GSM2640959,,source name:PV WT2|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT,PV WT2,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.,PV WT2,,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT,GSM2640959,GSM2640959: PV WT2; Danio rerio; RNA Seq,GSM2640959,,1,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2640959,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP108050,,,PV_WT2_R2.fastq.gz PV_WT2_R1.fastq.gz,fastq fastq,2021387268.0,10195384.0,GSM2640959 r1,0:99.15 1:99.12,A:517788644;C:487363563;G:485168383;T:530550229;N:516449,99,99,,,517788644,487363563,485168383,530550229,516449,SRX2858035,SRS2228759,SRA566530,GEO,"Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau",2,0.95112,0.95441,0.02399,0.02367,0.74221,0.74373,0.47995,0.47334,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2017-05-25,Undetermined,Undetermined,Gonad,Reproductive System 42467,SRR5605446,SRX2858034,SRS2228758,SRP108050,PRJNA388086,Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish,GSE99308,Transcriptome Analysis,Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles,,pubmed:30364302,,PV WT1,GSM2640958,,source name:PV WT1|strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT,PV WT1,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.,PV WT1,,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain:AB|tissue:follicle|developmental stage:pre vitellogenin|genotype:WT,GSM2640958,GSM2640958: PV WT1; Danio rerio; RNA Seq,GSM2640958,,1,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2640958,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP108050,,,PV_WT1_R1.fastq.gz PV_WT1_R2.fastq.gz,fastq fastq,3244660111.0,16481925.0,GSM2640958 r1,0:98.44 1:98.42,A:831426044;C:781489498;G:779991004;T:848549246;N:3204319,98,98,,,831426044,781489498,779991004,848549246,3204319,SRX2858034,SRS2228758,SRA566530,GEO,"Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau",2,0.94778,0.95185,0.02323,0.02295,0.7429,0.74385,0.48023,0.47809,95,95,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2017-05-25,Undetermined,Undetermined,Gonad,Reproductive System 42468,SRR5605445,SRX2858033,SRS2228757,SRP108050,PRJNA388086,Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish,GSE99308,Transcriptome Analysis,Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles,,pubmed:30364302,,PG WT3,GSM2640957,,source name:PG WT3|strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT,PG WT3,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.,PG WT3,,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT,GSM2640957,GSM2640957: PG WT3; Danio rerio; RNA Seq,GSM2640957,,1,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2640957,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP108050,,,PG_WT3_R1.fastq.gz PG_WT3_R2.fastq.gz,fastq fastq,1976825713.0,10028723.0,GSM2640957 r1,0:98.57 1:98.54,A:498115588;C:485653640;G:479542298;T:512706941;N:807246,98,98,,,498115588,485653640,479542298,512706941,807246,SRX2858033,SRS2228757,SRA566530,GEO,"Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau",2,0.93604,0.93923,0.01349,0.01322,0.76921,0.77029,0.4746,0.4742,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2017-05-25,Undetermined,Undetermined,Gonad,Reproductive System 42469,SRR5605444,SRX2858032,SRS2228756,SRP108050,PRJNA388086,Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish,GSE99308,Transcriptome Analysis,Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles,,pubmed:30364302,,PG WT2,GSM2640956,,source name:PG WT2|strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT,PG WT2,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.,PG WT2,,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT,GSM2640956,GSM2640956: PG WT2; Danio rerio; RNA Seq,GSM2640956,,1,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2640956,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP108050,,,PG_WT2_R1.fastq.gz PG_WT2_R2.fastq.gz,fastq fastq,3961495355.0,20078542.0,GSM2640956 r1,0:98.66 1:98.64,A:1001026721;C:972147725;G:960699221;T:1026249480;N:1372208,98,98,,,1001026721,972147725,960699221,1026249480,1372208,SRX2858032,SRS2228756,SRA566530,GEO,"Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau",2,0.93922,0.94298,0.01416,0.01405,0.77029,0.77106,0.46461,0.46358,100,100,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2017-05-25,Undetermined,Undetermined,Gonad,Reproductive System 42470,SRR5605443,SRX2858031,SRS2228755,SRP108050,PRJNA388086,Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation and Puberty Onset in the Zebrafish,GSE99308,Transcriptome Analysis,Puberty is a special transition period in sexual maturation and it has been extensively studied in vertebrates in the past decades. In mammals the initiation of puberty involves activation of numerous genes; however there have been few comprehensive reports in small model teleosts such as the zebrafish. In the zebrafish the onset of puberty in females is marked by the appearance of the first wave of pre vitellogenic PV follicles in the ovary during sexual maturation. Using transcriptomics and real time qPCR this study was undertaken to investigate temporal gene expression differences between the primary growth PG follicles and pre vitellogenic PV follicles with particular emphasis on oocyte and follicular cell specific genes as well as several closely associated signaling pathways. Our results showed that totally 1082 genes were significantly upregulated and 530 evidently downregulated during the PG PV transition and among them were some well recognized biomarkers such as cyp19a1a fshr inha and inhbaa and some novel genes like notch3 amh gadd45ga and lpl. Further gene ontology analysis showed that egg coat formation and steroid hormone mediated signaling pathway might be critical for follicle activation from PG to PV stage. In addition KEGG identified several signaling pathways that might play pivotal roles in early folliculogenesis including phosphatidylinositol signaling system glycolsaminoglycan biosynthesis RNA transport and p53 signaling pathways. Overall this study reported a comprehensive analysis for biomarker genes and potential pathways involved in PG PV transition or follicle activation which also marks female puberty onset in the zebrafish when occurring for the first time in sexual maturation. Overall design: Examination of gene expression patterns in 2 different stage follicles PG and PV follicles,,pubmed:30364302,,PG WT1,GSM2640955,,source name:PG WT1|strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT,PG WT1,Illumina HiSeq sequencer raw data was demultiplexed using bcl2fastq2 Quality of the sequencing data was checked using FastQC v0.11.5. No trimming was performed as the quality of data was good and there were no adapters enriched in the reads. Reads were aligned to Danio rerio genome version GRCz10 from Ensembl using Tophat2. Parameters: p 6 StringTie and prepDE.py Python script provided with StringTie tool was used to assemble the alignments into transcripts and extract the raw read counts for reference genomic features respectively. The read count matrix was processed by DeSeq2 package for differential gene expression analysis. Genome build: GRCz10 Ensembl build 84 Supplementary files format and content: PG vs PV rawCounts.csv: Raw read counts for each sample. Supplementary files format and content: PG vs PV normCounts.tab: Normalized read counts for each sample.,PG WT1,,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,,strain:AB|tissue:follicle|developmental stage:primary growth|genotype:WT,GSM2640955,GSM2640955: PG WT1; Danio rerio; RNA Seq,GSM2640955,,1,Both PG and PV follicles were isolated and followed by RNA extraction using Trizol reagent. Illumina TruSeq RNA Sample Prep Kit Cat#FC 122 1001 was used with 1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM2640955,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2500,,SRP108050,,,PG_WT1_R1.fastq.gz PG_WT1_R2.fastq.gz,fastq fastq,5007411498.0,25368266.0,GSM2640955 r1,0:98.71 1:98.68,A:1264491896;C:1228178565;G:1216038846;T:1296988060;N:1714131,98,98,,,1264491896,1228178565,1216038846,1296988060,1714131,SRX2858031,SRS2228755,SRA566530,GEO,"Genomics and Bioinformatics Core, Faculty of Health Sciences, University of Macau",2,0.93858,0.94172,0.01418,0.01395,0.76871,0.76995,0.46608,0.46312,100,99,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,China,2017-05-25,Undetermined,Undetermined,Gonad,Reproductive System 44967,SRR6345660,SRX3442976,SRS2733636,SRP126106,PRJNA421016,Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA],GSE107682,Transcriptome Analysis,Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.,parent bioproject:PRJNA315403,pubmed:30086300,,smRNA seq library of ovary from tdrd6a mut fish,GSM2875719,,source name:Ovary from tdrd6a mut fish|tissue:whole ovary|genotype:tdrd6a mutant,smRNA seq library of ovary from tdrd6a mut fish,1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks.,Ovary from tdrd6a mut fish,,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,,tissue:whole ovary|genotype:tdrd6a mutant,GSM2875719,GSM2875719: smRNA seq library of ovary from tdrd6a mut fish; Danio rerio; ncRNA Seq,GSM2875719,,1,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,GEO Accession:GSM2875719,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP126106,,,Tdrd6a-mut-ovary-input-Adult.fastq.gz,fastq,817885062.0,16036962.0,GSM2875719 r1,0:51,A:212456064;C:163491733;G:233627239;T:208262707;N:47319,51,,,,212456064,163491733,233627239,208262707,47319,SRX3442976,SRS2733636,SRA636010,GEO,"Rene Ketting, RNA silencing, IMB",1,0.46308,,0.13668,,0.83587,,0.79104,,51,,B,,usable mapping rate,illumina,hiseq_era,5prime,size_fractionation,unknown,sc_generic,single_cell_generic,generic-scrnaseq-only,,Germany,2017-12-04,Undetermined,Undetermined,Gonad,Reproductive System 