rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse
9419,ERR273825,ERX248101,ERS092357,ERP001559,PRJEB3118,Zebrafish transcript profiling,Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82,Transcriptome Analysis,Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.,,,,,SAMEA1888984,SC,ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:14Z|ENA LAST UPDATE:2018 03 08T15:36:21Z|External Id:SAMEA1888984|INSDC center name:SC|INSDC first public:2013 05 13T11:13:14Z|INSDC last update:2018 03 08T15:36:21Z|INSDC status:public|Submitter Id:hu2117 mutant vs wild type sc 2012 02 06T13:11:11Z 1107268|common name:zebrafish|sample description:3 prime end enriched mRNA from 3 morphological mutant hu2117 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:hu2117 mutant vs wild type sc 2012 02 06T13:11:11Z 1107268|scientific name:Danio rerio,,,,,,,,,1,SC EXP 6316 8,2387558,Illumina sequencing of library 2387558 constructed from sample accession ERS092357 for study accession ERP001559.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001559,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16,6316_8.bam,bam,12715227300.0,84768182.0,SC RUN 6316 8,0:75 1:75,A:3986328155;C:1983554902;G:2466211000;T:4277430579;N:1702664,75,75,,,3986328155,1983554902,2466211000,4277430579,1702664,ERX248101,ERS092357,ERA212579,SC,Wellcome Sanger Institute,2,0.06657,0.60346,0.04569,0.19203,0.9767,0.82014,0.52373,0.4048,75,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-05-13,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
9420,ERR273824,ERX248100,ERS092356,ERP001559,PRJEB3118,Zebrafish transcript profiling,Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82,Transcriptome Analysis,Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.,,,,,SAMEA1889000,SC,ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:13Z|ENA LAST UPDATE:2018 03 08T15:36:25Z|External Id:SAMEA1889000|INSDC center name:SC|INSDC first public:2013 05 13T11:13:13Z|INSDC last update:2018 03 08T15:36:25Z|INSDC status:public|Submitter Id:e48 mutant vs wild type sc 2012 02 06T13:11:09Z 1107267|common name:zebrafish|sample description:3 prime end enriched mRNA from 3 morphological mutant e48 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:e48 mutant vs wild type sc 2012 02 06T13:11:09Z 1107267|scientific name:Danio rerio,,,,,,,,,1,SC EXP 6316 7,2387557,Illumina sequencing of library 2387557 constructed from sample accession ERS092356 for study accession ERP001559.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001559,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16,6316_7.bam,bam,17475932100.0,116506214.0,SC RUN 6316 7,0:75 1:75,A:5548228936;C:2693024343;G:3365940794;T:5867204994;N:1533033,75,75,,,5548228936,2693024343,3365940794,5867204994,1533033,ERX248100,ERS092356,ERA212579,SC,Wellcome Sanger Institute,2,0.05939,0.59457,0.04089,0.19671,0.98068,0.838,0.46304,0.62741,75,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-05-13,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
9421,ERR273823,ERX248099,ERS092354,ERP001559,PRJEB3118,Zebrafish transcript profiling,Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82,Transcriptome Analysis,Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.,,,,,SAMEA1889008,SC,ArrayExpress Sex:mixed|ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:13Z|ENA LAST UPDATE:2018 03 08T15:36:21Z|External Id:SAMEA1889008|INSDC center name:SC|INSDC first public:2013 05 13T11:13:13Z|INSDC last update:2018 03 08T15:36:21Z|INSDC status:public|Submitter Id:hu3332 mutant vs wild type sc 2012 02 06T13:11:07Z 1107265|common name:zebrafish|sample description:3 prime end enriched mRNA from 3 morphological mutant hu3332 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:hu3332 mutant vs wild type sc 2012 02 06T13:11:07Z 1107265|scientific name:Danio rerio,,,,,,,,,1,SC EXP 6316 5,2387555,Illumina sequencing of library 2387555 constructed from sample accession ERS092354 for study accession ERP001559.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,ERP001559,Illumina HiSeq 2000 paired end sequencing,ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16,6316_5.bam,bam,13995917850.0,93306119.0,SC RUN 6316 5,0:75 1:75,A:4367273029;C:2176748810;G:2714026832;T:4736121060;N:1748119,75,75,,,4367273029,2176748810,2714026832,4736121060,1748119,ERX248099,ERS092354,ERA212579,SC,Wellcome Sanger Institute,2,0.06401,0.62019,0.04224,0.18728,0.97723,0.81071,0.461,0.55379,75,75,T,B,mate1 technical by mapping diff,illumina,hiseq_era,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-05-13,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
9422,ERR273822,ERX248098,ERS092063,ERP001559,PRJEB3118,Zebrafish transcript profiling,Zebrafish_transcript_profiling-sc-2012-06-28T15:47:32Z-82,Transcriptome Analysis,Paired end sequence data from the Illumina Genome Analyzer was prepared from normal and mutant zebrafish embryos for transcript profiling. This includes pilot studies for transcript indexing within the sequence reads.,,,,,SAMEA1888996,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2013 05 13T11:13:13Z|ENA LAST UPDATE:2018 03 08T15:36:13Z|External Id:SAMEA1888996|INSDC center name:SC|INSDC first public:2013 05 13T11:13:13Z|INSDC last update:2018 03 08T15:36:13Z|INSDC status:public|Submitter Id:sa0058 mutant vs wild type sc 2012 02 06T13:05:07Z 265521|common name:zebrafish|sample description:33 prime end enriched mRNA from 3 morphological mutant sa0058 embryo samples and 3 matched sibling wild type samples. A 6 base indexing sequence is bases 5 to 10 of read 1 followed by polyT.|sample name:sa0058 mutant vs wild type sc 2012 02 06T13:05:07Z 265521|scientific name:Danio rerio,,,,,,,,,1,SC EXP 5287 7,449230,Illumina sequencing of library 449230 constructed from sample accession ERS092063 for study accession ERP001559.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina Genome Analyzer II,,ERP001559,Illumina Genome Analyzer II paired end sequencing,ENA FIRST PUBLIC:2013 05 13|ENA LAST UPDATE:2018 11 16,5287_7.bam,bam,2216402460.0,20522245.0,SC RUN 5287 7,0:54 1:54,A:646882787;C:346392353;G:394060191;T:827745173;N:1321956,54,54,,,646882787,346392353,394060191,827745173,1321956,ERX248098,ERS092063,ERA212579,SC,Wellcome Sanger Institute,2,0.02565,0.72009,0.01691,0.21429,0.98725,0.78944,0.62084,0.61278,54,54,T,B,mate1 technical by mapping diff,illumina,early_illumina,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2013-05-13,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11777,ERR11758595,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S36_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S36_L001_R1_001.fastq.gz,fastq fastq,211593816.0,1679316.0,E MTAB 13196:drl h2b dendra tb S36 L001,0:28 1:98,A:62689430;C:45809168;G:45709128;T:57272091;N:113999,28,98,,,62689430,45809168,45709128,57272091,113999,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.00192,0.91331,0.00072,0.14588,0.99675,0.89292,0.51304,0.63144,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11778,ERR11758629,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S37_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S37_L001_R1_001.fastq.gz,fastq fastq,980164836.0,7779086.0,E MTAB 13196:drl h2b dendra tb S37 L001,0:28 1:98,A:281375011;C:216067640;G:222839674;T:259781180;N:101331,28,98,,,281375011,216067640,222839674,259781180,101331,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.00817,0.89718,0.00237,0.12153,0.98912,0.82643,0.46403,0.64954,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11779,ERR11758618,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S39_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S39_L001_R1_001.fastq.gz,fastq fastq,12118302.0,96177.0,E MTAB 13196:drl h2b dendra tb S39 L001,0:28 1:98,A:3543790;C:2662872;G:2728134;T:3182383;N:1123,28,98,,,3543790,2662872,2728134,3182383,1123,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.00786,0.88963,0.0025,0.12543,0.99403,0.88635,0.50098,0.64694,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11780,ERR11758643,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S5_L005_R2_001.fastq.gz drl_h2b-dendra_tb_S5_L005_R1_001.fastq.gz,fastq fastq,2061022698.0,16357323.0,E MTAB 13196:drl h2b dendra tb S5 L005,0:28 1:98,A:587730953;C:457631700;G:470283474;T:545196979;N:179592,28,98,,,587730953,457631700,470283474,545196979,179592,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.01192,0.91661,0.00336,0.12397,0.98518,0.82568,0.45692,0.65555,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11781,ERR11758610,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S38_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S38_L001_R1_001.fastq.gz,fastq fastq,924603120.0,7338120.0,E MTAB 13196:drl h2b dendra tb S38 L001,0:28 1:98,A:265987815;C:203824483;G:210024160;T:244670646;N:96016,28,98,,,265987815,203824483,210024160,244670646,96016,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.00773,0.89881,0.00242,0.12145,0.98944,0.82948,0.50529,0.66568,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11782,ERR11758641,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S6_L005_R2_001.fastq.gz drl_h2b-dendra_tb_S6_L005_R1_001.fastq.gz,fastq fastq,1954661562.0,15513187.0,E MTAB 13196:drl h2b dendra tb S6 L005,0:28 1:98,A:558769608;C:433724557;G:445550100;T:516443984;N:173313,28,98,,,558769608,433724557,445550100,516443984,173313,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.0125,0.91697,0.00373,0.12359,0.98447,0.82558,0.4881,0.6456,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11783,ERR11758591,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S35_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S35_L001_R1_001.fastq.gz,fastq fastq,4717188.0,37438.0,E MTAB 13196:drl h2b dendra tb S35 L001,0:28 1:98,A:1419430;C:1014265;G:1016661;T:1264642;N:2190,28,98,,,1419430,1014265,1016661,1264642,2190,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.0012,0.65482,0.00054,0.10783,0.99953,0.97157,0.625,0.63689,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11784,ERR11758606,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S34_L001_R1_001.fastq.gz drl_h2b-dendra_tb_S34_L001_R2_001.fastq.gz,fastq fastq,303645636.0,2409886.0,E MTAB 13196:drl h2b dendra tb S34 L001,0:28 1:98,A:90748559;C:65369482;G:65969002;T:81405258;N:153335,28,98,,,90748559,65369482,65969002,81405258,153335,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.00228,0.91262,0.00099,0.14666,0.99638,0.89006,0.47177,0.63109,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11785,ERR11758640,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S40_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S40_L001_R1_001.fastq.gz,fastq fastq,661361022.0,5248897.0,E MTAB 13196:drl h2b dendra tb S40 L001,0:28 1:98,A:190087869;C:145985661;G:150124621;T:175095762;N:67109,28,98,,,190087869,145985661,150124621,175095762,67109,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.00785,0.89784,0.00251,0.12159,0.98948,0.83055,0.46095,0.64951,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11786,ERR11758605,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S7_L005_R2_001.fastq.gz drl_h2b-dendra_tb_S7_L005_R1_001.fastq.gz,fastq fastq,25157790.0,199665.0,E MTAB 13196:drl h2b dendra tb S7 L005,0:28 1:98,A:7330053;C:5600451;G:5635840;T:6589498;N:1948,28,98,,,7330053,5600451,5635840,6589498,1948,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.01201,0.91385,0.00341,0.12826,0.98595,0.85161,0.49226,0.64953,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11787,ERR11758600,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S8_L005_R2_001.fastq.gz drl_h2b-dendra_tb_S8_L005_R1_001.fastq.gz,fastq fastq,1422735804.0,11291554.0,E MTAB 13196:drl h2b dendra tb S8 L005,0:28 1:98,A:405788442;C:317299433;G:322206476;T:377317416;N:124037,28,98,,,405788442,317299433,322206476,377317416,124037,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.01226,0.91547,0.0037,0.12565,0.9849,0.83662,0.48279,0.64531,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
11788,ERR11758616,ERX11157718,ERS16172936,ERP149744,PRJEB64563,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E-MTAB-13196,Transcriptome Analysis,Development of the dorsal aorta is a key step in the establishment of the adult blood forming system since hematopoietic stem and progenitor cells HSPCs arise from ventral aortic endothelium in all vertebrate animals studied. Work in zebrafish has demonstrated that arterial and venous endothelial precursors arise from distinct subsets of lateral plate mesoderm. Here we profile the transcriptome of the earliest detectable endothelial cells ECs during zebrafish embryogenesis to demonstrate that tissue specific EC programs initiate much earlier than previously appreciated by the end of gastrulation. Classic studies in the chick embryo showed that paraxial mesoderm generates a subset of somite derived endothelial cells SDECs that incorporate into the dorsal aorta to replace HSPCs as they exit the aorta and enter circulation. We describe a conserved program in the zebrafish where a rare population of endothelial precursors delaminates from the dermomyotome to incorporate exclusively into the developing dorsal aorta. Whereas SDECs lack hematopoietic potential they act as a local niche to support the emergence of HSPCs from neighboring hemogenic endothelium. Thus at least three subsets of ECs contribute to the developing dorsal aorta: vascular ECs hemogenic ECs and SDECs. Taken together our findings indicate that the distinct spatial origins of endothelial precursors dictate different cellular potentials within the developing dorsal aorta.,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,,Protocols: Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3ʹ GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,drl tb,SAMEA114192243,Institute of Molecular Genetics of the Czech Academy of Sciences,ENA FIRST PUBLIC:2023 08 01T00:17:16Z|ENA LAST UPDATE:2023 08 01T00:17:16Z|External Id:SAMEA114192243|INSDC center alias:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC center name:Institute of Molecular Genetics of the Czech Academy of Sciences|INSDC first public:2023 08 01T00:17:16Z|INSDC last update:2023 08 01T00:17:16Z|INSDC status:public|Submitter Id:E MTAB 13196:drl tb|age:10|broker name:ArrayExpress|cell type:endothelial cell|collection date:not collected|common name:zebrafish|developmental stage:tail bud prominent stage|genotype:drl:H2B Dendra2|geographic location country and/or sea:not collected|immunophenotype:drl:H2B Dendra2+|isolate:not applicable|organism part:embryo|sample name:E MTAB 13196:drl tb|scientific name:Danio rerio|strain:drl:H2B Dendra2,,,,,,,,,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,E MTAB 13196:drl tb p,drl tb p,Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,Dechorionated embryos were collected at defined stages dissociated by pipetting centrifugation at 300g for 5 minutes washed once with PBS and sorted by FACS. Total cell concentration and viability were determined using a TC20 Automated Cell Counter Bio Rad. Samples were then re suspended in 1x PBS with 0.05% BSA at 800 3000 cells per ml. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation. Samples were loaded on the 10x Chromium system with a target of 4 000 cells. Chromium Single Cell 3สน GEM Library & Gel Bead Kit v2 or v3 was used for library preparation.,,RNA-Seq,TRANSCRIPTOMIC SINGLE CELL,Oligo-dT,PAIRED,ILLUMINA,Illumina HiSeq 2500,,ERP149744,Illumina HiSeq 2500 paired end sequencing; Single cell RNA seq 10x Chromium of FACS sorted drl:H2B Dendra2 etv2:Kaede fli1:DsRed and tp1:eGFP transgenic zebrafish embryos,ENA FIRST PUBLIC:2023 08 01|ENA LAST UPDATE:2023 08 01,drl_h2b-dendra_tb_S33_L001_R2_001.fastq.gz drl_h2b-dendra_tb_S33_L001_R1_001.fastq.gz,fastq fastq,328918212.0,2610462.0,E MTAB 13196:drl h2b dendra tb S33 L001,0:28 1:98,A:98036464;C:71090137;G:71650807;T:87969481;N:171323,28,98,,,98036464,71090137,71650807,87969481,171323,ERX11157718,ERS16172936,ERA25628220,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,Institute of Molecular Genetics of the Czech Academy of Sciences|European Nucleotide Archive,2,0.00197,0.89969,0.00087,0.14269,0.99681,0.89134,0.49763,0.63651,28,98,T,B,sc-like readlen,illumina,hiseq_era,unknown,poly_a,unknown,sc,single_cell_droplet,10x,,Czech Republic,2023-08-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21439,ERR863500,ERX943150,ERS709981,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355680,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:53Z|External Id:SAMEA3355680|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:53Z|INSDC status:public|Submitter Id:spike dilution 5x 3 sc 1822515|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence CTTGTACT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 5x used.|sample name:spike dilution 5x 3 sc 1822515|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#12,9199436,Illumina sequencing of library 9199436 constructed from sample accession ERS709981 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence CTTGTACT.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#12.cram,cram,594698440.0,2123923.0,SC RUN 12025 1#12,0:130 1:150,A:191689930;C:107464803;G:124772545;T:170732108;N:39054,130,150,,,191689930,107464803,124772545,170732108,39054,ERX943150,ERS709981,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.64129,0.51516,0.21404,0.14552,0.84687,0.88377,0.72598,0.68367,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21440,ERR863499,ERX943149,ERS709980,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355679,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355679|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 5x 2 sc 1822514|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence GGCTACAG is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 5x used.|sample name:spike dilution 5x 2 sc 1822514|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#11,9199435,Illumina sequencing of library 9199435 constructed from sample accession ERS709980 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence GGCTACAG.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#11.cram,cram,581766920.0,2077739.0,SC RUN 12025 1#11,0:130 1:150,A:183939274;C:107734540;G:120783489;T:169271980;N:37637,130,150,,,183939274,107734540,120783489,169271980,37637,ERX943149,ERS709980,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.64005,0.5261,0.23053,0.15645,0.84589,0.88055,0.69474,0.68776,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21441,ERR863498,ERX943148,ERS709979,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355678,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:19:26Z|External Id:SAMEA3355678|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:19:26Z|INSDC status:public|Submitter Id:spike dilution 5x 1 sc 1822513|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development.. A 8 base indexing sequence TAGCTTGT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 5x used.|sample name:spike dilution 5x 1 sc 1822513|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#10,9199434,Illumina sequencing of library 9199434 constructed from sample accession ERS709979 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence TAGCTTGT.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#10.cram,cram,476835240.0,1702983.0,SC RUN 12025 1#10,0:130 1:150,A:152841008;C:89036877;G:100030474;T:134895194;N:31687,130,150,,,152841008,89036877,100030474,134895194,31687,ERX943148,ERS709979,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.64423,0.53089,0.22177,0.15517,0.84301,0.88061,0.69469,0.68545,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21442,ERR863497,ERX943147,ERS709978,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355677,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 08T23:24:54Z|External Id:SAMEA3355677|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 08T23:24:54Z|INSDC status:public|Submitter Id:spike dilution 1x 3 sc 1822512|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence GATCAGCG is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1x used.|sample name:spike dilution 1x 3 sc 1822512|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#9,9199433,Illumina sequencing of library 9199433 constructed from sample accession ERS709978 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence GATCAGCG.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#9.cram,cram,491187760.0,1754242.0,SC RUN 12025 1#9,0:130 1:150,A:153998911;C:91564987;G:102964774;T:142629578;N:29510,130,150,,,153998911,91564987,102964774,142629578,29510,ERX943147,ERS709978,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.64377,0.57656,0.20075,0.14986,0.83617,0.86991,0.67695,0.66089,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21443,ERR863496,ERX943146,ERS709977,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355676,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355676|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 1x 2 sc 1822511|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development.. A 8 base indexing sequence ACTTGATG is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1x used.|sample name:spike dilution 1x 2 sc 1822511|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#8,9199432,Illumina sequencing of library 9199432 constructed from sample accession ERS709977 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence ACTTGATG.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#8.cram,cram,533824480.0,1906516.0,SC RUN 12025 1#8,0:130 1:150,A:174500124;C:96003940;G:110166141;T:153115655;N:38620,130,150,,,174500124,96003940,110166141,153115655,38620,ERX943146,ERS709977,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.60583,0.49667,0.19917,0.13412,0.84488,0.88657,0.71075,0.69436,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21444,ERR863495,ERX943145,ERS709976,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355675,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:19:26Z|External Id:SAMEA3355675|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:19:26Z|INSDC status:public|Submitter Id:spike dilution 1x 1 sc 1822510|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence CAGATCTG is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1x used.|sample name:spike dilution 1x 1 sc 1822510|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#7,9199431,Illumina sequencing of library 9199431 constructed from sample accession ERS709976 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence CAGATCTG.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#7.cram,cram,479344040.0,1711943.0,SC RUN 12025 1#7,0:130 1:150,A:153765243;C:86981600;G:100250304;T:138314172;N:32721,130,150,,,153765243,86981600,100250304,138314172,32721,ERX943145,ERS709976,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.61061,0.50608,0.21328,0.13841,0.84585,0.88446,0.66959,0.36844,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21445,ERR863494,ERX943144,ERS709975,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355674,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 08T23:24:54Z|External Id:SAMEA3355674|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 08T23:24:54Z|INSDC status:public|Submitter Id:spike dilution 0 2x 3 sc 1822509|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence GCCAATGT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/5x used.|sample name:spike dilution 0 2x 3 sc 1822509|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#6,9199430,Illumina sequencing of library 9199430 constructed from sample accession ERS709975 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence GCCAATGT.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#6.cram,cram,591015320.0,2110769.0,SC RUN 12025 1#6,0:130 1:150,A:188141976;C:106674036;G:122384245;T:173776046;N:39017,130,150,,,188141976,106674036,122384245,173776046,39017,ERX943144,ERS709975,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.62433,0.52721,0.18742,0.13166,0.84273,0.87507,0.69441,0.67941,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21446,ERR863493,ERX943143,ERS709974,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355673,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355673|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 0 2x 2 sc 1822508|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence ACAGTGGT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/5x used.|sample name:spike dilution 0 2x 2 sc 1822508|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#5,9199429,Illumina sequencing of library 9199429 constructed from sample accession ERS709974 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence ACAGTGGT.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#5.cram,cram,602681240.0,2152433.0,SC RUN 12025 1#5,0:130 1:150,A:190852332;C:112068952;G:124549622;T:175168287;N:42047,130,150,,,190852332,112068952,124549622,175168287,42047,ERX943143,ERS709974,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.63341,0.5243,0.17928,0.12195,0.842,0.87963,0.70223,0.68203,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21447,ERR863492,ERX943142,ERS709973,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355672,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:19:26Z|External Id:SAMEA3355672|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:19:26Z|INSDC status:public|Submitter Id:spike dilution 0 2x 1 sc 1822507|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development.. A 8 base indexing sequence TGACCACT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/5x used.|sample name:spike dilution 0 2x 1 sc 1822507|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#4,9199428,Illumina sequencing of library 9199428 constructed from sample accession ERS709973 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence TGACCACT.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#4.cram,cram,608612200.0,2173615.0,SC RUN 12025 1#4,0:130 1:150,A:190261414;C:112413582;G:131456617;T:174436676;N:43911,130,150,,,190261414,112413582,131456617,174436676,43911,ERX943142,ERS709973,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.63718,0.51969,0.19272,0.13088,0.84591,0.88016,0.70626,0.67478,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21448,ERR863491,ERX943141,ERS709972,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355671,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 08T23:24:54Z|External Id:SAMEA3355671|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 08T23:24:54Z|INSDC status:public|Submitter Id:spike dilution 0 1x 3 sc 1822506|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence TTAGGCAT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/10x used.|sample name:spike dilution 0 1x 3 sc 1822506|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#3,9199427,Illumina sequencing of library 9199427 constructed from sample accession ERS709972 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence TTAGGCAT.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#3.cram,cram,559727840.0,1999028.0,SC RUN 12025 1#3,0:130 1:150,A:176833359;C:103868174;G:116658831;T:162329215;N:38261,130,150,,,176833359,103868174,116658831,162329215,38261,ERX943141,ERS709972,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.64315,0.53769,0.19922,0.14749,0.84467,0.88075,0.71042,0.68107,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21449,ERR863490,ERX943140,ERS709971,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355670,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355670|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 0 1x 2 sc 1822505|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence CGATGTTT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/10x used.|sample name:spike dilution 0 1x 2 sc 1822505|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#2,9199426,Illumina sequencing of library 9199426 constructed from sample accession ERS709971 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence CGATGTTT.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#2.cram,cram,544839960.0,1945857.0,SC RUN 12025 1#2,0:130 1:150,A:174691595;C:103044374;G:115824582;T:151241960;N:37449,130,150,,,174691595,103044374,115824582,151241960,37449,ERX943140,ERS709971,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.61405,0.52252,0.19134,0.13417,0.8578,0.89532,0.74009,0.73124,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
21450,ERR863489,ERX943139,ERS709970,ERP010224,PRJEB9145,Transcriptome profiling protocol development,Transcriptome_profiling_protocol_development-sc-2914,Transcriptome Analysis,Paired end sequence data from the IlluminaHiSeq was prepared from mutant and wild type zebrafish embryos from the Zebrafish Mutation Project for transcriptome profiling,,,,,SAMEA3355669,SC,ArrayExpress Species:Danio rerio|ENA FIRST PUBLIC:2015 04 21T14:58:32Z|ENA LAST UPDATE:2018 03 09T00:28:08Z|External Id:SAMEA3355669|INSDC center name:SC|INSDC first public:2015 04 21T14:58:32Z|INSDC last update:2018 03 09T00:28:08Z|INSDC status:public|Submitter Id:spike dilution 0 1x 1 sc 1822504|common name:zebrafish|sample description:3 prime end enriched mRNA from morphologically normal zebrafish embryos for protocol development. A 8 base indexing sequence ATCACGTT is bases 13 to 20 of read 1 followed by CG and polyT. 10uM 8mers used. Spike dilution of 1/10x used.|sample name:spike dilution 0 1x 1 sc 1822504|scientific name:Danio rerio|strain:mixed,,,,,,,,,Illumina MiSeq paired end sequencing,SC EXP 12025 1#1,9199425,Illumina sequencing of library 9199425 constructed from sample accession ERS709970 for study accession ERP010224. This is part of an Illumina multiplexed sequencing run 12025 1. This submission includes reads tagged with the sequence ATCACGTT.,qPCR only,,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina MiSeq,,ERP010224,Illumina MiSeq paired end sequencing,ENA FIRST PUBLIC:2015 04 21|ENA LAST UPDATE:2018 11 16,12025_1#1.cram,cram,591722600.0,2113295.0,SC RUN 12025 1#1,0:130 1:150,A:191185742;C:104479067;G:118593479;T:177428654;N:35658,130,150,,,191185742,104479067,118593479,177428654,35658,ERX943139,ERS709970,ERA432392,The Wellcome Trust Sanger Institute|European Nucleotide Archive,Wellcome Sanger Institute,2,0.59931,0.5446,0.18474,0.13393,0.85005,0.87856,0.67344,0.38597,130,150,B,B,biological fallback assumption,illumina,miseq,3prime,cdna_unspecified,unknown,bulk,unknown,unknown,,United Kingdom,2015-04-21,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
28690,SRR26535341,SRX22238472,SRS19292733,SRP468564,PRJNA1032461,A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo,GSE246295,Transcriptome Analysis,To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 alongside three control brains from injected siblings who did not develop tumors CTRL 1 3 were dissected for each condition for bulk RNA sequencing. We also performed fluorescent activated cell sorting on pooled dissociated brains from the EPS condition resulting in enrichment for mScarlet postive tumor cells CS Pos and mScarlet negative cells CS Neg for comparative analysis.,,pubmed:39052000,,Pooled EPS brains mScarlet ve Sorted Cells,GSM7866396,,source name:Sorted Cells|strain:CG1 p53null|tissue:Sorted Cells|geo loc name:missing|collection date:missing,Pooled EPS brains mScarlet ve Sorted Cells,Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions.,Sorted Cells,Fertilized embryos injected with either EPS or KPG construct mix,Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations,Zebrafish were housed and reared following approved animal use protocol,strain:CG1 p53null|tissue:Sorted Cells,GSM7866396,GSM7866396: Pooled EPS brains mScarlet ve Sorted Cells; Danio rerio; RNA Seq,GSM7866396 r1,GSM7866396,1,Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP468564,,loader:fastq load.py,CS_Neg.fastq.gz,fastq,6384313020.0,63211020.0,GSM7866396 r1,0:101,A:1646899028;C:1504048934;G:1428638008;T:1804712211;N:14839,101,,,,1646899028,1504048934,1428638008,1804712211,14839,SRX22238472,SRS19292733,SRA1740017,"Hayes Lab, DSCB, Sickkids Research","Hayes Lab, DSCB, Sickkids Research",1,0.94094,,0.14273,,0.67416,,0.48471,,101,,B,,usable mapping rate,illumina,novaseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,Canada,2023-10-26,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
28691,SRR26535342,SRX22238471,SRS19292732,SRP468564,PRJNA1032461,A syngeneic spontaneous zebrafish model oftp53 deficient EGFRviii and PI3KCAH1047R driven glioblastoma reveals inhibitory roles for inflammation during tumor initiation and relapsein vivo,GSE246295,Transcriptome Analysis,To build a patient relevantin vivomodel of human glioblastoma we expressed common oncogenic variants including activated human EGFRviii or KRAS and PI3KCAH1047Runder the control of the radial glial specific promoterher4.1in syngeneictp53loss of function mutant zebrafish.Robust tumor formation was observed prior to 45 days of life with a gene expression signature similar to human glioblastoma of the mesenchymal subtype along with a strong inflammatory component. Within early stage tumor lesions and in an intact and endogenous tumor microenvironment we visualized infiltration of phagocytic cells as well as internalization of tumor cells bympeg1.1:GFP+ microglia/macrophages suggesting negative regulatory pressure by pro inflammatory cell types on tumor growth at early stages of glioblastoma initiationin vivo. Furthermore CRISPR/Cas9 mediated gene targeting of master inflammatory transcription factorsirf7andirf8led to increased tumor formation in the primary context while suppression of microglial/macrophage activity led to enhanced tumor cell engraftment following transplantation into otherwise immune competent zebrafish hosts. Altogether we developed a genetically relevant model of aggressive human glioblastoma and harnessed the unique advantages of zebrafish including live imaging high throughput genetic and chemical manipulations to highlight important tumor suppressive roles for the innate immune system on glioblastoma initiation with important future significance for therapeutic discovery and optimizations. Overall design: To capture broad transcriptomic differences in tumor burdened brains versus normal brains we performed bulk RNA sequencing and gene expression analysis of whole brains and sorted cells. EGFRviii derived tumors were induced by microinjection of EGFRviii PI3KCAH1047R and mScarlet constructs defined as EPS. KRAS derived tumors were induced by microinjection of KRAS PI3KCAH1047R GFP constructs defined as KPG. Three whole brains positive for fluorescent tumors EPS 1 3 KPG 1 3 alongside three control brains from injected siblings who did not develop tumors CTRL 1 3 were dissected for each condition for bulk RNA sequencing. We also performed fluorescent activated cell sorting on pooled dissociated brains from the EPS condition resulting in enrichment for mScarlet postive tumor cells CS Pos and mScarlet negative cells CS Neg for comparative analysis.,,pubmed:39052000,,Pooled EPS brains mScarlet+ve Sorted Cells,GSM7866395,,source name:Sorted Cells|strain:CG1 p53null|tissue:Sorted Cells|geo loc name:missing|collection date:missing,Pooled EPS brains mScarlet+ve Sorted Cells,Raw .fastq data was processed using Salmon quantification of transcripts for each sample. A “decoy aware” index was built with the Danio rerio transcriptome and genome using the GRCz11 assembly with a k mers length of 23 with entries manually added for GFP mScarlet EGFRviii KRAS and PI3KCAH1047R transcripts. Samples were then quantified with the following arguments: r seqBias mp 3 validateMappings rangeFactorizationBins 4. Differential gene expression was compared utilizing DESeq2 and GSEA. Assembly: GRCz11 Supplementary files format and content: Tab delimited .csv file including raw counts for all conditions.,Sorted Cells,Fertilized embryos injected with either EPS or KPG construct mix,Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer’s recommendations,Zebrafish were housed and reared following approved animal use protocol,strain:CG1 p53null|tissue:Sorted Cells,GSM7866395,GSM7866395: Pooled EPS brains mScarlet+ve Sorted Cells; Danio rerio; RNA Seq,GSM7866395 r1,GSM7866395,1,Dissected brains or sorted cells were immediately put into Trizol. RNA was then extracted and purified utilizing Monarch RNA Cleanup Kit following manufacturer's recommendations Sequence ready polyA enriched libraries were prepared using the NEB Ultra II Directional mRNA prep kit for Illumina according to manufacturer's recommendations,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina NovaSeq 6000,,SRP468564,,loader:fastq load.py,CS_Pos.fastq.gz,fastq,6221936027.0,61603327.0,GSM7866395 r1,0:101,A:1586867899;C:1467436044;G:1398048259;T:1769569401;N:14424,101,,,,1586867899,1467436044,1398048259,1769569401,14424,SRX22238471,SRS19292732,SRA1740017,"Hayes Lab, DSCB, Sickkids Research","Hayes Lab, DSCB, Sickkids Research",1,0.88463,,0.14567,,0.69126,,0.48428,,101,,B,,usable mapping rate,illumina,novaseq_era,unknown,poly_a,unknown,bulk,bulk,bulk,,Canada,2023-10-26,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30115,SRR29493648,SRX25004180,SRS21704884,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,20ss 8,GSM8339626,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,20ss 8,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8339626,GSM8339626: 20ss 8; Danio rerio; RNA Seq,GSM8339626 r1,GSM8339626,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-016_1.fastq.gz,fastq,873781583.0,5786633.0,GSM8339626 r1,0:151,A:304485577;C:165950616;G:172432015;T:230907975;N:5400,151,,,,304485577,165950616,172432015,230907975,5400,SRX25004180,SRS21704884,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.69607,,0.06918,,0.8116,,0.5221,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30116,SRR29493649,SRX25004179,SRS21704886,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,20ss 7,GSM8339625,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,20ss 7,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8339625,GSM8339625: 20ss 7; Danio rerio; RNA Seq,GSM8339625 r1,GSM8339625,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-015_1.fastq.gz,fastq,1267562554.0,8394454.0,GSM8339625 r1,0:151,A:443947351;C:241828235;G:251111334;T:330668191;N:7443,151,,,,443947351,241828235,251111334,330668191,7443,SRX25004179,SRS21704886,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.69888,,0.06395,,0.80819,,0.54378,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30117,SRR29493650,SRX25004178,SRS21704885,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,20ss 6,GSM8339624,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,20ss 6,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8339624,GSM8339624: 20ss 6; Danio rerio; RNA Seq,GSM8339624 r1,GSM8339624,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-014_1.fastq.gz,fastq,1308765773.0,8667323.0,GSM8339624 r1,0:151,A:463621915;C:248487609;G:258441703;T:338206460;N:8086,151,,,,463621915,248487609,258441703,338206460,8086,SRX25004178,SRS21704885,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.68474,,0.05599,,0.80935,,0.53499,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30118,SRR29493651,SRX25004177,SRS21704882,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,20ss 5,GSM8339623,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,20ss 5,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8339623,GSM8339623: 20ss 5; Danio rerio; RNA Seq,GSM8339623 r1,GSM8339623,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-013_1.fastq.gz,fastq,1162568781.0,7699131.0,GSM8339623 r1,0:151,A:400374400;C:224477850;G:233635718;T:304073841;N:6972,151,,,,400374400,224477850,233635718,304073841,6972,SRX25004177,SRS21704882,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71228,,0.05604,,0.81292,,0.53526,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30119,SRR29493652,SRX25004176,SRS21704880,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,20ss 4,GSM8339622,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,20ss 4,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8339622,GSM8339622: 20ss 4; Danio rerio; RNA Seq,GSM8339622 r1,GSM8339622,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-012_1.fastq.gz,fastq,517602028.0,3427828.0,GSM8339622 r1,0:151,A:182978429;C:99031373;G:102229989;T:133359023;N:3214,151,,,,182978429,99031373,102229989,133359023,3214,SRX25004176,SRS21704880,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.68764,,0.06639,,0.82692,,0.53449,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30120,SRR29493653,SRX25004175,SRS21704877,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,20ss 3,GSM8339621,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,20ss 3,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8339621,GSM8339621: 20ss 3; Danio rerio; RNA Seq,GSM8339621 r1,GSM8339621,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-011_1.fastq.gz,fastq,301191848.0,1994648.0,GSM8339621 r1,0:151,A:106755903;C:57289515;G:59757902;T:77386571;N:1957,151,,,,106755903,57289515,59757902,77386571,1957,SRX25004175,SRS21704877,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.67695,,0.06443,,0.83491,,0.5365,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30121,SRR29493654,SRX25004174,SRS21704881,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,20ss 2,GSM8339620,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,20ss 2,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8339620,GSM8339620: 20ss 2; Danio rerio; RNA Seq,GSM8339620 r1,GSM8339620,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-010_1.fastq.gz,fastq,448021983.0,2967033.0,GSM8339620 r1,0:151,A:154862122;C:87128816;G:90406996;T:115621285;N:2764,151,,,,154862122,87128816,90406996,115621285,2764,SRX25004174,SRS21704881,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7036,,0.0603,,0.8327,,0.55569,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30122,SRR29493655,SRX25004173,SRS21704874,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,20ss 1,GSM8339619,,tissue:RNA from single embryo at mRNA|strain:RW|geo loc name:missing|collection date:missing,20ss 1,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RNA from single embryo at mRNA,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8339619,GSM8339619: 20ss 1; Danio rerio; RNA Seq,GSM8339619 r1,GSM8339619,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,DrRyu-009_1.fastq.gz,fastq,474612177.0,3143127.0,GSM8339619 r1,0:151,A:165855833;C:92383218;G:95962939;T:120407376;N:2811,151,,,,165855833,92383218,95962939,120407376,2811,SRX25004173,SRS21704874,SRA1904789,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.69299,,0.05915,,0.83246,,0.55097,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-06-20,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30130,SRR27710060,SRX23376560,SRS20238481,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,65 20ss 8,GSM8032998,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,65 20ss 8,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8032998,GSM8032998: 65 20ss 8; Danio rerio; RNA Seq,GSM8032998 r1,GSM8032998,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-065_R1.fastq.gz,fastq,315451684.0,2089084.0,GSM8032998 r1,0:151,A:107025597;C:61268322;G:63960453;T:83196458;N:854,151,,,,107025597,61268322,63960453,83196458,854,SRX23376560,SRS20238481,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7085,,0.04727,,0.80488,,0.51062,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30131,SRR27710061,SRX23376559,SRS20238482,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,40 15ss S4,GSM8032973,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,40 15ss S4,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:15ss,GSM8032973,GSM8032973: 40 15ss S4; Danio rerio; RNA Seq,GSM8032973 r1,GSM8032973,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-040_R1.fastq.gz,fastq,498553529.0,3301679.0,GSM8032973 r1,0:151,A:166809389;C:97016597;G:101866712;T:132859644;N:1187,151,,,,166809389,97016597,101866712,132859644,1187,SRX23376559,SRS20238482,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71715,,0.0483,,0.8003,,0.50987,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30132,SRR27710062,SRX23376558,SRS20238480,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,39 15ss S3,GSM8032972,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,39 15ss S3,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:15ss,GSM8032972,GSM8032972: 39 15ss S3; Danio rerio; RNA Seq,GSM8032972 r1,GSM8032972,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-039_R1.fastq.gz,fastq,390771239.0,2587889.0,GSM8032972 