44968,SRR6345659,SRX3442975,SRS2733637,SRP126106,PRJNA421016,Tdrd6a recruits Ziwi bound piRNAs and coordinates deposition of germ plasm mRNAs into primordial germ cells [small RNA],GSE107682,Transcriptome Analysis,Germ plasm the Balbiani body and nuage are evolutionary conserved structures essential for germ cell specification and maintenance. We describe Tdrd6a as a component of these structures with two distinct molecular functions. First Tdrd6a facilitates the accumulation of the typical antisense bias of piRNAs without xxx effects on piRNA biogenesis signatures. Second we show that Tdrd6a is required for Balbiani body and germ plasm integrity and associates with RNA binding proteins and germ plasm mRNAs. On the cell biological level maternally contributed Tdrd6a strongly impacts germ cell formation but is dispensable for fertility. Using single cell RNA sequencing we demonstrate that Tdrd6a promotes early germ cell development and regulates the stoichiometry of germ plasm mRNAs. We propose that Tdrd6a functions as a scaffold to recruit correct ratios of germ plasm transcripts and to accumulate antisense piRNA complexes in order to ensure both specification and maintenance of germ cells. Overall design: Zebrafish were grown under standard conditions. Total ovary or size selected Oocytes were used to extact RNA from het of tdrd6a mutant fish.,parent bioproject:PRJNA315403,pubmed:30086300,,smRNA seq library of ovary from tdrd6a het fish,GSM2875718,,source name:Ovary from tdrd6a het fish|tissue:whole ovary|genotype:tdrd6a heterozygous,smRNA seq library of ovary from tdrd6a het fish,1. Adapter trimming with cutadapt O 8 m 26 M 38 a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 2. Low quality read filtering with fastq quality filter q 20 p 100 Q 33. 3. Duplicate reads were collapsed using the unique molecule identifiers UMIs added during library preparation 4 random bases at both the five prime and three prime end using a custom bash script. 4. UMIs were trimmed with seqtk trimfq b 4 a 4 5. Reads with less than 15 nt in length were filtered out with seqtk seq L 15  6. Mapping was done to Zebrafish Danio rerio genome assembly Zv9 with bowtie v0.12.8 tryhard best strata chunkmbs 256 v 1 M 5. 7. Bigwig tracks normalized to the number of mapped reads were created using genomeCoverageBed bg split scale bedtools 2.25.0 followed by bedGraphToBigWig Kent utilities.    8. Mapped reads converted to bed with bamToBed where intersected with the locations of transposable elements LINE SINE LTR and DNA downloaded from the UCSC genome browser repeat masker track Zv9 using bedtools intersect a reads b transposons wa wb bed f 1.0 nonamecheck to keep both the read and the transposon information. The arguments s/ S were also set to find reads mapping sense or antisense to the transposons. Results are in data file transposons counts.txt.gz Genome build: Zv9 Supplementary files format and content: transposons counts.txt.gz is a compressed tab delimited file. Each line corresponds a read that overlaps and annotated transposon. The fields chr re start re end re repFamily repName strand re and repClass represent the location and classification of the repeat elements as described in the RepeatMasker track of UCSC. Feature is whether they are DNA or RNA transposons and readlength the length of the read that. Sample is the sample name and Mapping whether teh reads mapped sense or antisense in relation to the transposon it maps to.  Supplementary files format and content: Files ending in .bw are bigwig tracks.,Ovary from tdrd6a het fish,,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,,tissue:whole ovary|genotype:tdrd6a heterozygous,GSM2875718,GSM2875718: smRNA seq library of ovary from tdrd6a het fish; Danio rerio; ncRNA Seq,GSM2875718,,1,RNA was extracted from ovary tissue as indicated by Trizol extraction. Standard smRNA seq library preperation,GEO Accession:GSM2875718,ncRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP126106,,,Tdrd6a-het-ovary-input-Adult.fastq.gz,fastq,1452353571.0,28477521.0,GSM2875718 r1,0:51,A:397993735;C:284194126;G:396142390;T:373939235;N:84085,51,,,,397993735,284194126,396142390,373939235,84085,SRX3442975,SRS2733637,SRA636010,GEO,"Rene Ketting, RNA silencing, IMB",1,0.3869,,0.1369,,0.86397,,0.77165,,51,,B,,usable mapping rate,illumina,hiseq_era,5prime,size_fractionation,unknown,sc_generic,single_cell_generic,generic-scrnaseq-only,,Germany,2017-12-04,Undetermined,Undetermined,Gonad,Reproductive System 47717,SRR6841472,SRX3797301,SRS3049359,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,testis rep2,GSM3043290,,source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB,testis rep2,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish testis dissected from male,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:testis|genotype:wild type|strain:TLAB,GSM3043290,GSM3043290: testis rep2; Danio rerio; RNA Seq,GSM3043290,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043290,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_testis_2_5_F.fq.gz zf_testis_2_5_R.fq.gz,fastq fastq,5099627816.0,33550183.0,GSM3043290 r1,0:76 1:76,A:1299059138;C:1244888565;G:1262375980;T:1289309350;N:3994783,76,76,,,1299059138,1244888565,1262375980,1289309350,3994783,SRX3797301,SRS3049359,SRA666799,GEO,IMP,2,0.95446,0.95725,0.13178,0.13422,0.73578,0.74255,0.50147,0.50146,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47718,SRR6841473,SRX3797301,SRS3049359,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,testis rep2,GSM3043290,,source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB,testis rep2,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish testis dissected from male,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:testis|genotype:wild type|strain:TLAB,GSM3043290,GSM3043290: testis rep2; Danio rerio; RNA Seq,GSM3043290,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043290,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_testis_2_6_R.fq.gz zf_testis_2_6_F.fq.gz,fastq fastq,4863124784.0,31994242.0,GSM3043290 r2,0:76 1:76,A:1239366804;C:1186097287;G:1202405036;T:1232271257;N:2984400,76,76,,,1239366804,1186097287,1202405036,1232271257,2984400,SRX3797301,SRS3049359,SRA666799,GEO,IMP,2,0.94462,0.95606,0.13046,0.13473,0.73551,0.74063,0.50501,0.50288,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47719,SRR6841474,SRX3797301,SRS3049359,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,testis rep2,GSM3043290,,source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB,testis rep2,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish testis dissected from male,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:testis|genotype:wild type|strain:TLAB,GSM3043290,GSM3043290: testis rep2; Danio rerio; RNA Seq,GSM3043290,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043290,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_testis_2_7_F.fq.gz zf_testis_2_7_R.fq.gz,fastq fastq,5026658088.0,33070119.0,GSM3043290 r3,0:76 1:76,A:1279542888;C:1226763768;G:1244243364;T:1271608208;N:4499860,76,76,,,1279542888,1226763768,1244243364,1271608208,4499860,SRX3797301,SRS3049359,SRA666799,GEO,IMP,2,0.94351,0.95825,0.12954,0.1332,0.73645,0.7413,0.50092,0.49891,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47720,SRR6841469,SRX3797300,SRS3049358,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,testis rep1,GSM3043289,,source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB,testis rep1,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish testis dissected from male,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:testis|genotype:wild type|strain:TLAB,GSM3043289,GSM3043289: testis rep1; Danio rerio; RNA Seq,GSM3043289,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043289,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_testis_1_5_F.fq.gz zf_testis_1_5_R.fq.gz,fastq fastq,5828604008.0,38346079.0,GSM3043289 r1,0:76 1:76,A:1496363417;C:1405966872;G:1430979231;T:1490547871;N:4746617,76,76,,,1496363417,1405966872,1430979231,1490547871,4746617,SRX3797300,SRS3049358,SRA666799,GEO,IMP,2,0.95085,0.95291,0.13996,0.1422,0.70873,0.71662,0.5006,0.50954,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47721,SRR6841470,SRX3797300,SRS3049358,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,testis rep1,GSM3043289,,source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB,testis rep1,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish testis dissected from male,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:testis|genotype:wild type|strain:TLAB,GSM3043289,GSM3043289: testis rep1; Danio rerio; RNA Seq,GSM3043289,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043289,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_testis_1_6_F.fq.gz zf_testis_1_6_R.fq.gz,fastq fastq,5548288344.0,36501897.0,GSM3043289 r2,0:76 1:76,A:1424701888;C:1337280760;G:1360693266;T:1422058469;N:3553961,76,76,,,1424701888,1337280760,1360693266,1422058469,3553961,SRX3797300,SRS3049358,SRA666799,GEO,IMP,2,0.93973,0.95206,0.13904,0.14259,0.70999,0.7177,0.49362,0.50295,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47722,SRR6841471,SRX3797300,SRS3049358,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,testis rep1,GSM3043289,,source name:whole wildtype zebrafish testis dissected from male|tissue:testis|genotype:wild type|strain:TLAB,testis rep1,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish testis dissected from male,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:testis|genotype:wild type|strain:TLAB,GSM3043289,GSM3043289: testis rep1; Danio rerio; RNA Seq,GSM3043289,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043289,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_testis_1_7_F.fq.gz zf_testis_1_7_R.fq.gz,fastq fastq,5685121784.0,37402117.0,GSM3043289 