r1,0:151,A:132215529;C:75372095;G:78886679;T:104295997;N:939,151,,,,132215529,75372095,78886679,104295997,939,SRX23376558,SRS20238480,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71184,,0.05123,,0.80081,,0.50063,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30133,SRR27710063,SRX23376557,SRS20238479,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,38 15ss S2,GSM8032971,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,38 15ss S2,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:15ss,GSM8032971,GSM8032971: 38 15ss S2; Danio rerio; RNA Seq,GSM8032971 r1,GSM8032971,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5×,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-038_R1.fastq.gz,fastq,474938941.0,3145291.0,GSM8032971 r1,0:151,A:158127143;C:92840155;G:97530312;T:126440178;N:1153,151,,,,158127143,92840155,97530312,126440178,1153,SRX23376557,SRS20238479,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72239,,0.04594,,0.80332,,0.51087,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30134,SRR27710064,SRX23376556,SRS20238478,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,37 15ss S1,GSM8032970,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,37 15ss S1,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:15ss,GSM8032970,GSM8032970: 37 15ss S1; Danio rerio; RNA Seq,GSM8032970 r1,GSM8032970,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-037_R1.fastq.gz,fastq,337359972.0,2234172.0,GSM8032970 r1,0:151,A:113092761;C:65637958;G:68845967;T:89782587;N:699,151,,,,113092761,65637958,68845967,89782587,699,SRX23376556,SRS20238478,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71517,,0.04941,,0.80223,,0.50509,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30135,SRR27710065,SRX23376555,SRS20238475,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,36 10ss S8,GSM8032969,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,36 10ss S8,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:10ss,GSM8032969,GSM8032969: 36 10ss S8; Danio rerio; RNA Seq,GSM8032969 r1,GSM8032969,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-036_R1.fastq.gz,fastq,667384666.0,4419766.0,GSM8032969 r1,0:151,A:222892885;C:128753556;G:135360227;T:180376349;N:1649,151,,,,222892885,128753556,135360227,180376349,1649,SRX23376555,SRS20238475,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72097,,0.04947,,0.80482,,0.50176,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30136,SRR27710066,SRX23376554,SRS20238476,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,35 10ss S7,GSM8032968,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,35 10ss S7,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:10ss,GSM8032968,GSM8032968: 35 10ss S7; Danio rerio; RNA Seq,GSM8032968 r1,GSM8032968,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-035_R1.fastq.gz,fastq,343431078.0,2274378.0,GSM8032968 r1,0:151,A:115086242;C:66384157;G:70152965;T:91806893;N:821,151,,,,115086242,66384157,70152965,91806893,821,SRX23376554,SRS20238476,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72038,,0.04972,,0.80817,,0.51065,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30137,SRR27710067,SRX23376553,SRS20238477,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,34 10ss S6,GSM8032967,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,34 10ss S6,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:10ss,GSM8032967,GSM8032967: 34 10ss S6; Danio rerio; RNA Seq,GSM8032967 r1,GSM8032967,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-034_R1.fastq.gz,fastq,367343589.0,2432739.0,GSM8032967 r1,0:151,A:122986132;C:70561308;G:74047754;T:99747430;N:965,151,,,,122986132,70561308,74047754,99747430,965,SRX23376553,SRS20238477,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7141,,0.05134,,0.80624,,0.49975,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30138,SRR27710068,SRX23376552,SRS20238474,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,33 10ss S5,GSM8032966,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,33 10ss S5,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:10ss,GSM8032966,GSM8032966: 33 10ss S5; Danio rerio; RNA Seq,GSM8032966 r1,GSM8032966,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-033_R1.fastq.gz,fastq,500101581.0,3311931.0,GSM8032966 r1,0:151,A:166659447;C:96782939;G:102086513;T:134571440;N:1242,151,,,,166659447,96782939,102086513,134571440,1242,SRX23376552,SRS20238474,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72135,,0.04817,,0.80501,,0.51772,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30148,SRR27710078,SRX23376542,SRS20238464,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,24 6ss S4,GSM8032957,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,24 6ss S4,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032957,GSM8032957: 24 6ss S4; Danio rerio; RNA Seq,GSM8032957 r1,GSM8032957,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-024_R1.fastq.gz,fastq,311028441.0,2059791.0,GSM8032957 r1,0:151,A:104670505;C:60352595;G:62877196;T:83127441;N:704,151,,,,104670505,60352595,62877196,83127441,704,SRX23376542,SRS20238464,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71421,,0.05562,,0.81671,,0.52501,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30149,SRR27710079,SRX23376541,SRS20238462,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,23 6ss S3,GSM8032956,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,23 6ss S3,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032956,GSM8032956: 23 6ss S3; Danio rerio; RNA Seq,GSM8032956 r1,GSM8032956,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-023_R1.fastq.gz,fastq,900525193.0,5963743.0,GSM8032956 r1,0:151,A:302108212;C:171811037;G:180635986;T:245967863;N:2095,151,,,,302108212,171811037,180635986,245967863,2095,SRX23376541,SRS20238462,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72187,,0.05423,,0.80523,,0.509,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30150,SRR27710080,SRX23376540,SRS20238463,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,22 6ss S2,GSM8032955,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,22 6ss S2,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032955,GSM8032955: 22 6ss S2; Danio rerio; RNA Seq,GSM8032955 r1,GSM8032955,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-022_R1.fastq.gz,fastq,296192238.0,1961538.0,GSM8032955 r1,0:151,A:99348376;C:56752476;G:59956890;T:80133851;N:645,151,,,,99348376,56752476,59956890,80133851,645,SRX23376540,SRS20238463,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71708,,0.05521,,0.81329,,0.52671,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30151,SRR27710081,SRX23376539,SRS20238461,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,21 6ss S1,GSM8032954,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,21 6ss S1,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032954,GSM8032954: 21 6ss S1; Danio rerio; RNA Seq,GSM8032954 r1,GSM8032954,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-021_R1.fastq.gz,fastq,405205631.0,2683481.0,GSM8032954 r1,0:151,A:136134806;C:77430521;G:81422532;T:110216684;N:1088,151,,,,136134806,77430521,81422532,110216684,1088,SRX23376539,SRS20238461,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72045,,0.05386,,0.80783,,0.50795,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30171,SRR27710101,SRX23376519,SRS20238441,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,41 15ss S5,GSM8032974,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,41 15ss S5,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:15ss,GSM8032974,GSM8032974: 41 15ss S5; Danio rerio; RNA Seq,GSM8032974 r1,GSM8032974,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-041_R1.fastq.gz,fastq,649715401.0,4302751.0,GSM8032974 r1,0:151,A:216414707;C:127064944;G:132545819;T:173688314;N:1617,151,,,,216414707,127064944,132545819,173688314,1617,SRX23376519,SRS20238441,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7252,,0.04719,,0.79979,,0.50615,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30176,SRR27710106,SRX23376514,SRS20238436,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,12 15ss 4,GSM8032945,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,12 15ss 4,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:15ss,GSM8032945,GSM8032945: 12 15ss 4; Danio rerio; RNA Seq,GSM8032945 r1,GSM8032945,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-012_R1.fastq.gz,fastq,879932719.0,5827369.0,GSM8032945 r1,0:151,A:295722952;C:169204528;G:176727368;T:238275542;N:2329,151,,,,295722952,169204528,176727368,238275542,2329,SRX23376514,SRS20238436,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72281,,0.04966,,0.80081,,0.50989,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30177,SRR27710107,SRX23376513,SRS20238435,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,11 15ss 3,GSM8032944,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,11 15ss 3,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:15ss,GSM8032944,GSM8032944: 11 15ss 3; Danio rerio; RNA Seq,GSM8032944 r1,GSM8032944,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-011_R1.fastq.gz,fastq,453450886.0,3002986.0,GSM8032944 r1,0:151,A:151317456;C:87084620;G:91618535;T:123429147;N:1128,151,,,,151317456,87084620,91618535,123429147,1128,SRX23376513,SRS20238435,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72201,,0.05792,,0.80255,,0.5133,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30178,SRR27710108,SRX23376512,SRS20238434,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,10 15ss 2,GSM8032943,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,10 15ss 2,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:15ss,GSM8032943,GSM8032943: 10 15ss 2; Danio rerio; RNA Seq,GSM8032943 r1,GSM8032943,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-010_R1.fastq.gz,fastq,551480841.0,3652191.0,GSM8032943 r1,0:151,A:183791565;C:106604483;G:111620483;T:149462978;N:1332,151,,,,183791565,106604483,111620483,149462978,1332,SRX23376512,SRS20238434,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72399,,0.05154,,0.80695,,0.52026,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30179,SRR27710109,SRX23376511,SRS20238433,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,9 15ss 1,GSM8032942,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,9 15ss 1,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:15ss,GSM8032942,GSM8032942: 9 15ss 1; Danio rerio; RNA Seq,GSM8032942 r1,GSM8032942,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-009_R1.fastq.gz,fastq,497394906.0,3294006.0,GSM8032942 r1,0:151,A:167109996;C:95711974;G:100225234;T:134346439;N:1263,151,,,,167109996,95711974,100225234,134346439,1263,SRX23376511,SRS20238433,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71991,,0.05182,,0.80521,,0.52364,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30180,SRR27710110,SRX23376510,SRS20238432,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,64 20ss 7,GSM8032997,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,64 20ss 7,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8032997,GSM8032997: 64 20ss 7; Danio rerio; RNA Seq,GSM8032997 r1,GSM8032997,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-064_R1.fastq.gz,fastq,350772094.0,2322994.0,GSM8032997 r1,0:151,A:118203787;C:68346677;G:71132328;T:93088400;N:902,151,,,,118203787,68346677,71132328,93088400,902,SRX23376510,SRS20238432,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71487,,0.04522,,0.80271,,0.50943,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30181,SRR27710111,SRX23376509,SRS20238431,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,63 20ss 6,GSM8032996,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,63 20ss 6,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8032996,GSM8032996: 63 20ss 6; Danio rerio; RNA Seq,GSM8032996 r1,GSM8032996,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-063_R1.fastq.gz,fastq,437789921.0,2899271.0,GSM8032996 r1,0:151,A:146190276;C:85351980;G:89392608;T:116853971;N:1086,151,,,,146190276,85351980,89392608,116853971,1086,SRX23376509,SRS20238431,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72305,,0.04991,,0.80004,,0.50619,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30182,SRR27710112,SRX23376508,SRS20238430,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,62 20ss 5,GSM8032995,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,62 20ss 5,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8032995,GSM8032995: 62 20ss 5; Danio rerio; RNA Seq,GSM8032995 r1,GSM8032995,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-062_R1.fastq.gz,fastq,502558049.0,3328199.0,GSM8032995 r1,0:151,A:167647133;C:98376006;G:103165276;T:133368326;N:1308,151,,,,167647133,98376006,103165276,133368326,1308,SRX23376508,SRS20238430,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72672,,0.04873,,0.80095,,0.513,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30183,SRR27710113,SRX23376507,SRS20238429,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,61 20ss 4,GSM8032994,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,61 20ss 4,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8032994,GSM8032994: 61 20ss 4; Danio rerio; RNA Seq,GSM8032994 r1,GSM8032994,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-061_R1.fastq.gz,fastq,366103728.0,2424528.0,GSM8032994 r1,0:151,A:124292130;C:71142743;G:74133274;T:96534644;N:937,151,,,,124292130,71142743,74133274,96534644,937,SRX23376507,SRS20238429,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7103,,0.04427,,0.80367,,0.50994,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30184,SRR27710114,SRX23376506,SRS20238428,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,60 20ss 3,GSM8032993,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,60 20ss 3,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8032993,GSM8032993: 60 20ss 3; Danio rerio; RNA Seq,GSM8032993 r1,GSM8032993,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-060_R1.fastq.gz,fastq,519806326.0,3442426.0,GSM8032993 r1,0:151,A:173658961;C:101699167;G:106103956;T:138343024;N:1218,151,,,,173658961,101699167,106103956,138343024,1218,SRX23376506,SRS20238428,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7227,,0.04793,,0.80168,,0.51023,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30185,SRR27710115,SRX23376505,SRS20238427,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,59 20ss 2,GSM8032992,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,59 20ss 2,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8032992,GSM8032992: 59 20ss 2; Danio rerio; RNA Seq,GSM8032992 r1,GSM8032992,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-059_R1.fastq.gz,fastq,393704414.0,2607314.0,GSM8032992 r1,0:151,A:133373380;C:76448436;G:80014902;T:103866747;N:949,151,,,,133373380,76448436,80014902,103866747,949,SRX23376505,SRS20238427,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71277,,0.04824,,0.80308,,0.5146,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30186,SRR27710116,SRX23376504,SRS20238426,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,58 20ss 1,GSM8032991,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,58 20ss 1,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:20ss,GSM8032991,GSM8032991: 58 20ss 1; Danio rerio; RNA Seq,GSM8032991 r1,GSM8032991,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-058_R1.fastq.gz,fastq,371849278.0,2462578.0,GSM8032991 r1,0:151,A:125795809;C:72793712;G:75742213;T:97516456;N:1088,151,,,,125795809,72793712,75742213,97516456,1088,SRX23376504,SRS20238426,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7164,,0.04484,,0.80681,,0.51466,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30188,SRR27710118,SRX23376502,SRS20238424,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,32 10ss S4,GSM8032965,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,32 10ss S4,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:10ss,GSM8032965,GSM8032965: 32 10ss S4; Danio rerio; RNA Seq,GSM8032965 r1,GSM8032965,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-032_R1.fastq.gz,fastq,359160144.0,2378544.0,GSM8032965 r1,0:151,A:121695927;C:68878856;G:72208959;T:96375451;N:951,151,,,,121695927,68878856,72208959,96375451,951,SRX23376502,SRS20238424,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7106,,0.05003,,0.80582,,0.50783,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30189,SRR27710119,SRX23376501,SRS20238423,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,31 10ss S3,GSM8032964,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,31 10ss S3,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:10ss,GSM8032964,GSM8032964: 31 10ss S3; Danio rerio; RNA Seq,GSM8032964 r1,GSM8032964,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-031_R1.fastq.gz,fastq,484559604.0,3209004.0,GSM8032964 r1,0:151,A:162437596;C:93209283;G:98058841;T:130852705;N:1179,151,,,,162437596,93209283,98058841,130852705,1179,SRX23376501,SRS20238423,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71911,,0.04811,,0.80511,,0.50613,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30190,SRR27710120,SRX23376500,SRS20238422,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,30 10ss S2,GSM8032963,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,30 10ss S2,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:10ss,GSM8032963,GSM8032963: 30 10ss S2; Danio rerio; RNA Seq,GSM8032963 r1,GSM8032963,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-030_R1.fastq.gz,fastq,326953052.0,2165252.0,GSM8032963 r1,0:151,A:109677089;C:62822068;G:66297601;T:88155491;N:803,151,,,,109677089,62822068,66297601,88155491,803,SRX23376500,SRS20238422,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7175,,0.05175,,0.8059,,0.51155,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30191,SRR27710121,SRX23376499,SRS20238421,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,29 10ss S1,GSM8032962,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,29 10ss S1,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:10ss,GSM8032962,GSM8032962: 29 10ss S1; Danio rerio; RNA Seq,GSM8032962 r1,GSM8032962,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-029_R1.fastq.gz,fastq,413637471.0,2739321.0,GSM8032962 r1,0:151,A:138530860;C:79675749;G:84088966;T:111340930;N:966,151,,,,138530860,79675749,84088966,111340930,966,SRX23376499,SRS20238421,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71717,,0.0495,,0.80659,,0.51539,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30192,SRR27710122,SRX23376498,SRS20238420,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,28 6ss S8,GSM8032961,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,28 6ss S8,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032961,GSM8032961: 28 6ss S8; Danio rerio; RNA Seq,GSM8032961 r1,GSM8032961,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-028_R1.fastq.gz,fastq,312104769.0,2066919.0,GSM8032961 r1,0:151,A:104811820;C:59763722;G:63032942;T:84495610;N:675,151,,,,104811820,59763722,63032942,84495610,675,SRX23376498,SRS20238420,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71142,,0.05609,,0.81481,,0.52449,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30193,SRR27710123,SRX23376497,SRS20238419,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,27 6ss S7,GSM8032960,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,27 6ss S7,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032960,GSM8032960: 27 6ss S7; Danio rerio; RNA Seq,GSM8032960 r1,GSM8032960,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-027_R1.fastq.gz,fastq,406291623.0,2690673.0,GSM8032960 r1,0:151,A:135404744;C:78279561;G:82142129;T:110464173;N:1016,151,,,,135404744,78279561,82142129,110464173,1016,SRX23376497,SRS20238419,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7226,,0.05837,,0.81126,,0.52229,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30194,SRR27710124,SRX23376496,SRS20238418,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,26 6ss S6,GSM8032959,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,26 6ss S6,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032959,GSM8032959: 26 6ss S6; Danio rerio; RNA Seq,GSM8032959 r1,GSM8032959,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-026_R1.fastq.gz,fastq,731946528.0,4847328.0,GSM8032959 r1,0:151,A:245812695;C:140238291;G:147006461;T:198887459;N:1622,151,,,,245812695,140238291,147006461,198887459,1622,SRX23376496,SRS20238418,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71794,,0.05461,,0.80819,,0.51908,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30195,SRR27710125,SRX23376495,SRS20238417,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,25 6ss S5,GSM8032958,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,25 6ss S5,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032958,GSM8032958: 25 6ss S5; Danio rerio; RNA Seq,GSM8032958 r1,GSM8032958,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-025_R1.fastq.gz,fastq,745928071.0,4939921.0,GSM8032958 r1,0:151,A:250680771;C:142881010;G:149860265;T:202504044;N:1981,151,,,,250680771,142881010,149860265,202504044,1981,SRX23376495,SRS20238417,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71868,,0.05743,,0.80967,,0.50573,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30196,SRR27710126,SRX23376494,SRS20238416,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,8 6ss 8,GSM8032941,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,8 6ss 8,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032941,GSM8032941: 8 6ss 8; Danio rerio; RNA Seq,GSM8032941 r1,GSM8032941,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-008_R1.fastq.gz,fastq,392774556.0,2601156.0,GSM8032941 r1,0:151,A:132863929;C:74787244;G:78470819;T:106651643;N:921,151,,,,132863929,74787244,78470819,106651643,921,SRX23376494,SRS20238416,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71576,,0.05161,,0.81393,,0.52756,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30197,SRR27710127,SRX23376493,SRS20238415,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,7 6ss 7,GSM8032940,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,7 6ss 7,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032940,GSM8032940: 7 6ss 7; Danio rerio; RNA Seq,GSM8032940 r1,GSM8032940,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-007_R1.fastq.gz,fastq,333216230.0,2206730.0,GSM8032940 r1,0:151,A:111551893;C:63560817;G:66541800;T:91560950;N:770,151,,,,111551893,63560817,66541800,91560950,770,SRX23376493,SRS20238415,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7193,,0.0601,,0.81268,,0.52207,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30198,SRR27710128,SRX23376492,SRS20238414,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,6 6ss 6,GSM8032939,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,6 6ss 6,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032939,GSM8032939: 6 6ss 6; Danio rerio; RNA Seq,GSM8032939 r1,GSM8032939,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-006_R1.fastq.gz,fastq,392108495.0,2596745.0,GSM8032939 r1,0:151,A:130191991;C:75278820;G:79178866;T:107457991;N:827,151,,,,130191991,75278820,79178866,107457991,827,SRX23376492,SRS20238414,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72703,,0.05576,,0.81195,,0.51811,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30199,SRR27710129,SRX23376491,SRS20238413,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,5 6ss 5,GSM8032938,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,5 6ss 5,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032938,GSM8032938: 5 6ss 5; Danio rerio; RNA Seq,GSM8032938 r1,GSM8032938,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-005_R1.fastq.gz,fastq,410697350.0,2719850.0,GSM8032938 r1,0:151,A:137174407;C:78514592;G:82425334;T:112581962;N:1055,151,,,,137174407,78514592,82425334,112581962,1055,SRX23376491,SRS20238413,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72668,,0.04983,,0.81389,,0.51594,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30200,SRR27710130,SRX23376490,SRS20238412,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,4 6ss 4,GSM8032937,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,4 6ss 4,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032937,GSM8032937: 4 6ss 4; Danio rerio; RNA Seq,GSM8032937 r1,GSM8032937,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-004_R1.fastq.gz,fastq,422651567.0,2799017.0,GSM8032937 r1,0:151,A:141786425;C:80388438;G:85080241;T:115395302;N:1161,151,,,,141786425,80388438,85080241,115395302,1161,SRX23376490,SRS20238412,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72186,,0.05657,,0.81148,,0.52572,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30201,SRR27710131,SRX23376489,SRS20238411,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,3 6ss 3,GSM8032936,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,3 6ss 3,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032936,GSM8032936: 3 6ss 3; Danio rerio; RNA Seq,GSM8032936 r1,GSM8032936,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-003_R1.fastq.gz,fastq,358201898.0,2372198.0,GSM8032936 r1,0:151,A:121199812;C:68388325;G:71426496;T:97186269;N:996,151,,,,121199812,68388325,71426496,97186269,996,SRX23376489,SRS20238411,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.71083,,0.05172,,0.81414,,0.52509,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30202,SRR27710132,SRX23376488,SRS20238410,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,2 6ss 2,GSM8032935,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,2 6ss 2,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032935,GSM8032935: 2 6ss 2; Danio rerio; RNA Seq,GSM8032935 r1,GSM8032935,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-002_R1.fastq.gz,fastq,392878746.0,2601846.0,GSM8032935 r1,0:151,A:131932969;C:74531672;G:78651691;T:107761556;N:858,151,,,,131932969,74531672,78651691,107761556,858,SRX23376488,SRS20238410,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.7184,,0.05833,,0.81186,,0.52246,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
30203,SRR27710133,SRX23376487,SRS20238409,SRP485624,PRJNA1068513,Time course indivudal RNA Seq of zebrafish early development,GSE254071,Transcriptome Analysis,Time course indivudal RNA Seq of zebrafish early development from 6 somites stage to 96 hpf Overall design: Zebrafish larvas were sacrificed at 6ss 10ss 15ss 20ss 24 hpf 32 hpf 48hpf 72 hpf 96 hpf with 8 16 biological replicates.,,pubmed:39320016,,1 6ss 1,GSM8032934,,tissue:RW|strain:RW|geo loc name:missing|collection date:missing,1 6ss 1,Read 1 reads were processed with fastp version 0.21.0 S. Chen et al. 2018 using the following command: “ fastp trim poly x w 20 adapter sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA adapter sequence r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT l 31”. The trimmed reads were then mapped to a D. japonica transcriptome reference An et al. 2018 using BWA mem version 0.7.17 r1188 W. Chen et al. 2013 with the default parameters. The read count for each gene was calculated with salmon using l IU which specifies the library type version v0.12.0 Patro et al. 2017. Assembly: Danio rerio.GRCz11.cdna.all.fa Supplementary files format and content: csv delimited text file includes rawcnt values for each Sample,RW,,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer’s protocol. 3’ mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer’s instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,The zebrafish Danio rerio strains RIKEN WT RW was maintained under a 14 h light/10 h dark cycle. The water temperature was kept at 28°C ± 1°C and water quality conditions were maintained according to The Zebrafish Book University of Oregon Press and the Guide for the Care and Use of Laboratory Animals 8th edition National Research Council 2011.,strain:RW|developmental.stage:6ss,GSM8032934,GSM8032934: 1 6ss 1; Danio rerio; RNA Seq,GSM8032934 r1,GSM8032934,1,Each stage of RW zebrafish embryos was dissected and the total RNA was extracted using the RNeasy kit Qiagen according to the manufacturer's protocol. three prime mRNA Seq were conducted according to the Lasy Seq ver. 1.1 protocol https://sites.google.com/view/lasy seq/ Kamitani et al. 2019; Kashima et al. 2021. Briefly total RNA was reverse transcribed using an RT primer with index and SuperScript IV reverse transcriptase Thermo Fisher Scientific Waltham MA USA. Then all RT mixtures of the samples were pooled and purified using an equal volume of AMpure XP beads Beckman Coulter Brea CA USA according to the manufacturer's instructions. Second strand synthesis was conducted on the pooled samples using RnaseH 5 U/μL Enzymatics Beverly MA USA and DNA polymerase I 10 U/μL Enzymatics Beverly MA USA. To avoid the carryover of large amounts of rRNAs the mixture was subjected to Rnase treatment using Rnase T1 Thermo Fisher Scientific Waltham MA USA. Then purification was conducted with a 0.8× volume of Ampure XP beads. Fragmentation end repair and A tailing were conducted using 5× WGS Fragmentation Mix Enzymatics Beverly MA USA. The Adapter for Lasy Seq was ligated using 5× Ligation Mix Enzymatics Beverly MA USA and the adapter ligated DNA was purified twice with a 0.8× volume of Ampure XP beads. post optimisation of PCR cycles for library amplification by qPCR using Evagreen 20× in water Biotium Fremont CA USA and the QuantStudio5 Real Time PCR System Applied Biosystems Waltham MA USA the library was amplified using KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS Wilmington MA USA on the ProFlex PCR System Applied Biosystems Waltham MA USA. The amplified library was purified with an equal volume of Ampure XP beads. One microliter of the library was then used for electrophoresis using a Bioanalyzer 2100 with the Agilent High Sensitivity DNA kit Agilent Technologies Santa Clara CA USA to check for quality. Then sequencing of 150 bp paired end reads was performed using HiSeq X Ten Illumina San Diego CA USA by Macrogen Inc. Seoul Korea.,,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,HiSeq X Ten,,SRP485624,,,Tasaki1-001_R1.fastq.gz,fastq,399940563.0,2648613.0,GSM8032934 r1,0:151,A:134296994;C:76342891;G:80537022;T:108762689;N:967,151,,,,134296994,76342891,80537022,108762689,967,SRX23376487,SRS20238409,SRA1791114,Aoyama Gakuinn University,Aoyama Gakuinn University,1,0.72009,,0.0546,,0.81485,,0.53318,,151,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,Japan,2024-01-24,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