r3,0:76 1:76,A:1458152144;C:1370999956;G:1396053726;T:1454648231;N:5267727,76,76,,,1458152144,1370999956,1396053726,1454648231,5267727,SRX3797300,SRS3049358,SRA666799,GEO,IMP,2,0.9388,0.95443,0.13734,0.14167,0.70759,0.71593,0.49681,0.50673,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47729,SRR6841460,SRX3797297,SRS3049356,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,ovary rep2,GSM3043286,,source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB,ovary rep2,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish ovary dissected from female,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:ovary|genotype:wild type|strain:TLAB,GSM3043286,GSM3043286: ovary rep2; Danio rerio; RNA Seq,GSM3043286,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043286,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_ovary_2_5_R.fq.gz zf_ovary_2_5_F.fq.gz,fastq fastq,5760370600.0,37897175.0,GSM3043286 r1,0:76 1:76,A:1438701176;C:1432115027;G:1438947886;T:1446014914;N:4591597,76,76,,,1438701176,1432115027,1438947886,1446014914,4591597,SRX3797297,SRS3049356,SRA666799,GEO,IMP,2,0.93588,0.94232,0.0501,0.05082,0.79527,0.79955,0.49845,0.49442,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47730,SRR6841461,SRX3797297,SRS3049356,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,ovary rep2,GSM3043286,,source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB,ovary rep2,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish ovary dissected from female,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:ovary|genotype:wild type|strain:TLAB,GSM3043286,GSM3043286: ovary rep2; Danio rerio; RNA Seq,GSM3043286,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043286,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_ovary_2_6_F.fq.gz zf_ovary_2_6_R.fq.gz,fastq fastq,5494881168.0,36150534.0,GSM3043286 r2,0:76 1:76,A:1372809163;C:1365261188;G:1371912460;T:1381448918;N:3449439,76,76,,,1372809163,1365261188,1371912460,1381448918,3449439,SRX3797297,SRS3049356,SRA666799,GEO,IMP,2,0.93073,0.94077,0.04966,0.05048,0.79774,0.80014,0.49517,0.49843,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47731,SRR6841462,SRX3797297,SRS3049356,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,ovary rep2,GSM3043286,,source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB,ovary rep2,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish ovary dissected from female,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:ovary|genotype:wild type|strain:TLAB,GSM3043286,GSM3043286: ovary rep2; Danio rerio; RNA Seq,GSM3043286,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043286,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_ovary_2_7_F.fq.gz zf_ovary_2_7_R.fq.gz,fastq fastq,5666410584.0,37279017.0,GSM3043286 r3,0:76 1:76,A:1414483905;C:1408220336;G:1415545424;T:1423029758;N:5131161,76,76,,,1414483905,1408220336,1415545424,1423029758,5131161,SRX3797297,SRS3049356,SRA666799,GEO,IMP,2,0.9299,0.94287,0.04893,0.04939,0.7974,0.80135,0.49935,0.49202,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47732,SRR6841457,SRX3797296,SRS3049354,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,ovary rep1,GSM3043285,,source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB,ovary rep1,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish ovary dissected from female,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:ovary|genotype:wild type|strain:TLAB,GSM3043285,GSM3043285: ovary rep1; Danio rerio; RNA Seq,GSM3043285,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043285,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_ovary_1_5_R.fq.gz zf_ovary_1_5_F.fq.gz,fastq fastq,6093708728.0,40090189.0,GSM3043285 r1,0:76 1:76,A:1532089324;C:1504701252;G:1515053503;T:1536814286;N:5050363,76,76,,,1532089324,1504701252,1515053503,1536814286,5050363,SRX3797296,SRS3049354,SRA666799,GEO,IMP,2,0.93785,0.9429,0.0338,0.03321,0.78628,0.7903,0.48856,0.47641,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47733,SRR6841458,SRX3797296,SRS3049354,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,ovary rep1,GSM3043285,,source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB,ovary rep1,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish ovary dissected from female,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:ovary|genotype:wild type|strain:TLAB,GSM3043285,GSM3043285: ovary rep1; Danio rerio; RNA Seq,GSM3043285,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043285,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_ovary_1_6_R.fq.gz zf_ovary_1_6_F.fq.gz,fastq fastq,5797092432.0,38138766.0,GSM3043285 r2,0:76 1:76,A:1457841031;C:1430894241;G:1440413370;T:1464148562;N:3795228,76,76,,,1457841031,1430894241,1440413370,1464148562,3795228,SRX3797296,SRS3049354,SRA666799,GEO,IMP,2,0.93123,0.94187,0.03345,0.03344,0.78616,0.78991,0.48359,0.48306,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 47734,SRR6841459,SRX3797296,SRS3049354,SRP135774,PRJNA438478,RNAseq of wild type zebrafish germline ovary oocyte testis,GSE111882,Transcriptome Analysis,Goal of this study is the gene expression analysis of the zebrafish adult germline ovary oocyte testis Overall design: Three tissue types ovary oocyte testis from adult wildtype TLAB zebrafish; two replicates each,,pubmed:30190407;pubmed:34556579,,ovary rep1,GSM3043285,,source name:whole wildtype zebrafish ovary dissected from female|tissue:ovary|genotype:wild type|strain:TLAB,ovary rep1,Libraries were sequenced on a HiSeq 2000 paired end 76 bp reads. Reads were aligned to GRCz10 using the Ensembl transcriptome release 88. A custom file was generated by adding bouncer based on its position coordinates tracking ID: bouncer; exon = Chr18:50858259 50858859 strand; CDS = chr18:50858285 50858663 strand. The following command was used to map each sample: ‘tophat o p 16  library type fr firststrand –no novel juncs –g 1 –G ”.  Quantification of transcript levels FPKM was determined using cuffnorm with the following command “cuffnorm p 22 library type=fr firststrand L < labels > o . Genome build: GRCz10 Supplementary files format and content: tab delimited text file containing FPKMs,whole wildtype zebrafish ovary dissected from female,,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,Zebrafish Danio rerio were raised according to standard protocols 28°C water temperature; 14/10 hour light/dark cycle until point of sample collection.,tissue:ovary|genotype:wild type|strain:TLAB,GSM3043285,GSM3043285: ovary rep1; Danio rerio; RNA Seq,GSM3043285,,1,Total RNA was isolated using the standard TRIzol Invitrogen protocol and genomic DNA was removed by TURBO DNase treatment followed by phenol/chloroform extraction. Libraries were constructed using Illumina TruSeq RNA Library Prep Kit v2 Strand specific libraries for 76 bp paired end sequencing were prepared from cDNA by the Broad Institute Sequencing Platform.,GEO Accession:GSM3043285,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP135774,,,zf_ovary_1_7_R.fq.gz zf_ovary_1_7_F.fq.gz,fastq fastq,5924015928.0,38973789.0,GSM3043285 r3,0:76 1:76,A:1488452513;C:1462498287;G:1473066232;T:1494401585;N:5597311,76,76,,,1488452513,1462498287,1473066232,1494401585,5597311,SRX3797296,SRS3049354,SRA666799,GEO,IMP,2,0.93218,0.94439,0.03341,0.03312,0.78715,0.79172,0.48512,0.48267,76,76,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,unknown,unknown,,Austria,2018-03-15,Undetermined,Undetermined,Gonad,Reproductive System 52150,SRR18181456,SRX14328420,SRS12144051,SRP194254,PRJNA540466,Characterization of the zebrafish cell landscape at single cell resolution,GSE130487,Transcriptome Analysis,Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.,,pubmed:34660600,,Testis7,GSM5924294,,source name:testis|strain:Tubingen|tissue:testis|genotype:wild type,Testis7,Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Mus musculus.GRCm38.88 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.,testis,,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,,strain:Tubingen|tissue:testis|genotype:wild type,GSM5924294,GSM5924294: Testis7; Danio rerio; RNA Seq,GSM5924294,,1,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,GEO Accession:GSM5924294,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP194254,,assembly:Danio rerio GRCz10|intentional duplicate,Testis7.bam,bam,22355333400.0,74517778.0,GSM5924294 r1,0:150 1:150,A:6035271880;C:3425705783;G:3638861956;T:9252935935;N:2557846,150,150,,,6035271880,3425705783,3638861956,9252935935,2557846,SRX14328420,SRS12144051,SRA880843,GEO,Zhejiang University,2,2e-05,0.65459,0.0,0.06753,0.99997,0.78981,1.0,0.50866,150,150,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,microwellseq,,China,2022-03-01,Undetermined,Multi-stage,Gonad,Reproductive System 52151,SRR18181455,SRX14328419,SRS12144050,SRP194254,PRJNA540466,Characterization of the zebrafish cell landscape at single cell resolution,GSE130487,Transcriptome Analysis,Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.,,pubmed:34660600,,Testis6,GSM5924293,,source name:testis|strain:Tubingen|tissue:testis|genotype:wild type,Testis6,Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Mus musculus.GRCm38.88 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.,testis,,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,,strain:Tubingen|tissue:testis|genotype:wild type,GSM5924293,GSM5924293: Testis6; Danio rerio; RNA Seq,GSM5924293,,1,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,GEO Accession:GSM5924293,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP194254,,assembly:Danio rerio GRCz10|intentional duplicate,Testis6.bam,bam,26427119100.0,88090397.0,GSM5924293 r1,0:150 1:150,A:6656757738;C:4332393726;G:4530415358;T:10904715070;N:2837208,150,150,,,6656757738,4332393726,4530415358,10904715070,2837208,SRX14328419,SRS12144050,SRA880843,GEO,Zhejiang University,2,5e-05,0.71817,0.0,0.06748,0.99993,0.78642,0.66666,0.5085,150,150,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,microwellseq,,China,2022-03-01,Undetermined,Multi-stage,Gonad,Reproductive System 52157,SRR18181449,SRX14328413,SRS12144044,SRP194254,PRJNA540466,Characterization of the zebrafish cell landscape at single cell resolution,GSE130487,Transcriptome Analysis,Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.,,pubmed:34660600,,Ovary5,GSM5924287,,source name:ovary|strain:Tubingen|tissue:ovary|genotype:wild type,Ovary5,Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Mus musculus.GRCm38.88 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.,ovary,,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,,strain:Tubingen|tissue:ovary|genotype:wild type,GSM5924287,GSM5924287: Ovary5; Danio rerio; RNA Seq,GSM5924287,,1,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,GEO Accession:GSM5924287,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP194254,,assembly:Danio rerio GRCz10|intentional duplicate,Ovary5.bam,bam,19803996900.0,66013323.0,GSM5924287 r1,0:150 1:150,A:5073828462;C:3239587102;G:3356397736;T:8132061615;N:2121985,150,150,,,5073828462,3239587102,3356397736,8132061615,2121985,SRX14328413,SRS12144044,SRA880843,GEO,Zhejiang University,2,0.0,0.69276,0.0,0.03046,1.0,0.8297,,0.5054,150,150,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,microwellseq,,China,2022-03-01,Undetermined,Multi-stage,Gonad,Reproductive System 52158,SRR18181448,SRX14328412,SRS12144043,SRP194254,PRJNA540466,Characterization of the zebrafish cell landscape at single cell resolution,GSE130487,Transcriptome Analysis,Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.,,pubmed:34660600,,Ovary4,GSM5924286,,source name:ovary|strain:Tubingen|tissue:ovary|genotype:wild type,Ovary4,Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Mus musculus.GRCm38.88 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.,ovary,,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,,strain:Tubingen|tissue:ovary|genotype:wild type,GSM5924286,GSM5924286: Ovary4; Danio rerio; RNA Seq,GSM5924286,,1,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,GEO Accession:GSM5924286,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP194254,,assembly:Danio rerio GRCz10|intentional duplicate,Ovary4.bam,bam,18909491400.0,63031638.0,GSM5924286 r1,0:150 1:150,A:4449523781;C:3271362982;G:3415526983;T:7771066311;N:2011343,150,150,,,4449523781,3271362982,3415526983,7771066311,2011343,SRX14328412,SRS12144043,SRA880843,GEO,Zhejiang University,2,2e-05,0.80325,0.0,0.03273,0.99997,0.81895,1.0,0.53235,150,150,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,microwellseq,,China,2022-03-01,Undetermined,Multi-stage,Gonad,Reproductive System 52181,SRR9058966,SRX5835166,SRS4761462,SRP194254,PRJNA540466,Characterization of the zebrafish cell landscape at single cell resolution,GSE130487,Transcriptome Analysis,Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.,,pubmed:34660600,,Testis2,GSM3768163,,source name:testis|strain:Tubingen|genotype/variation:wild type|tissue:testis,Testis2,Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.,testis,,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,,strain:Tubingen|genotype/variation:wild type|tissue:testis,GSM3768163,GSM3768163: Testis2; Danio rerio; RNA Seq,GSM3768163,,1,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,GEO Accession:GSM3768163,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq X Ten,,SRP194254,,assembly:http://dec2017.archive.ensembl.org/Danio rerio/Info/Index,Testis2.bam,bam,10897833300.0,36326111.0,GSM3768163 r1,0:150 1:150,A:2949189012;C:1827068947;G:1843781525;T:4276886403;N:907413,150,150,,,2949189012,1827068947,1843781525,4276886403,907413,SRX5835166,SRS4761462,SRA880843,GEO,Zhejiang University,2,5e-05,0.72733,1e-05,0.0449,0.99995,0.78216,0.5,0.50959,150,150,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,microwellseq,,China,2019-05-15,Undetermined,Multi-stage,Gonad,Reproductive System 52182,SRR9058965,SRX5835165,SRS4761461,SRP194254,PRJNA540466,Characterization of the zebrafish cell landscape at single cell resolution,GSE130487,Transcriptome Analysis,Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.,,pubmed:34660600,,Testis1,GSM3768162,,source name:testis|strain:Tubingen|genotype/variation:wild type|tissue:testis,Testis1,Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.,testis,,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,,strain:Tubingen|genotype/variation:wild type|tissue:testis,GSM3768162,GSM3768162: Testis1; Danio rerio; RNA Seq,GSM3768162,,1,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,GEO Accession:GSM3768162,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq X Ten,,SRP194254,,assembly:http://dec2017.archive.ensembl.org/Danio rerio/Info/Index,Testis1.bam,bam,20087467800.0,66958226.0,GSM3768162 r1,0:150 1:150,A:5333777727;C:3476144155;G:3519583110;T:7754981380;N:2981428,150,150,,,5333777727,3476144155,3519583110,7754981380,2981428,SRX5835165,SRS4761461,SRA880843,GEO,Zhejiang University,2,3e-05,0.71273,0.0,0.05569,0.99997,0.78151,1.0,0.49988,150,150,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,microwellseq,,China,2019-05-15,Undetermined,Multi-stage,Gonad,Reproductive System 52183,SRR9058964,SRX5835164,SRS4761460,SRP194254,PRJNA540466,Characterization of the zebrafish cell landscape at single cell resolution,GSE130487,Transcriptome Analysis,Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.,,pubmed:34660600,,Ovary2,GSM3768161,,source name:ovary|strain:Tubingen|genotype/variation:wild type|tissue:ovary,Ovary2,Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: Danio rerio GRCz10 Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.,ovary,,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,,strain:Tubingen|genotype/variation:wild type|tissue:ovary,GSM3768161,GSM3768161: Ovary2; Danio rerio; RNA Seq,GSM3768161,,1,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,GEO Accession:GSM3768161,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq X Ten,,SRP194254,,assembly:http://dec2017.archive.ensembl.org/Danio rerio/Info/Index,Ovary2.bam,bam,27873510686.0,92296393.0,GSM3768161 r1,0:151 1:151,A:7431755509;C:4813567006;G:4753054905;T:10804284010;N:70849256,151,151,,,7431755509,4813567006,4753054905,10804284010,70849256,SRX5835164,SRS4761460,SRA880843,GEO,Zhejiang University,2,0.0,0.64422,0.0,0.03306,1.0,0.85251,,0.49446,151,151,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,microwellseq,,China,2019-05-15,Undetermined,Multi-stage,Gonad,Reproductive System 52198,SRR8991408,SRX5770476,SRS4704585,SRP194254,PRJNA540466,Characterization of the zebrafish cell landscape at single cell resolution,GSE130487,Transcriptome Analysis,Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.,,pubmed:34660600,,Testis5,GSM3740961,,source name:testis|strain:Tubingen|genotype:wild type|tissue:testis,Testis5,The drop seq core computational tool was used for preprocessing of the Microwell seq data. The implementation is described in the Drop seq computational cookbook http://mccarrolllab.org/dropseq/. Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: http://dec2017.archive.ensembl.org/Danio rerio/Info/Index Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.,testis,,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,,strain:Tubingen|genotype:wild type|tissue:testis,GSM3740961,GSM3740961: Testis5; Danio rerio; RNA Seq,GSM3740961,,1,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,GEO Accession:GSM3740961,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq X Ten,,SRP194254,,assembly:Danio rerio GRCz10,Testis5.bam,bam,25120411340.0,83180170.0,GSM3740961 r1,0:151 1:151,A:6309984521;C:4265951177;G:4463773513;T:10013679424;N:67022705,151,151,,,6309984521,4265951177,4463773513,10013679424,67022705,SRX5770476,SRS4704585,SRA880843,GEO,Zhejiang University,2,0.0,0.73589,0.0,0.05677,1.0,0.76852,,0.48176,151,151,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,microwellseq,,China,2019-04-30,Undetermined,Multi-stage,Gonad,Reproductive System 52202,SRR8991404,SRX5770472,SRS4704581,SRP194254,PRJNA540466,Characterization of the zebrafish cell landscape at single cell resolution,GSE130487,Transcriptome Analysis,Zebrafish have been found to be a premier model organism in biological and regeneration research. However the comprehensive cell compositions and molecular dynamics during tissue regeneration in zebrafish remain poorly understood. Here we utilized Microwell seq to analyze more than 250 000 single cells covering major zebrafish cell types and constructed a systematic zebrafish cell landscape. We revealed single cell compositions for 18 zebrafish tissue types covering both embryo and adult stages. Single cell mapping of caudal fin regeneration revealed a unique characteristic of blastema population and key genetic regulation involved in zebrafish tissue repair. Overall our single cell datasets demonstrate the utility of zebrafish cell landscape resources in various fields of biological research. Overall design: Expression profiling by high throughput sequencing of major zebrafish organ types. Please note that 19 samples were added and 9 samples were deleted on Mar 1 2022.,,pubmed:34660600,,Ovary3,GSM3740957,,source name:ovary|strain:Tubingen|genotype:wild type|tissue:ovary,Ovary3,The drop seq core computational tool was used for preprocessing of the Microwell seq data. The implementation is described in the Drop seq computational cookbook http://mccarrolllab.org/dropseq/. Base calls were performed with Illumina bcl2fastq Sequenced reads were trimmed for adaptor sequence.Then reads in bam files were tagged with the cell and molecular UMI barcode sequences using Drop seq tools 1.12.The