36265,SRR058073,SRX022206,SRS084221,SRP002640,PRJNA128943,Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing,GSE22068,Other,We present “centered sites ” a class of microRNA target sites that lacks both perfect seed pairing and three prime compensatory pairing and instead has 11–12 contiguous Watson–Crick pairs to the center of the microRNA. In elevated Mg2+ centered sites impart mRNA cleavage but in cells centered sites repress protein output without xxx Agronaute catalyzed cleavage. Our study also identified novel extensively paired sites that are cleavage substrates in cultured cells and human brain. This expanded repertoire of cleavage targets and the identification of the centered site type help explain why central regions of many microRNAs are evolutionarily conserved. Overall design: To study centered sites and identify miRNA cleavage targets mRNA degradomes were sequenced from human brain and HeLa cells and smallRNAs were sequenced from human brain and zebrafish embryo at 24 hpf. Replicates were combined before the analysis. Fastq files are not available for GSM548638 and GSM548639.,,pubmed:20620952,,Zebrafish Embryo small RNAs,GSM548640,,source name:Embryo Cells|data type:small RNAs|tissue:embryo,Zebrafish Embryo small RNAs,Small RNA sequences from same total RNA samples were mapped to the human genome hg18 requiring a perfect match and reads co localizing to annotated miRNA loci miRBase version 11.0 were counted. sequence reads are summarized as frequency counts,Embryo Cells,,The small RNA cDNA libraries were made as described Grimson et al. 2008 except for the three prime adaptor ligation which was five prime adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol see http://web.wi.mit.edu/bartel/pub/protocols.html.,,data type:small RNAs|tissue:embryo,GSM548640,GSM548640: Zebrafish Embryo small RNAs,GSM548640: Zebrafish Embryo small RNAs,GSM548640: Zebrafish Embryo small RNAs,1,,GEO Accession:GSM548640,RNA-Seq,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,Illumina Genome Analyzer,0Application ReadForward1,SRP002640,,quality book char:@|quality scoring system:log odds,Zebrafish_embryo_24h.fastq,fastq,62213148.0,1728143.0,GSM548640 1,0:36,A:13550515;C:14269249;G:15670049;T:18673533;N:49802,36,,,,13550515,14269249,15670049,18673533,49802,SRX022206,SRS084221,SRA020539,GEO,"Bartel lab, Whitehead Institute",1,0.02298,,0.02186,,0.9988,,0.3246,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2010-06-01,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
36405,SRR546820,SRX180750,SRS347212,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain embryo prim6 stage,D. rerio prim6 embryo,D. rerio prim6 embryo,,,,,,,,,,,RNAseq D. rerio prim6 embryo,RNAseq D. rerio prim6 embryo,1,1,,,RNA-Seq,TRANSCRIPTOMIC,unspecified,PAIRED,ILLUMINA,Illumina Genome Analyzer IIx,1520Application ReadForward11Application ReadReverse77,SRP013950,,,RNAseq_prim6_2_fix.fastq,fastq,3011340704.0,19811452.0,RNAseq D. rerio prim6 embryo,0:76 1:76,A:727345664;C:767747833;G:787766862;T:725606403;N:2873942,76,76,,,727345664,767747833,787766862,725606403,2873942,SRX180750,SRS347212,SRA055273,University of Bergen,ZEPROME consortium,2,0.94491,0.94492,0.04196,0.04323,0.76641,0.76928,0.48087,0.48787,76,76,B,B,biological fallback assumption,illumina,early_illumina,unknown,unknown,unknown,bulk,unknown,unknown,,Unknown,2015-07-22,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
36409,SRR516560,SRX156356,SRS347213,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain embryo prim20 stage,D. rerio prim20 embryo,D. rerio prim20 embryo,,,,,,,,,,,CAGE D. rerio prim20 embryo,CAGE D. rerio prim20 embryo run2,D. rerio prim20 embryo,1,,,OTHER,TRANSCRIPTOMIC,CAGE,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,270Application ReadForward1,SRP013950,,,CAGE_prim20_run1.fastq,fastq,76770666.0,2843358.0,CAGE D. rerio prim20 embryo run1,0:27,A:19320047;C:17585086;G:22511175;T:17354358;N:0,27,,,,19320047,17585086,22511175,17354358,0,SRX156356,SRS347213,SRA055273,University of Bergen,ZEPROME consortium,1,0.56472,,0.10044,,0.77469,,0.74192,,27,,B,,usable mapping rate,illumina,early_illumina,unknown,cage,unknown,bulk,unknown,unknown,,Unknown,2012-06-28,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
36410,SRR516561,SRX156356,SRS347213,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain embryo prim20 stage,D. rerio prim20 embryo,D. rerio prim20 embryo,,,,,,,,,,,CAGE D. rerio prim20 embryo,CAGE D. rerio prim20 embryo run2,D. rerio prim20 embryo,1,,,OTHER,TRANSCRIPTOMIC,CAGE,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,270Application ReadForward1,SRP013950,,,CAGE_prim20_run2.fastq,fastq,163254906.0,6046478.0,CAGE D. rerio prim20 embryo run2,0:27,A:40211042;C:36959797;G:46866669;T:39217398;N:0,27,,,,40211042,36959797,46866669,39217398,0,SRX156356,SRS347213,SRA055273,University of Bergen,ZEPROME consortium,1,0.47475,,0.06947,,0.78409,,0.78014,,27,,B,,usable mapping rate,illumina,early_illumina,unknown,cage,unknown,bulk,unknown,unknown,,Unknown,2013-08-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
36411,SRR516559,SRX156355,SRS347212,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain embryo prim6 stage,D. rerio prim6 embryo,D. rerio prim6 embryo,,,,,,,,,,,CAGE D. rerio prim6 embryo,CAGE D. rerio prim6 embryo,D. rerio prim6 embryo,1,,,OTHER,TRANSCRIPTOMIC,CAGE,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,270Application ReadForward1,SRP013950,,,CAGE_prim6.fastq,fastq,283414275.0,10496825.0,CAGE D. rerio prim6 embryo,0:27,A:70974303;C:66202040;G:80064124;T:66173808;N:0,27,,,,70974303,66202040,80064124,66173808,0,SRX156355,SRS347212,SRA055273,University of Bergen,ZEPROME consortium,1,0.53395,,0.07806,,0.78255,,0.77575,,27,,B,,usable mapping rate,illumina,early_illumina,unknown,cage,unknown,bulk,unknown,unknown,,Unknown,2013-08-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
36420,SRR516550,SRX156337,SRS347206,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain embryo high stage,D. rerio high embryo,D. rerio high embryo,,,,,,,,,,,CAGE D. rerio high embryo,CAGE D. rerio high embryo,D. rerio high embryo,1,,,OTHER,TRANSCRIPTOMIC,CAGE,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,270Application ReadForward1,SRP013950,,,CAGE_high.fastq,fastq,128592846.0,4762698.0,CAGE D. rerio high embryo,0:27,A:33693838;C:27629256;G:36692263;T:30577489;N:0,27,,,,33693838,27629256,36692263,30577489,0,SRX156337,SRS347206,SRA055273,University of Bergen,ZEPROME consortium,1,0.53282,,0.08323,,0.80854,,0.77395,,27,,B,,usable mapping rate,illumina,early_illumina,unknown,cage,unknown,bulk,unknown,unknown,,Unknown,2013-08-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
36581,SRR594769,SRX195432,SRS369361,SRP016134,PRJNA177654,Danio rerio Transcriptome or Gene expression,PRJNA177654,Other,We use zebrafish embryos to characterise the transcriptome of the developing blood and endothelium.,,,1,Test,GFP Negative 1,,,,,,,,,,,Global analysis of the haematopoietic and endothelial transcriptome during zebrafish development,Embryos,1,1,,,RNA-Seq,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,400Application ReadForward1,SRP016134,,,,,2525199228.0,65962848.0,GFP Positive,0:38.28,A:665802914;C:594493287;G:612298433;T:652078696;N:525898,38,,,,665802914,594493287,612298433,652078696,525898,SRX195432,SRS369361,,,University of Cambridge,1,0.89062,,0.09595,,0.74059,,0.47506,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,unknown,unknown,bulk,unknown,unknown,,United Kingdom,2015-07-22,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
36582,SRR594771,SRX195432,SRS369361,SRP016134,PRJNA177654,Danio rerio Transcriptome or Gene expression,PRJNA177654,Other,We use zebrafish embryos to characterise the transcriptome of the developing blood and endothelium.,,,1,Test,GFP Negative 1,,,,,,,,,,,Global analysis of the haematopoietic and endothelial transcriptome during zebrafish development,Embryos,1,1,,,RNA-Seq,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,400Application ReadForward1,SRP016134,,,gfp_negative_replicate_1_sequence.txt.gz,fastq,2549682148.0,66546682.0,GFP Negative,0:38.31,A:686329592;C:587342682;G:601330559;T:674194074;N:485241,38,,,,686329592,587342682,601330559,674194074,485241,SRX195432,SRS369361,,,University of Cambridge,1,0.90413,,0.13272,,0.71342,,0.48186,,36,,B,,usable mapping rate,illumina,early_illumina,unknown,unknown,unknown,bulk,unknown,unknown,,United Kingdom,2015-07-22,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
37129,SRR953087,SRX335692,SRS470740,SRP028862,PRJNA215266,Danio rerio Transcriptome or Gene expression,PRJNA215266,Other,During early vertebrate development various small non coding RNAs sRNAs such as MicroRNAs miRNAs and Piwi interacting RNAs piRNAs are dynamically expressed for orchestrating the maternal to zygotic transition MZT. Systematic analysis of expression profiles of zebrafish small RNAome will be greatly helpful for understanding the sRNA regulation during embryonic development.,,,small RNA sequencing for zebrafish early development,General Sample for zebrafish,zebrafish early development,,breed:wild type zebrafish,,,,,,,,,1 cell of zebrafish development,1 cell stage,1,Total RNA from embryos was isolated using Trizol reagent Invitrogen. RNAs were fractioned on 15% denaturing polyacrylamide gels and small RNAs were isolated and purified. Subsequently small RNAs were ligated with both a 5’ adapter and 3’ adapter for reverse transcription using SuperscriptTM II reverse transcription kit Invitrogen following the manufacturer's instructions at 42 oC for 1 h and 70 oC for 15 min. post that the reverse transcribed product cDNA was amplified by the following PCR program: a 15 cycle reaction at 98 oC for 30 sec followed by 15 cycles consisting of 10 sec at 98 oC 15 sec at 72 oC and then 10 min at 72 oC. post obtaining a 92bp DNA band on 6% denaturing PAGE gels the PCR products were enriched by ethanol precipitation and purified using Spin X filter columns Fisher.,,,RNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,490Application ReadForward1,SRP028862,,,,,1002077048.0,20450552.0,1 cell stage,0:49,A:210178307;C:226566574;G:255003953;T:310259058;N:69156,49,,,,210178307,226566574,255003953,310259058,69156,SRX335692,SRS470740,SRA098041,Huazhong University of Science and Technology|cuckoo,Huazhong University of Science and Technology,1,0.0001,,3e-05,,0.99975,,0.76923,,49,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,unknown,bulk,unknown,unknown,,China,2015-07-22,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
38020,SRR1265736,SRX529131,SRS598827,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Embryo Replicate 3 sRNAseq,GSM1376619,,source name:Embryo|tissue:Embryo|genetic background:Wild type Singapore strain,Embryo Replicate 3 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Embryo,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,tissue:Embryo|genetic background:Wild type Singapore strain,GSM1376619,GSM1376619: Embryo Replicate 3 sRNAseq; Danio rerio; miRNA Seq,GSM1376619,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376619,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZE006_CTTGTA_L008_R1.fastq.gz,fastq,1714180635.0,33611385.0,GSM1376619 r1,0:51,A:338559677;C:431494863;G:537012008;T:406904091;N:209996,51,,,,338559677,431494863,537012008,406904091,209996,SRX529131,SRS598827,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.09044,,0.01776,,0.97782,,0.77023,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
38021,SRR1265735,SRX529130,SRS598828,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Embryo Replicate 2 sRNAseq,GSM1376618,,source name:Embryo|tissue:Embryo|genetic background:Wild type Singapore strain,Embryo Replicate 2 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Embryo,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,tissue:Embryo|genetic background:Wild type Singapore strain,GSM1376618,GSM1376618: Embryo Replicate 2 sRNAseq; Danio rerio; miRNA Seq,GSM1376618,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376618,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZE005_GGCTAC_L008_R1.fastq.gz,fastq,736486002.0,14440902.0,GSM1376618 r1,0:51,A:145757737;C:194417932;G:231157927;T:165060763;N:91643,51,,,,145757737,194417932,231157927,165060763,91643,SRX529130,SRS598828,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.01133,,0.00234,,0.99515,,0.73854,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