cell barcodes are tagged as XC in the bam file and the UMI is tagged as XM in the bam file. The reads quality under 10 were removed. ScRNA seq reads were aligned to the Danio rerio GRCz10 genome assembly using STAR version 2.5.2a with default configurations. Next merge the STAR alignment tagged bam SAM to recover cell /molecular barcodes and the reads are annotated with exon tags. Last we demultiplexed all cell barcodes taken into consideration for the analysis from the exon tagged bam files to get a digital expression matrix based on UMI counts. Genome build: http://dec2017.archive.ensembl.org/Danio rerio/Info/Index Supplementary files format and content: tab delimited text files of digital expression matrix dge based on raw UMI counts columns are cells and rows are genes.,ovary,,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,,strain:Tubingen|genotype:wild type|tissue:ovary,GSM3740957,GSM3740957: Ovary3; Danio rerio; RNA Seq,GSM3740957,,1,Tissue dissociation and single cell lysate Library preparations were performed with the Microwell seq protocol,GEO Accession:GSM3740957,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq X Ten,,SRP194254,,assembly:Danio rerio GRCz10,Ovary3.bam,bam,28925343900.0,96417813.0,GSM3740957 r1,0:150 1:150,A:7017871289;C:5039388405;G:5052960907;T:11812448419;N:2674880,150,150,,,7017871289,5039388405,5052960907,11812448419,2674880,SRX5770472,SRS4704581,SRA880843,GEO,Zhejiang University,2,2e-05,0.79333,0.0,0.03249,0.99997,0.83374,0.0,0.48484,150,150,T,B,mate1 technical by mapping diff,illumina,hiseq_era,unknown,cdna_unspecified,unknown,sc,single_cell_plate,microwellseq,,China,2019-04-30,Undetermined,Multi-stage,Gonad,Reproductive System 52326,SRR9119512,SRX5893495,SRS4815090,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIb 3,GSM3816534,,source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb,IIIb 3,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIb follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIb,GSM3816534,GSM3816534: IIIb 3; Danio rerio; miRNA Seq,GSM3816534,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816534,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.005.RPI10.IIIb_3_R1.fastq.gz,fastq,1449340900.0,28986818.0,GSM3816534 r1,0:50 1:0,A:351029701;C:324452324;G:401722902;T:371889768;N:246205,50,0,,,351029701,324452324,401722902,371889768,246205,SRX5893495,SRS4815090,SRA890399,GEO,"Biology, YorkU",1,0.08662,,0.01333,,0.96213,,0.83838,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52327,SRR9119513,SRX5893495,SRS4815090,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIb 3,GSM3816534,,source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb,IIIb 3,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIb follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIb,GSM3816534,GSM3816534: IIIb 3; Danio rerio; miRNA Seq,GSM3816534,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816534,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.006.RPI10.IIIb_3_R1.fastq,fastq,1447621100.0,28952422.0,GSM3816534 r2,0:50 1:0,A:350650304;C:324162528;G:401055729;T:371582418;N:170121,50,0,,,350650304,324162528,401055729,371582418,170121,SRX5893495,SRS4815090,SRA890399,GEO,"Biology, YorkU",1,0.08676,,0.01312,,0.96282,,0.84604,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52328,SRR9119510,SRX5893494,SRS4815089,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIb 2,GSM3816533,,source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb,IIIb 2,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIb follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIb,GSM3816533,GSM3816533: IIIb 2; Danio rerio; miRNA Seq,GSM3816533,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816533,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.005.RPI9.IIIb_2_R1.fastq.gz,fastq,1012538750.0,20250775.0,GSM3816533 r1,0:50 1:0,A:242873339;C:228078637;G:287889366;T:253526026;N:171382,50,0,,,242873339,228078637,287889366,253526026,171382,SRX5893494,SRS4815089,SRA890399,GEO,"Biology, YorkU",1,0.04745,,0.00802,,0.968,,0.75298,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52329,SRR9119511,SRX5893494,SRS4815089,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIb 2,GSM3816533,,source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb,IIIb 2,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIb follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIb,GSM3816533,GSM3816533: IIIb 2; Danio rerio; miRNA Seq,GSM3816533,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816533,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.006.RPI9.IIIb_2_R1.fastq,fastq,1010559400.0,20211188.0,GSM3816533 r2,0:50 1:0,A:242471282;C:227664296;G:287157957;T:253147388;N:118477,50,0,,,242471282,227664296,287157957,253147388,118477,SRX5893494,SRS4815089,SRA890399,GEO,"Biology, YorkU",1,0.04679,,0.008,,0.96946,,0.71268,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52330,SRR9119508,SRX5893493,SRS4815088,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIb 1,GSM3816532,,source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb,IIIb 1,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIb follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIb,GSM3816532,GSM3816532: IIIb 1; Danio rerio; miRNA Seq,GSM3816532,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816532,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.005.RPI8.IIIb_1_R1.fastq.gz,fastq,1443846950.0,28876939.0,GSM3816532 r1,0:50 1:0,A:350805103;C:319766230;G:407583206;T:365448522;N:243889,50,0,,,350805103,319766230,407583206,365448522,243889,SRX5893493,SRS4815088,SRA890399,GEO,"Biology, YorkU",1,0.02559,,0.00389,,0.98407,,0.82023,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52331,SRR9119509,SRX5893493,SRS4815088,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIb 1,GSM3816532,,source name:stage IIIb follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIb,IIIb 1,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIb follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIb,GSM3816532,GSM3816532: IIIb 1; Danio rerio; miRNA Seq,GSM3816532,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816532,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.006.RPI8.IIIb_1_R1.fastq,fastq,1442694250.0,28853885.0,GSM3816532 r2,0:50 1:0,A:350607715;C:319569609;G:407049947;T:365297986;N:168993,50,0,,,350607715,319569609,407049947,365297986,168993,SRX5893493,SRS4815088,SRA890399,GEO,"Biology, YorkU",1,0.02565,,0.00409,,0.98417,,0.81633,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52332,SRR9119506,SRX5893492,SRS4815087,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIa 3,GSM3816531,,source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa,IIIa 3,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIa follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIa,GSM3816531,GSM3816531: IIIa 3; Danio rerio; miRNA Seq,GSM3816531,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816531,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.005.RPI4.IIIa_3_R1.fastq.gz,fastq,1324489100.0,26489782.0,GSM3816531 r1,0:50 1:0,A:333465386;C:289207984;G:364882545;T:336711699;N:221486,50,0,,,333465386,289207984,364882545,336711699,221486,SRX5893492,SRS4815087,SRA890399,GEO,"Biology, YorkU",1,0.02703,,0.00432,,0.98313,,0.75385,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52333,SRR9119507,SRX5893492,SRS4815087,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIa 3,GSM3816531,,source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa,IIIa 3,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIa follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIa,GSM3816531,GSM3816531: IIIa 3; Danio rerio; miRNA Seq,GSM3816531,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816531,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.006.RPI4.IIIa_3_R1.fastq,fastq,1322554650.0,26451093.0,GSM3816531 r2,0:50 1:0,A:333031673;C:288843797;G:364209143;T:336315522;N:154515,50,0,,,333031673,288843797,364209143,336315522,154515,SRX5893492,SRS4815087,SRA890399,GEO,"Biology, YorkU",1,0.02671,,0.00422,,0.98283,,0.76748,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52334,SRR9119504,SRX5893491,SRS4815086,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIa 2,GSM3816530,,source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa,IIIa 2,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIa follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIa,GSM3816530,GSM3816530: IIIa 2; Danio rerio; miRNA Seq,GSM3816530,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816530,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.005.RPI3.IIIa_2_R1.fastq.gz,fastq,1382308600.0,27646172.0,GSM3816530 r1,0:50 1:0,A:342206537;C:301597185;G:385756857;T:352517232;N:230789,50,0,,,342206537,301597185,385756857,352517232,230789,SRX5893491,SRS4815086,SRA890399,GEO,"Biology, YorkU",1,0.05315,,0.00892,,0.9643,,0.79967,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52335,SRR9119505,SRX5893491,SRS4815086,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIa 2,GSM3816530,,source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa,IIIa 2,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIa follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIa,GSM3816530,GSM3816530: IIIa 2; Danio rerio; miRNA Seq,GSM3816530,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816530,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.006.RPI3.IIIa_2_R1.fastq,fastq,1383050750.0,27661015.0,GSM3816530 r2,0:50 1:0,A:342441286;C:301828080;G:385820344;T:352800933;N:160107,50,0,,,342441286,301828080,385820344,352800933,160107,SRX5893491,SRS4815086,SRA890399,GEO,"Biology, YorkU",1,0.0533,,0.00892,,0.96323,,0.81292,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52336,SRR9119502,SRX5893490,SRS4815085,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIa 1,GSM3816529,,source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa,IIIa 1,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIa follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIa,GSM3816529,GSM3816529: IIIa 1; Danio rerio; miRNA Seq,GSM3816529,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816529,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.005.RPI2.IIIa_1_R1.fastq.gz,fastq,1333818450.0,26676369.0,GSM3816529 r1,0:50 1:0,A:320039883;C:296663387;G:380656068;T:336233800;N:225312,50,0,,,320039883,296663387,380656068,336233800,225312,SRX5893490,SRS4815085,SRA890399,GEO,"Biology, YorkU",1,0.0976,,0.019,,0.93718,,0.75404,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 52337,SRR9119503,SRX5893490,SRS4815085,SRP199448,PRJNA544696,Identification of novel microRNAs and characterization of microRNA expression profiles in zebrafish ovarian follicular cells,GSE131759,Transcriptome Analysis,MicroRNAs miRNAs are small noncoding RNAs that regulate gene expression primarily at the post transcriptional levels and thereby play important roles in regulating many physiological and developmental processes. Oocyte maturation in fish is induced by hormones produced from the hypothalamus pituitary and ovary. Gonadotropin releasing hormone GnRH stimulates the secretion of luteinizing hormone LH which in turn induces the secretion of maturation inducing hormone MIH from the ovary. It is documented that small early vitellogenic or stage IIIa follicles are unable to undergo oocyte maturation whereas oocytes in mid to late vitellogenic stage IIIb follicles can be induced by LH and MIH to become mature. To determine whether miRNAs may be involved in the growth and acquisition of maturational competency of ovarian follicles we determined the miRNA expression profiles in follicular cells collected from stage IIIa and IIIb follicles using next generation sequencing. It was found that miRNAs are abundantly expressed in the follicular cells from both stages IIIa and IIIb follicles. Furthermore bioinformatics analysis revealed the presence of 214 known 31 conserved novel and 44 novel miRNAs in zebrafish vitellogenic ovarian follicular cells. Most mature miRNAs in follicular cells were found to be in the length of 22 nucleotides. Differential expression analysis revealed that 11 miRNAs were significantly up regulated and 13 miRNAs were significantly down regulated in the stage IIIb follicular cells as compared with stage IIIa follicular cells. The expression of four of the significantly regulated miRNAs dre miR 22a 3p dre miR 16a dre miR 181a 3p and dre miR 29a was validated by real time PCR. Finally gene enrichment and pathway analyses of the predicted targets of the significantly regulated miRNAs supported the involvement of several key signaling pathways in regulating ovarian function including oocyte maturation. Taken together this study identifies novel zebrafish miRNAs and characterizes miRNA expression profiles in somatic cells within the zebrafish ovarian follicles. The differential expression of miRNAs between stage IIIa and IIIb follicular cells suggests that these miRNAs are important regulators of zebrafish ovarian follicle development and/or oocyte maturation. Overall design: miRNA seq analysis in stage IIIa and IIIb vitellogenic zebrafish follicular cells.,,pubmed:31417497,,IIIa 1,GSM3816529,,source name:stage IIIa follicular cells|tissue:ovary|cell type:follicular cells|developmental stage:IIIa,IIIa 1,LC Sciences in house program ACGT101 miR program was used to process the raw sequencing data allowing for 1 mismatch Raw sequencing reads were processed using the ACGT101 miR program LC Sciences Houston Texas USA. Adaptor dimers junk low complexity common RNA families and repeats were removed and only unique sequences of 18 26 nucleotides nt in length were retained and compared to known zebrafish miRNAs in miRBase. Unannotated sequences that were mapped to the zebrafish genome and had at least one predicted pre miRNA and such pre miRNA is able to form a hairpin structure whose genomic coordinates should not overlap with known pre miRNAs included in this analysis were regarded as novel miRNAs. Sequencing counts were normalized by the library size parameter of the corresponding sample Genome build: GRCz11 Supplementary files format and content: tab delimited text files include mature miRNA sequence and normalized values for each Sample,stage IIIa follicular cells,,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,,tissue:ovary|cell type:follicular cells|developmental stage:IIIa,GSM3816529,GSM3816529: IIIa 1; Danio rerio; miRNA Seq,GSM3816529,,1,Follicular cells from stages IIIa and IIIb were removed and RNA was usolayed using miRNeasy kit. Construction of sequencing libraries was performed by Nanuq sequencing facility for RNA Seq Illumina Massively Parallel Sequencing. RNA libraries were prepared for sequencing using standard Illumina protocols,GEO Accession:GSM3816529,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP199448,,,HI.2030.006.RPI2.IIIa_1_R1.fastq,fastq,1334152750.0,26683055.0,GSM3816529 r2,0:50 1:0,A:320194547;C:296827909;G:380547854;T:336424243;N:158197,50,0,,,320194547,296827909,380547854,336424243,158197,SRX5893490,SRS4815085,SRA890399,GEO,"Biology, YorkU",1,0.09727,,0.01947,,0.93866,,0.76527,,50,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,Canada,2019-05-24,Undetermined,Undetermined,Gonad,Reproductive System 58533,SRR11355387,SRX7957249,SRS6343356,SRP253408,PRJNA613558,Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture,PRJNA613558,Other,As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.,,,,C2 3,C2 3,,strain:AB|isolate:C2|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|sex:female|tissue:ovary|collection date:2019 11 01|geo loc name:China: Shenzhen Guangdong|replicate:biological replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of zebrafish,C2 320200327,C2 320200327,RNA seq of zebrafish in different conditions,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM PCR,PAIRED,BGISEQ,BGISEQ-500,,SRP253408,,,C2_3_1.fq.gz C2_3_2.fq.gz,fastq fastq,6857650800.0,45717672.0,C2 3 1.fq.gz,0:150 1:150,A:1826466263;C:1599272942;G:1580689630;T:1851144875;N:77090,150,150,,,1826466263,1599272942,1580689630,1851144875,77090,SRX7957249,SRS6343356,SRA1056819,Southern University of Science and Technology|School of Environmental Science and Engineering,Southern University of Science and Technology,1,0.93222,,0.02854,,0.75138,,0.50759,,150,,B,,usable mapping rate,bgi,bgi,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-03-20,Undetermined,Adult,Gonad,Reproductive System 58534,SRR11355388,SRX7957248,SRS6343355,SRP253408,PRJNA613558,Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture,PRJNA613558,Other,As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.,,,,C2 2,C2 2,,strain:AB|isolate:C2|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|sex:female|tissue:ovary|collection date:2019 11 01|geo loc name:China: Shenzhen Guangdong|replicate:biological replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of zebrafish,C2 220200326,C2 220200326,RNA seq of zebrafish in different conditions,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM PCR,PAIRED,BGISEQ,BGISEQ-500,,SRP253408,,,C2_2_1.fq.gz C2_2_2.fq.gz,fastq fastq,6859954800.0,45733032.0,C2 2 1.fq.gz,0:150 1:150,A:1836618967;C:1591135182;G:1572318102;T:1859806048;N:76501,150,150,,,1836618967,1591135182,1572318102,1859806048,76501,SRX7957248,SRS6343355,SRA1056819,Southern University of Science and Technology|School of Environmental Science and Engineering,Southern University of Science and Technology,1,0.93237,,0.03248,,0.74663,,0.5081,,150,,B,,usable mapping rate,bgi,bgi,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-03-20,Undetermined,Adult,Gonad,Reproductive System 58535,SRR11355389,SRX7957247,SRS6343354,SRP253408,PRJNA613558,Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture,PRJNA613558,Other,As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.,,,,C2 1,C2 1,,strain:AB|isolate:C2|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|sex:female|tissue:ovary|collection date:2019 11 01|geo loc name:China: Shenzhen Guangdong|replicate:biological replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of zebrafish,C2 120200325,C2 120200325,RNA seq of zebrafish in different conditions,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM PCR,PAIRED,BGISEQ,BGISEQ-500,,SRP253408,,,C2_1_1.fq.gz C2_1_2.fq.gz,fastq fastq,6618974400.0,44126496.0,C2 1 1.fq.gz,0:150 1:150,A:1774116288;C:1533828286;G:1511526952;T:1799423408;N:79466,150,150,,,1774116288,1533828286,1511526952,1799423408,79466,SRX7957247,SRS6343354,SRA1056819,Southern University of Science and Technology|School of Environmental Science and Engineering,Southern University of Science and Technology,1,0.9326,,0.02973,,0.75426,,0.50678,,150,,B,,usable mapping rate,bgi,bgi,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-03-20,Undetermined,Adult,Gonad,Reproductive System 58536,SRR11355390,SRX7957246,SRS6343353,SRP253408,PRJNA613558,Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture,PRJNA613558,Other,As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.,,,,C1 3,C1 3,,strain:AB|isolate:C1|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|sex:female|tissue:ovary|collection date:2019 11 01|geo loc name:China: Shenzhen Guangdong|replicate:biological replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of zebrafish,C1 320200324,C1 320200324,RNA seq of zebrafish in different conditions,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM PCR,PAIRED,BGISEQ,BGISEQ-500,,SRP253408,,,C1_3_1.fq.gz C1_3_2.fq.gz,fastq fastq,6837729600.0,45584864.0,C1 3 1.fq.gz,0:150 