38022,SRR1265734,SRX529129,SRS598825,SRP041544,PRJNA245824,Deep sequencing of small RNA facilitates tissue and sex associated microRNA discovery in zebrafish,GSE57169,Transcriptome Analysis,The role of microRNAs in gene regulation has been well established. The extent of miRNA regulation also increases with increasing genome complexity. Though the number of genes appear to be equal between human and zebrafish substantially less microRNAs have been discovered in zebrafish compared to human Release 19. It appears that most of the miRNAs in zebrafish are yet to be discovered. We sequenced small RNAs from brain gut liver ovary testis eye heart and embryo of zebrafish. In brain gut and liver sequencing was done in male and female separately. Majority of the sequenced reads 16 62% mapped to known miRNAs with the exception of ovary 5.7% and testis 7.8%. Using the miRNA discovery tool miRDeep2 we discovered novel miRNAs from the un annotated reads that ranged from 7.6 to 23.0% with exceptions of ovary 51.4% and testis 55.2%. The prediction tool identified a total of 459 novel pre miRNAs. We compared expression of miRNAs between different tissues and between males and females to identify tissue associated and sex associated miRNAs respectively. These miRNAs could serve as putative biomarkers for these tissues. The brain and liver had highest number of tissue associated 22 and sex associated 34 miRNAs respectively. This study comprehensively identifies tissue and sex associated miRNAs in zebrafish. Further we have discovered 459 novel pre miRNAs 30% seed homology to human miRNA as a genomic resource which can facilitate further investigations to understand miRNA mRNA gene regulatory networks in zebrafish which will have implications in understanding the function of human homologs. Overall design: Known miRNA profiling novel miRNA discovery and identification of tissue associated and sex associated miRNAs from sRNA deep sequencing data of different tissues and embryo of zebrafish in triplicate was carried out using the Illumina HiSeq 2000 platform.,,pubmed:26574018,,Embryo Replicate 1 sRNAseq,GSM1376617,,source name:Embryo|tissue:Embryo|genetic background:Wild type Singapore strain,Embryo Replicate 1 sRNAseq,Illumina Casava 1.8.2 software used for basecalling. The sequenced reads were first subjected to adapter removal through the cutadapt program Martin 2011. The trimmed reads were then collapsed to remove redundancy and to obtain a unique sequence fasta file through the mapper module of miRDeep2 package Friedländer et al. 2012. The unique reads fasta file was then put through an elimination pipeline module Vaz et al. 2010 comprising of a series of sequence similarity searches with the annotated databases. At each step the reads were matched to an annotated database with a maximum of two mismatches. The matched reads were removed and the unmatched ones were further matched to another annotated database finally culminating into an un annotated pool of reads that served as a source of novel miRNAs and novel sRNAs. The known miRNA expression profile was generated by using the quantifier module of the miRDeep2 package that gives the read counts for the known miRNAs. The quantifier.pl command line used: perl quantifier.pl p m r t Zebrafish The raw reads expression profile generated for all the replicates of the samples were subjected to Trimmed Mean of M values TMM normalisation using the Bioconductor package edgeR Robinson et al. 2010. Genome build: ZV9 Supplementary files format and content: 1. 'Danio rerio known miRNA Rel19 profile Raw.txt': Tab delimited text file that includes the raw counts for the known mature miRNA miRBase Release 19. Supplementary files format and content: 2. 'Danio rerio known miRNA Rel19 profile Normalised.txt': Tab delimited text file that includes the Trimmed Mean of M values TMM normalised counts for the known mature miRNA miRBase Release 19. One of the replicate of Heart MZH008 failed to cluster with the other two replicates on basis of its known miRNA expression profile and hence was not used for further analysis.,Embryo,N/A,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,Fishes were purchased from a local supplier and acclimatized before tissue extraction.,tissue:Embryo|genetic background:Wild type Singapore strain,GSM1376617,GSM1376617: Embryo Replicate 1 sRNAseq; Danio rerio; miRNA Seq,GSM1376617,,1,Total RNA were extracted using mirVana™ miRNA Isolation Kit AM1560 Life Technologies. Tissues were homogenised in 1.5 ml microfuge tube containing Lysis/Binding buffer provided in the mirVana™ miRNA Isolation using a hand held pestle. Total RNA containing small RNA were purified following the manufacturer protocol. Small RNA libraries were prepared for sequencing using TruSeq Small RNA Sample Preparation Kit RS 200 0012 Illumina Inc.. Libraries were prepared according to manufacturer instructions. Briefly 1µg of good quality Total RNA per sample was used as starting material. 5’ and 3’ RNA adapters were ligated to each RNA molecule before reverse transcription to create single stranded cDNA. The cDNA was then amplified with PCR using a common primer and a primer containing a unique index sequence. The resulting PCR reactions were electrophoresed on 6% Novex TBE PAGE Gel Life Technologies and bands corresponding to adapter ligated constructs derived from 22 30 nucleotides small RNA fragments were excised from the gel. The small RNA were purified from the excised gel and validated on High Sensitivity DNA chips on a Bioanalyser Agilent Technologies before sequencing.,GEO Accession:GSM1376617,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP041544,,,MZE004_TAGCTT_L008_R1.fastq.gz,fastq,477426912.0,9361312.0,GSM1376617 r1,0:51,A:93534991;C:123428376;G:148877677;T:111524753;N:61115,51,,,,93534991,123428376,148877677,111524753,61115,SRX529129,SRS598825,SRA160430,GEO,"Expression and Signaling in Mesenchymal and Hematopoietic Stem Cells, Genome and Gene Expression Data Analysis Division, Bioinformatics Institute, A*STAR, Singapore",1,0.02061,,0.00461,,0.99379,,0.8448,,51,,B,,usable mapping rate,illumina,hiseq_era,unknown,size_fractionation,trueseq,bulk,unknown,unknown,,Singapore,2014-04-29,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
38253,SRR1593716,SRX718002,SRS713862,SRP048545,PRJNA262696,Adenylation of maternally inherited microRNAs by Wispy,GSE61931,Other,Early development depends heavily on accurate control of maternally inherited mRNAs and yet it remains unknown how maternal microRNAs miRNAs are regulated during maternal to zygotic transition MZT. We here find that maternal miRNAs are highly adenylated at their three prime ends in mature oocytes and early embryos. Pervasive adenylation is observed in oocytes of fly sea urchin and mouse indicating that maternal miRNA adenylation may be widely conserved in animals. We identify Wispy as the enzyme responsible for miRNA adenylation in flies. Wispy is known to be expressed specifically in oocytes and early embryos and function as a noncanonical polyA polymerase. Knockout of wispy abrogates miRNA adenylation and induces miRNA accumulation in fly eggs whereas overexpression of Wispy increases adenylation and reduces miRNA levels in S2 cells. Adenylation occurs on both the 5p and 3p miRNAs indicating that Wispy acts on miRNAs post Dicer processing. We further find that Wispy interacts with Ago1 through protein protein interaction which may allow the effective and selective adenylation of miRNAs. Thus adenylation may contribute to the clearance of maternally deposited miRNAs during MZT. Our work provides the first mechanistic insights into the regulation of maternal miRNAs and illustrates the importance of RNA tailing in development. Overall design: MiRNA expression and modification profile during early embryo development of fruit fly and zebra fish using high throughput sequencing,,pubmed:25454948,,Zeb fish Emb t 30m,GSM1517417,,tissue:embryo|genotype/variation:WT|developmental stage:embryo 30m,Zeb fish Emb t 30m,The base calling was done by Illumina Pipeline CASAVA v1.8.2. The 3′ adaptor sequences starting with “TGGAATTC” were removed and the sequence reads with short length <16 nt or artifacts e.g. long homopolymer or low quality Phred quality <30 in >15% of nucleotides were filtered out using the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/. Filtered sequence reads from Drosophila melanogaster and Danio rerio were aligned to dm3 and danRer7 reference genomes from UCSC respectively. The BWA short read aligner Li and Durbin 2009 version 0.7.5a r405 was used for the alignment with options of ‘18nt long seed length’ and ‘no allowed mismatches in the seed region. Each aligned read was classified using intersectBed in Bedtools Quinlan and Hall 2010 with annotations retrieved from RefSeq GtRNAdb FlyBase RepeatMasker Rfam and miRBase. We collected reads that perfectly match to the mature miRNA sequences annotated in miRBase as well as those that have 3’ additions to the perfectly matching sequences. Sample wise normalization of miRNA read counts was done by TMM normalization Robinson and Oshlack 2010 using edgR package http://www.bioconductor.org/packages/release/bioc/html/edgeR.html. Genome build: dm3 GCF 000001215.2; danRer7 GCA 000002035.2 Supplementary files format and content: *.classcount.csv : comma separated files containing sequencing statistics. Column class indicates each class of RNA. Column reads indicates number of sequence reads mapped on each class of RNA. Column proportion indicates the read count proportion to the total pre processed reads of each class of RNA; dme miRNA TMM.csv : comma separated files containing expression level of miRNAs normalized by TMM. Column hairpin indicates name of each mature miRNA. Rest of the columns indicates the normalized expression levels of each mature miRNA in each sample.,embryo,,Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition.,,genotype/variation:WT|developmental stage:embryo 30m,GSM1517417,GSM1517417: Zeb fish Emb t 30m; Danio rerio; miRNA Seq,GSM1517417,,1,Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition.,GEO Accession:GSM1517417,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP048545,,,Zeb_fish_Emb_t_30m_1.fastq.gz,fastq,3380715591.0,66288541.0,GSM1517417 r1,0:51,A:854040134;C:726173965;G:952338238;T:848081062;N:82192,51,,,,854040134,726173965,952338238,848081062,82192,SRX718002,SRS713862,SRA188351,GEO,"Narry Kim Lab, School of Biological Sciences, Seoul National University",1,1e-05,,0.0,,0.99997,,1.0,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,3prime,size_fractionation,trueseq,bulk,unknown,unknown,,South Korea,2014-09-30,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
38254,SRR1593715,SRX718001,SRS713861,SRP048545,PRJNA262696,Adenylation of maternally inherited microRNAs by Wispy,GSE61931,Other,Early development depends heavily on accurate control of maternally inherited mRNAs and yet it remains unknown how maternal microRNAs miRNAs are regulated during maternal to zygotic transition MZT. We here find that maternal miRNAs are highly adenylated at their three prime ends in mature oocytes and early embryos. Pervasive adenylation is observed in oocytes of fly sea urchin and mouse indicating that maternal miRNA adenylation may be widely conserved in animals. We identify Wispy as the enzyme responsible for miRNA adenylation in flies. Wispy is known to be expressed specifically in oocytes and early embryos and function as a noncanonical polyA polymerase. Knockout of wispy abrogates miRNA adenylation and induces miRNA accumulation in fly eggs whereas overexpression of Wispy increases adenylation and reduces miRNA levels in S2 cells. Adenylation occurs on both the 5p and 3p miRNAs indicating that Wispy acts on miRNAs post Dicer processing. We further find that Wispy interacts with Ago1 through protein protein interaction which may allow the effective and selective adenylation of miRNAs. Thus adenylation may contribute to the clearance of maternally deposited miRNAs during MZT. Our work provides the first mechanistic insights into the regulation of maternal miRNAs and illustrates the importance of RNA tailing in development. Overall design: MiRNA expression and modification profile during early embryo development of fruit fly and zebra fish using high throughput sequencing,,pubmed:25454948,,Zeb fish Emb t 10m,GSM1517416,,tissue:embryo|genotype/variation:WT|developmental stage:embryo 10m,Zeb fish Emb t 10m,The base calling was done by Illumina Pipeline CASAVA v1.8.2. The 3′ adaptor sequences starting with “TGGAATTC” were removed and the sequence reads with short length <16 nt or artifacts e.g. long homopolymer or low quality Phred quality <30 in >15% of nucleotides were filtered out using the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/. Filtered sequence reads from Drosophila melanogaster and Danio rerio were aligned to dm3 and danRer7 reference genomes from UCSC respectively. The BWA short read aligner Li and Durbin 2009 version 0.7.5a r405 was used for the alignment with options of ‘18nt long seed length’ and ‘no allowed mismatches in the seed region. Each aligned read was classified using intersectBed in Bedtools Quinlan and Hall 2010 with annotations retrieved from RefSeq GtRNAdb FlyBase RepeatMasker Rfam and miRBase. We collected reads that perfectly match to the mature miRNA sequences annotated in miRBase as well as those that have 3’ additions to the perfectly matching sequences. Sample wise normalization of miRNA read counts was done by TMM normalization Robinson and Oshlack 2010 using edgR package http://www.bioconductor.org/packages/release/bioc/html/edgeR.html. Genome build: dm3 GCF 000001215.2; danRer7 GCA 000002035.2 Supplementary files format and content: *.classcount.csv : comma separated files containing sequencing statistics. Column class indicates each class of RNA. Column reads indicates number of sequence reads mapped on each class of RNA. Column proportion indicates the read count proportion to the total pre processed reads of each class of RNA; dme miRNA TMM.csv : comma separated files containing expression level of miRNAs normalized by TMM. Column hairpin indicates name of each mature miRNA. Rest of the columns indicates the normalized expression levels of each mature miRNA in each sample.,embryo,,Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition.,,genotype/variation:WT|developmental stage:embryo 10m,GSM1517416,GSM1517416: Zeb fish Emb t 10m; Danio rerio; miRNA Seq,GSM1517416,,1,Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition.,GEO Accession:GSM1517416,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP048545,,,Zeb_fish_Emb_t_10m_1.fastq.gz,fastq,3339395697.0,65478347.0,GSM1517416 r1,0:51,A:847877403;C:714050198;G:934084609;T:843302102;N:81385,51,,,,847877403,714050198,934084609,843302102,81385,SRX718001,SRS713861,SRA188351,GEO,"Narry Kim Lab, School of Biological Sciences, Seoul National University",1,0.0,,0.0,,1.0,,,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,3prime,size_fractionation,trueseq,bulk,unknown,unknown,,South Korea,2014-09-30,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