1:150,A:1831266308;C:1587032733;G:1565071069;T:1853950421;N:409069,150,150,,,1831266308,1587032733,1565071069,1853950421,409069,SRX7957246,SRS6343353,SRA1056819,Southern University of Science and Technology|School of Environmental Science and Engineering,Southern University of Science and Technology,1,0.93541,,0.03212,,0.74681,,0.50268,,150,,B,,usable mapping rate,bgi,bgi,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-03-20,Undetermined,Adult,Gonad,Reproductive System 58537,SRR11355391,SRX7957245,SRS6343352,SRP253408,PRJNA613558,Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture,PRJNA613558,Other,As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.,,,,C1 2,C1 2,,strain:AB|isolate:C1|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|sex:female|tissue:ovary|collection date:2019 11 01|geo loc name:China: Shenzhen Guangdong|replicate:biological replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of zebrafish,C1 220200323,C1 220200323,RNA seq of zebrafish in different conditions,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM PCR,PAIRED,BGISEQ,BGISEQ-500,,SRP253408,,,C1_2_2.fq.gz C1_2_1.fq.gz,fastq fastq,6860328000.0,45735520.0,C1 2 1.fq.gz,0:150 1:150,A:1838176072;C:1591277709;G:1569605888;T:1861063734;N:204597,150,150,,,1838176072,1591277709,1569605888,1861063734,204597,SRX7957245,SRS6343352,SRA1056819,Southern University of Science and Technology|School of Environmental Science and Engineering,Southern University of Science and Technology,1,0.93763,,0.033,,0.74617,,0.50287,,150,,B,,usable mapping rate,bgi,bgi,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-03-20,Undetermined,Adult,Gonad,Reproductive System 58538,SRR11355392,SRX7957244,SRS6343351,SRP253408,PRJNA613558,Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture,PRJNA613558,Other,As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.,,,,C1 1,C1 1,,strain:AB|isolate:C1|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|sex:female|tissue:ovary|collection date:2019 11 01|geo loc name:China: Shenzhen Guangdong|replicate:biological replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of zebrafish,C1 120200322,C1 120200322,RNA seq of zebrafish in different conditions,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM PCR,PAIRED,BGISEQ,BGISEQ-500,,SRP253408,,,C1_1_1.fq.gz C1_1_2.fq.gz,fastq fastq,6865547700.0,45770318.0,C1 1 1.fq.gz,0:150 1:150,A:1841774713;C:1591288582;G:1570400871;T:1861867728;N:215806,150,150,,,1841774713,1591288582,1570400871,1861867728,215806,SRX7957244,SRS6343351,SRA1056819,Southern University of Science and Technology|School of Environmental Science and Engineering,Southern University of Science and Technology,1,0.93567,,0.03152,,0.74653,,0.50239,,150,,B,,usable mapping rate,bgi,bgi,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-03-20,Undetermined,Adult,Gonad,Reproductive System 58539,SRR11355393,SRX7957243,SRS6343350,SRP253408,PRJNA613558,Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture,PRJNA613558,Other,As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.,,,,C0 3,C0 3,,strain:AB|isolate:C0|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|sex:female|tissue:ovary|collection date:2019 11 01|geo loc name:China: Shenzhen Guangdong|replicate:biological replicate 3|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of zebrafish,C0 320200321,C0 320200321,RNA seq of zebrafish in different conditions,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM PCR,PAIRED,BGISEQ,BGISEQ-500,,SRP253408,,,C0_3_1.fq.gz C0_3_2.fq.gz,fastq fastq,6824622600.0,45497484.0,C0 3 1.fq.gz,0:150 1:150,A:1833660953;C:1578510104;G:1558095174;T:1854128169;N:228200,150,150,,,1833660953,1578510104,1558095174,1854128169,228200,SRX7957243,SRS6343350,SRA1056819,Southern University of Science and Technology|School of Environmental Science and Engineering,Southern University of Science and Technology,1,0.93758,,0.0323,,0.75024,,0.50852,,150,,B,,usable mapping rate,bgi,bgi,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-03-20,Undetermined,Adult,Gonad,Reproductive System 58540,SRR11355394,SRX7957242,SRS6343349,SRP253408,PRJNA613558,Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture,PRJNA613558,Other,As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.,,,,C0 2,C0 2,,strain:AB|isolate:C0|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|sex:female|tissue:ovary|collection date:2019 11 01|geo loc name:China: Shenzhen Guangdong|replicate:biological replicate 2|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of zebrafish,C0 220200320,C0 220200320,RNA seq of zebrafish in different conditions,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM PCR,PAIRED,BGISEQ,BGISEQ-500,,SRP253408,,,C0_2_2.fq.gz C0_2_1.fq.gz,fastq fastq,6819326400.0,45462176.0,C0 2 1.fq.gz,0:150 1:150,A:1837661215;C:1571877614;G:1550458835;T:1859103408;N:225328,150,150,,,1837661215,1571877614,1550458835,1859103408,225328,SRX7957242,SRS6343349,SRA1056819,Southern University of Science and Technology|School of Environmental Science and Engineering,Southern University of Science and Technology,1,0.93697,,0.0339,,0.74793,,0.5035,,150,,B,,usable mapping rate,bgi,bgi,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-03-20,Undetermined,Adult,Gonad,Reproductive System 58541,SRR11355395,SRX7957241,SRS6343348,SRP253408,PRJNA613558,Transcriptomic assessments RNA sequencing in ovaries following treatments of gravid female zebrafish to an antibiotic mixture,PRJNA613558,Other,As the use of antimicrobials during pregnancy and the perinatal period may lead to adverse outcomes such as miscarriages and newborn disease the purpose of present study was to evaluate the influence of antibiotic exposure in offspring following treatments of gravid female zebrafish to an antibiotic mixture. For the F0 generation adult zebrafish AB strain at sexual maturity 150 dpf dpf were selected for experimentation 50% male and 50% pregnant female. Given a significant change occurred in eggs production and F1 survival at birth in present study combined with antibiotics bioaccumulated in ovary we suspect that antibiotic exposure might impact the ovary of F0 generation zebrafish and thus affect egg production and survival. Therefore ovaries of the F0 generation were evaluated for transcriptional effects in different antibiotics mixture exposure 0 1 and 100 ug/L using a HTS approach coupled with advanced bioinformatic tools.,,,,C0 1,C0 1,,strain:AB|isolate:C0|breed:not applicable|cultivar:not applicable|ecotype:not applicable|age:not applicable|dev stage:not applicable|sex:female|tissue:ovary|collection date:2019 11 01|geo loc name:China: Shenzhen Guangdong|replicate:biological replicate 1|BioSampleModel:Model organism or animal,,,,,,,,,RNA seq of zebrafish,C0 120200319,C0 120200319,RNA seq of zebrafish in different conditions,,,RNA-Seq,TRANSCRIPTOMIC,RANDOM PCR,PAIRED,BGISEQ,BGISEQ-500,,SRP253408,,,C0_1_1.fq.gz C0_1_2.fq.gz,fastq fastq,7030804800.0,46872032.0,C0 1 1.fq.gz,0:150 1:150,A:1891469955;C:1624531422;G:1603124564;T:1911444454;N:234405,150,150,,,1891469955,1624531422,1603124564,1911444454,234405,SRX7957241,SRS6343348,SRA1056819,Southern University of Science and Technology|School of Environmental Science and Engineering,Southern University of Science and Technology,1,0.93519,,0.0328,,0.74602,,0.48272,,150,,B,,usable mapping rate,bgi,bgi,unknown,random_priming,unknown,bulk,unknown,unknown,,China,2020-03-20,Undetermined,Adult,Gonad,Reproductive System 61505,SRR12786081,SRX9255339,SRS7487541,SRP286633,PRJNA667863,Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs,GSE159162,Transcriptome Analysis,Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.,,pubmed:35532311,,Sample WT FG 4,GSM4820795,,source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type,Sample WT FG 4,Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample,follicles,,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.,,tissue:Ovary|stage of follicles:FG|genotype:wild type,GSM4820795,GSM4820795: Sample WT FG 4; Danio rerio; RNA Seq,GSM4820795,,1,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.,GEO Accession:GSM4820795,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP286633,,,Sample_WT_FG_4.R1.fq.gz Sample_WT_FG_4.R2.fq.gz,fastq fastq,6494839649.0,22379034.0,GSM4820795 r1,0:145.94 1:144.28,A:1649345658;C:1579352648;G:1580948162;T:1685086821;N:106360,145,144,,,1649345658,1579352648,1580948162,1685086821,106360,SRX9255339,SRS7487541,SRA1139682,GEO,Institute of Hydrobiology,2,0.94646,0.94736,0.01915,0.01888,0.75554,0.75566,0.50735,0.50347,150,150,B,B,biological fallback assumption,illumina,hiseq_era,unknown,small_rna,trueseq,bulk,unknown,unknown,,China,2020-10-07,Undetermined,Undetermined,Gonad,Reproductive System 61506,SRR12786080,SRX9255338,SRS7487540,SRP286633,PRJNA667863,Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs,GSE159162,Transcriptome Analysis,Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.,,pubmed:35532311,,Sample WT FG 3,GSM4820794,,source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type,Sample WT FG 3,Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample,follicles,,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.,,tissue:Ovary|stage of follicles:FG|genotype:wild type,GSM4820794,GSM4820794: Sample WT FG 3; Danio rerio; RNA Seq,GSM4820794,,1,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.,GEO Accession:GSM4820794,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP286633,,,Sample_WT_FG_3.R1.fq.gz Sample_WT_FG_3.R2.fq.gz,fastq fastq,6925670591.0,23930393.0,GSM4820794 r1,0:145.51 1:143.90,A:1758516170;C:1686214780;G:1687326968;T:1793466364;N:146309,145,143,,,1758516170,1686214780,1687326968,1793466364,146309,SRX9255338,SRS7487540,SRA1139682,GEO,Institute of Hydrobiology,2,0.94987,0.95208,0.01972,0.01986,0.75779,0.75891,0.49235,0.49103,150,150,B,B,biological fallback assumption,illumina,hiseq_era,unknown,small_rna,trueseq,bulk,unknown,unknown,,China,2020-10-07,Undetermined,Undetermined,Gonad,Reproductive System 61507,SRR12786079,SRX9255337,SRS7487539,SRP286633,PRJNA667863,Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs,GSE159162,Transcriptome Analysis,Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.,,pubmed:35532311,,Sample WT FG 2,GSM4820793,,source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type,Sample WT FG 2,Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample,follicles,,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.,,tissue:Ovary|stage of follicles:FG|genotype:wild type,GSM4820793,GSM4820793: Sample WT FG 2; Danio rerio; RNA Seq,GSM4820793,,1,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.,GEO Accession:GSM4820793,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP286633,,,Sample_WT_FG_2.R1.fq.gz Sample_WT_FG_2.R2.fq.gz,fastq fastq,6937720341.0,23868543.0,GSM4820793 r1,0:146.23 1:144.43,A:1760323867;C:1687409068;G:1688288208;T:1801543463;N:155735,146,144,,,1760323867,1687409068,1688288208,1801543463,155735,SRX9255337,SRS7487539,SRA1139682,GEO,Institute of Hydrobiology,2,0.94558,0.94771,0.01901,0.01877,0.75915,0.75893,0.49355,0.49438,86,86,B,B,biological fallback assumption,illumina,hiseq_era,unknown,small_rna,trueseq,bulk,unknown,unknown,,China,2020-10-07,Undetermined,Undetermined,Gonad,Reproductive System 61508,SRR12786078,SRX9255336,SRS7487538,SRP286633,PRJNA667863,Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs,GSE159162,Transcriptome Analysis,Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.,,pubmed:35532311,,Sample WT FG 1,GSM4820792,,source name:follicles|tissue:Ovary|stage of follicles:FG|genotype:wild type,Sample WT FG 1,Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample,follicles,,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.,,tissue:Ovary|stage of follicles:FG|genotype:wild type,GSM4820792,GSM4820792: Sample WT FG 1; Danio rerio; RNA Seq,GSM4820792,,1,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.,GEO Accession:GSM4820792,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP286633,,,Sample_WT_FG_1.R1.fq.gz Sample_WT_FG_1.R2.fq.gz,fastq fastq,6967269048.0,23937357.0,GSM4820792 r1,0:146.29 1:144.78,A:1778908738;C:1684335965;G:1686285595;T:1817522579;N:216171,146,144,,,1778908738,1684335965,1686285595,1817522579,216171,SRX9255336,SRS7487538,SRA1139682,GEO,Institute of Hydrobiology,2,0.9478,0.94904,0.0209,0.02072,0.75653,0.75716,0.48347,0.48235,150,150,B,B,biological fallback assumption,illumina,hiseq_era,unknown,small_rna,trueseq,bulk,unknown,unknown,,China,2020-10-07,Undetermined,Undetermined,Gonad,Reproductive System 61509,SRR12786077,SRX9255335,SRS7487537,SRP286633,PRJNA667863,Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs,GSE159162,Transcriptome Analysis,Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.,,pubmed:35532311,,Sample WT EGG 5,GSM4820791,,source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type,Sample WT EGG 5,Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample,follicles,,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.,,tissue:Ovary|stage of follicles:mature egg|genotype:wild type,GSM4820791,GSM4820791: Sample WT EGG 5; Danio rerio; RNA Seq,GSM4820791,,1,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.,GEO Accession:GSM4820791,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP286633,,,Sample_WT_EGG_5.R1.fq.gz Sample_WT_EGG_5.R2.fq.gz,fastq fastq,6759669369.0,23484870.0,GSM4820791 r1,0:144.70 1:143.13,A:1779446270;C:1589997978;G:1589479961;T:1800569943;N:175217,144,143,,,1779446270,1589997978,1589479961,1800569943,175217,SRX9255335,SRS7487537,SRA1139682,GEO,Institute of Hydrobiology,2,0.93866,0.94281,0.02922,0.02836,0.81203,0.81211,0.50024,0.50364,150,150,B,B,biological fallback assumption,illumina,hiseq_era,unknown,small_rna,trueseq,bulk,unknown,unknown,,China,2020-10-07,Undetermined,Undetermined,Gonad,Reproductive System 61510,SRR12786076,SRX9255334,SRS7487536,SRP286633,PRJNA667863,Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs,GSE159162,Transcriptome Analysis,Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.,,pubmed:35532311,,Sample WT EGG 4,GSM4820790,,source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type,Sample WT EGG 4,Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample,follicles,,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.,,tissue:Ovary|stage of follicles:mature egg|genotype:wild type,GSM4820790,GSM4820790: Sample WT EGG 4; Danio rerio; RNA Seq,GSM4820790,,1,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.,GEO Accession:GSM4820790,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP286633,,,Sample_WT_EGG_4.R1.fq.gz Sample_WT_EGG_4.R2.fq.gz,fastq fastq,6507516169.0,22482048.0,GSM4820790 r1,0:145.79 1:143.66,A:1716909756;C:1525253185;G:1525859003;T:1739392348;N:101877,145,143,,,1716909756,1525253185,1525859003,1739392348,101877,SRX9255334,SRS7487536,SRA1139682,GEO,Institute of Hydrobiology,2,0.93927,0.94219,0.02868,0.02773,0.81225,0.81268,0.51042,0.50948,150,150,B,B,biological fallback assumption,illumina,hiseq_era,unknown,small_rna,trueseq,bulk,unknown,unknown,,China,2020-10-07,Undetermined,Undetermined,Gonad,Reproductive System 61511,SRR12786075,SRX9255333,SRS7487535,SRP286633,PRJNA667863,Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs,GSE159162,Transcriptome Analysis,Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.,,pubmed:35532311,,Sample WT EGG 3,GSM4820789,,source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type,Sample WT EGG 3,Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample,follicles,,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.,,tissue:Ovary|stage of follicles:mature egg|genotype:wild type,GSM4820789,GSM4820789: Sample WT EGG 3; Danio rerio; RNA Seq,GSM4820789,,1,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.,GEO Accession:GSM4820789,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP286633,,,Sample_WT_EGG_3.R1.fq.gz Sample_WT_EGG_3.R2.fq.gz,fastq fastq,6892017136.0,23794526.0,GSM4820789 r1,0:145.73 1:143.92,A:1860381019;C:1583189044;G:1576215039;T:1872104069;N:127965,145,143,,,1860381019,1583189044,1576215039,1872104069,127965,SRX9255333,SRS7487535,SRA1139682,GEO,Institute of Hydrobiology,2,0.93308,0.93454,0.03385,0.0331,0.82836,0.82862,0.51253,0.52212,150,150,B,B,biological fallback assumption,illumina,hiseq_era,unknown,small_rna,trueseq,bulk,unknown,unknown,,China,2020-10-07,Undetermined,Undetermined,Gonad,Reproductive System 61512,SRR12786074,SRX9255332,SRS7487534,SRP286633,PRJNA667863,Genes related to microtubule functions were downregulated in sinhcaf mutant FG follicles and eggs,GSE159162,Transcriptome Analysis,Transcriptome sequencing RNA seq analysis uncovered that 1238 genes were upregulated 923 genes were downregulated in sinhcaf mutant FG follicles compared to wild type FG follicles. Loss of sinhcaf in mature eggs resulted in upregulation of 904 genes and downregulation of 911 genes. Downregulated genes in sinhcaf mutant FG follicles and eggs were classified by gene ontology GO analysis then the top 30 GO terms with highest log10P values were screened out and at least two downregulated genes were included in each biological processes cellular components or molecular function term. Microtubules and microtubule based processes were included in the top 30 GO terms. Overall design: RNA sequencing was performed on five biological replicates for mature egg four biological replicates for FG follicle of wild type and sinhcaf mutant zebrafish. Each biological replicate was a pool of mature eggs or FG follicles from one female zebrafish.,,pubmed:35532311,,Sample WT EGG 2,GSM4820788,,source name:follicles|tissue:Ovary|stage of follicles:mature egg|genotype:wild type,Sample WT EGG 2,Then these libraries were sequenced on the Illumina sequencing platform Illumina HiSeq X Ten and 150bp paired end reads were generated. Raw data raw reads were processed using Trimmomatic. The reads containing poly N and the low quality reads were removed to obtain the clean reads. These clean reads were mapped to reference genome using hisat2. FPKM value of each gene was calculated using cufflinks and the read counts of each gene were obtained by htseq count. Genome build: GRCz11 Supplementary files format and content: Txt file includes gene ID gene name and FPKM values for each Sample,follicles,,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer’s protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer’s instructions.,,tissue:Ovary|stage of follicles:mature egg|genotype:wild type,GSM4820788,GSM4820788: Sample WT EGG 2; Danio rerio; RNA Seq,GSM4820788,,1,Total RNA was extracted using the mirVana miRNA Isolation Kit Ambion following the manufacturer's protocol. RNA integrity was evaluated using the Agilent 2100 Bioanalyzer Agilent Technologies Santa Clara CA USA. The samples with RNA Integrity Number RIN ≥ 7 were subjected to the subsequent analysis. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit Illumina San Diego CA USA according to the manufacturer's instructions.,GEO Accession:GSM4820788,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,HiSeq X Ten,,SRP286633,,,Sample_WT_EGG_2.R1.fq.gz Sample_WT_EGG_2.R2.fq.gz,fastq fastq,5738534730.0,20501677.0,GSM4820788 r1,0:140.71 1:139.19,A:1521303459;C:1341529264;G:1344606059;T:1531008879;N:87069,140,139,,,1521303459,1341529264,1344606059,1531008879,87069,SRX9255332,SRS7487534,SRA1139682,GEO,Institute of Hydrobiology,2,0.93514,0.93628,0.03038,0.02998,0.82471,0.82477,0.51484,0.52018,78,80,B,B,biological fallback assumption,illumina,hiseq_era,unknown,small_rna,trueseq,bulk,unknown,unknown,,China,2020-10-07,Undetermined,Undetermined,Gonad,Reproductive System