38255,SRR1593714,SRX718000,SRS713860,SRP048545,PRJNA262696,Adenylation of maternally inherited microRNAs by Wispy,GSE61931,Other,Early development depends heavily on accurate control of maternally inherited mRNAs and yet it remains unknown how maternal microRNAs miRNAs are regulated during maternal to zygotic transition MZT. We here find that maternal miRNAs are highly adenylated at their three prime ends in mature oocytes and early embryos. Pervasive adenylation is observed in oocytes of fly sea urchin and mouse indicating that maternal miRNA adenylation may be widely conserved in animals. We identify Wispy as the enzyme responsible for miRNA adenylation in flies. Wispy is known to be expressed specifically in oocytes and early embryos and function as a noncanonical polyA polymerase. Knockout of wispy abrogates miRNA adenylation and induces miRNA accumulation in fly eggs whereas overexpression of Wispy increases adenylation and reduces miRNA levels in S2 cells. Adenylation occurs on both the 5p and 3p miRNAs indicating that Wispy acts on miRNAs post Dicer processing. We further find that Wispy interacts with Ago1 through protein protein interaction which may allow the effective and selective adenylation of miRNAs. Thus adenylation may contribute to the clearance of maternally deposited miRNAs during MZT. Our work provides the first mechanistic insights into the regulation of maternal miRNAs and illustrates the importance of RNA tailing in development. Overall design: MiRNA expression and modification profile during early embryo development of fruit fly and zebra fish using high throughput sequencing,,pubmed:25454948,,Zeb fish Emb t 0m,GSM1517415,,tissue:egg|genotype/variation:WT|developmental stage:embryo 0m,Zeb fish Emb t 0m,The base calling was done by Illumina Pipeline CASAVA v1.8.2. The 3′ adaptor sequences starting with “TGGAATTC” were removed and the sequence reads with short length <16 nt or artifacts e.g. long homopolymer or low quality Phred quality <30 in >15% of nucleotides were filtered out using the FASTX Toolkit http://hannonlab.cshl.edu/fastx toolkit/. Filtered sequence reads from Drosophila melanogaster and Danio rerio were aligned to dm3 and danRer7 reference genomes from UCSC respectively. The BWA short read aligner Li and Durbin 2009 version 0.7.5a r405 was used for the alignment with options of ‘18nt long seed length’ and ‘no allowed mismatches in the seed region. Each aligned read was classified using intersectBed in Bedtools Quinlan and Hall 2010 with annotations retrieved from RefSeq GtRNAdb FlyBase RepeatMasker Rfam and miRBase. We collected reads that perfectly match to the mature miRNA sequences annotated in miRBase as well as those that have 3’ additions to the perfectly matching sequences. Sample wise normalization of miRNA read counts was done by TMM normalization Robinson and Oshlack 2010 using edgR package http://www.bioconductor.org/packages/release/bioc/html/edgeR.html. Genome build: dm3 GCF 000001215.2; danRer7 GCA 000002035.2 Supplementary files format and content: *.classcount.csv : comma separated files containing sequencing statistics. Column class indicates each class of RNA. Column reads indicates number of sequence reads mapped on each class of RNA. Column proportion indicates the read count proportion to the total pre processed reads of each class of RNA; dme miRNA TMM.csv : comma separated files containing expression level of miRNAs normalized by TMM. Column hairpin indicates name of each mature miRNA. Rest of the columns indicates the normalized expression levels of each mature miRNA in each sample.,egg,,Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition.,,genotype/variation:WT|developmental stage:embryo 0m,GSM1517415,GSM1517415: Zeb fish Emb t 0m; Danio rerio; miRNA Seq,GSM1517415,,1,Small RNA cDNA libraries were generated using TruSeq small RNA sample preparation kit Illumina according to manufacturer’s guide. For each library 10 ug of total RNA was separated on 15% urea PAGE. RNA of 15 29 nt was gel purified and then ligated to the 3’ adaptor with T4 RNA ligase2 truncated NEB. post gel purification of 3’ adaptor ligated RNA the 5’ adaptor ligation was performed using T4 RNA ligase1. The ligation product was reverse transcribed by SuperScript II Life Technologies and amplified by PCR with Phusion DNA polymerase. The cDNA libraries were sequenced by HiSeq 2000 or HiSeq 2500. Total RNA was extracted using TRIzol reagent for each experimental condition.,GEO Accession:GSM1517415,miRNA-Seq,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP048545,,,Zeb_fish_Emb_t_0m_1.fastq.gz,fastq,3135589293.0,61482143.0,GSM1517415 r1,0:51,A:800912828;C:671516191;G:883139862;T:779944407;N:76005,51,,,,800912828,671516191,883139862,779944407,76005,SRX718000,SRS713860,SRA188351,GEO,"Narry Kim Lab, School of Biological Sciences, Seoul National University",1,0.0,,0.0,,1.0,,,,51,,T,,under 1.2% mapping rate,illumina,hiseq_era,3prime,size_fractionation,trueseq,bulk,unknown,unknown,,South Korea,2014-09-30,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
38355,SRR1785161,SRX864132,SRS834993,SRP053099,PRJNA274362,Transcriptomics analysis of gene expression in 10 embryo development stages of Danio rerio,GSE65556,Transcriptome Analysis,RNA was isolated from Danio embryo cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. All samples showed a RIN RNA integrity number of higher than 9. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer's protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 101 bp. Sequencing chemistry v2 Illumina was used and samples were multiplexed in two samples per lane. Overall design: Examination of gene expressive levels in embryo development of Danio,,,,1 cell rep1,GSM1600037,,tissue:Danio embryo cells|developmental stage:embryo|cell type:1 cell,1 cell rep1,Reads were aligned to theZv9 genome assembly using TopHat v2.0.9 For each sample RPKM was computed as the number of reads which map per kilobase of exon model per million mapped reads for each gene. Genome build: Zv9 Supplementary files format and content: RPKM for each gene in each development stage,Danio embryo cells,,RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp.,,developmental stage:embryo|cell type:1 cell,GSM1600037,GSM1600037: 1 cell rep1; Danio rerio; RNA Seq,GSM1600037,,1,RNA was isolated from Danio cells using the TRIzol Invitrogen reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100 Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 Illumina San Diego CA USA according to the manufacturer’s protocol.The libraries were sequenced using HiSeq2000 Illumina in single read mode creating reads with a length of 50 bp.,GEO Accession:GSM1600037,RNA-Seq,TRANSCRIPTOMIC,cDNA,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP053099,,,W3T_1.fastq.gz,fastq,4678817425.0,46324925.0,GSM1600037 r1,0:101,A:1226268061;C:1122155105;G:1116587571;T:1213657606;N:149082,101,,,,1226268061,1122155105,1116587571,1213657606,149082,SRX864132,SRS834993,SRA236187,GEO,Beijing Institute of Genomics (BIG) of Chinese Academy of Sciences (CAS),1,0.95665,,0.0188,,0.83631,,0.49048,,101,,B,,usable mapping rate,illumina,hiseq_era,unknown,cdna_unspecified,trueseq,bulk,bulk,bulk,,China,2015-02-03,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
39762,SRR2136169,SRX1125646,SRS1017709,SRP061852,PRJNA291530,DNA methylome patterns of zebrafish cells under cold pressure,GSE71567,Other,In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.,,,,ZF4 18d30dRNA3,GSM1838568,,tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days,ZF4 18d30dRNA3,Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt,embryonic fibroblast cells,For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days.,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies.,The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA.,cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days,GSM1838568,GSM1838568: ZF4 18d30dRNA3; Danio rerio; RNA Seq,GSM1838568,,1,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM1838568,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP061852,,,18_30_replica3_2.fastq.gz 18_30_replica3_1.fastq.gz,fastq fastq,2119584182.0,10492991.0,GSM1838568 r1,0:101 1:101,A:536167639;C:523355640;G:520266539;T:537210435;N:2583929,101,101,,,536167639,523355640,520266539,537210435,2583929,SRX1125646,SRS1017709,SRA281140,GEO,"College of fishery and life science, Shanghai Ocean University",2,0.95676,0.95804,0.17177,0.17513,0.74361,0.74675,0.50106,0.53867,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2015-07-30,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
39763,SRR2136168,SRX1125644,SRS1017710,SRP061852,PRJNA291530,DNA methylome patterns of zebrafish cells under cold pressure,GSE71567,Other,In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.,,,,ZF4 18d30dRNA2,GSM1838567,,tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days,ZF4 18d30dRNA2,Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt,embryonic fibroblast cells,For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days.,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies.,The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA.,cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days,GSM1838567,GSM1838567: ZF4 18d30dRNA2; Danio rerio; RNA Seq,GSM1838567,,1,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM1838567,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP061852,,,18_30_replica2_1.fastq.gz 18_30_replica2_2.fastq.gz,fastq fastq,2953584814.0,14621707.0,GSM1838567 r1,0:101 1:101,A:787167276;C:695721456;G:682643125;T:787744527;N:308430,101,101,,,787167276,695721456,682643125,787744527,308430,SRX1125644,SRS1017710,SRA281140,GEO,"College of fishery and life science, Shanghai Ocean University",2,0.94845,0.94723,0.09069,0.09086,0.739,0.74061,0.49017,0.48951,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2015-07-30,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
39764,SRR2136167,SRX1125643,SRS1017711,SRP061852,PRJNA291530,DNA methylome patterns of zebrafish cells under cold pressure,GSE71567,Other,In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.,,,,ZF4 18d30dRNA1,GSM1838566,,tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days,ZF4 18d30dRNA1,Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt,embryonic fibroblast cells,For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days.,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies.,The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA.,cell type:fibroblast cell line|growth:cultured at 18°C for 30 days|treatment:cold treatment for 30 days,GSM1838566,GSM1838566: ZF4 18d30dRNA1; Danio rerio; RNA Seq,GSM1838566,,1,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM1838566,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP061852,,,18_30_replica1_1.fastq.gz 18_30_replica1_2.fastq.gz,fastq fastq,2287951443.0,11382843.0,GSM1838566 r1,0:100 1:101,A:605485570;C:541783445;G:533913145;T:606360277;N:409006,100,101,,,605485570,541783445,533913145,606360277,409006,SRX1125643,SRS1017711,SRA281140,GEO,"College of fishery and life science, Shanghai Ocean University",2,0.93784,0.93575,0.10431,0.10502,0.72153,0.72472,0.49277,0.49322,100,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2015-07-30,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
39765,SRR2136166,SRX1125642,SRS1017712,SRP061852,PRJNA291530,DNA methylome patterns of zebrafish cells under cold pressure,GSE71567,Other,In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.,,,,ZF4 18d5dRNA3,GSM1838565,,tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 5 days|treatment:cold treatment for 5 days,ZF4 18d5dRNA3,Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt,embryonic fibroblast cells,For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days.,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies.,The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA.,cell type:fibroblast cell line|growth:cultured at 18°C for 5 days|treatment:cold treatment for 5 days,GSM1838565,GSM1838565: ZF4 18d5dRNA3; Danio rerio; RNA Seq,GSM1838565,,1,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM1838565,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP061852,,,18_5_replica3_2.fastq.gz 18_5_replica3_1.fastq.gz,fastq fastq,2161339804.0,10699702.0,GSM1838565 r1,0:101 1:101,A:536759371;C:543672217;G:540702028;T:537573543;N:2632645,101,101,,,536759371,543672217,540702028,537573543,2632645,SRX1125642,SRS1017712,SRA281140,GEO,"College of fishery and life science, Shanghai Ocean University",2,0.96121,0.96196,0.15571,0.1569,0.75491,0.75759,0.48619,0.52542,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2015-07-30,Undetermined,Embryo,Embryo Imprecise,All anatomical structures
39766,SRR2136165,SRX1125641,SRS1017713,SRP061852,PRJNA291530,DNA methylome patterns of zebrafish cells under cold pressure,GSE71567,Other,In this study MeDIP seq and RNA seq were performed to reveal a genome wide methylation profile of zebrafish Danio rerio embryonic fibroblast cell line ZF4 and its variation under cold environment.This study puts a new insight into the genome wide epigenetic regulation under cold environment. Overall design: ZF4 cells were cultured at 28 °C as control and at 18 °C for 5 days and 30 days seperately. Each condition has three biological replica.,,,,ZF4 18d5dRNA2,GSM1838564,,tissue:embryonic fibroblast cells|cell type:fibroblast cell line|growth:cultured at 18°C for 5 days|treatment:cold treatment for 5 days,ZF4 18d5dRNA2,Illumina Casava1.7 software was used for basecalling. The fastx toolkit program was used to filter off low quality sequences from raw sequencing data. Sequences were aligned with Zebrafish genomeZR9/danRer7 downloaded from iGenome using Bowtie2. MeDIP seq peaks were called with the Model based Analysis of MeDIP Seq MACS software with default parameters with alignment results. The three peak sets generated by MACS were merged using Bedtools for peaks with at least 1bp overlap to get a reference peak set REF for following analysis. Genome build: ZR9/danRer7 Supplementary files format and content: .txt,embryonic fibroblast cells,For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days.,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies.,The zebrafish embryonic fibroblast cell line ZF4 was purchased from the American Type Culture Collection ATCC CRL 2050; Driever and Rangini 1993. The cells were grown at 28 °C 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrient mix DMEM/F12 supplemented with 10% FBS 1% l glutamine 100 u/ml penicillin 100 μg/ml streptomycin. For cold treatment cells were grown at 18 °C 5% CO2 in the same medium for up to 30 days. All cell culture medium components were purchased from Gibco BRL Life Technologies Ltd USA.,cell type:fibroblast cell line|growth:cultured at 18°C for 5 days|treatment:cold treatment for 5 days,GSM1838564,GSM1838564: ZF4 18d5dRNA2; Danio rerio; RNA Seq,GSM1838564,,1,For MeDIP seq genomic DNAs were isolated and sonicated. End repair adenylation adapter ligation methylated DNA enrichment and methylated DNA library construction were all performed with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. For RNA seq total RNA was isolated using TRlzol reagent Invitrogen life Technologies. MeDIP DNA libraries were prepared with The NEXTflex™ Methyl Seq 1 Kit BIOO LIFE SCIENCE PRODUCTS Cat No. 5118 01 according to the manufacturer’s instruction. RNA libraries were prepared for sequencing using standard Illumina protocols.,GEO Accession:GSM1838564,RNA-Seq,TRANSCRIPTOMIC,cDNA,PAIRED,ILLUMINA,Illumina HiSeq 2000,,SRP061852,,,18_5_replica2_2.fastq.gz 18_5_replica2_1.fastq.gz,fastq fastq,2948189798.0,14594999.0,GSM1838564 r1,0:101 1:101,A:784972120;C:694695628;G:681782943;T:786426712;N:312395,101,101,,,784972120,694695628,681782943,786426712,312395,SRX1125641,SRS1017713,SRA281140,GEO,"College of fishery and life science, Shanghai Ocean University",2,0.94304,0.94274,0.10665,0.10697,0.72383,0.72508,0.48863,0.4889,101,101,B,B,biological fallback assumption,illumina,hiseq_era,unknown,cdna_unspecified,unknown,bulk,unknown,unknown,,China,2015-07-30,Undetermined,Embryo,Embryo Imprecise,All anatomical structures