rowid,run.accession,experiment.accession,sample.accession,study.accession,bioproject,study.title,study.alias,study.type,study.abstract,study.attributes,study.PMIDs,sample.description,sample.title,sample.alias,sample.centername,sample.attributes,GEOsample.title,GEOsample.dataprocessing,GEOsample.source,GEOsample.treatmentprotocol,GEOsample.extractprotocol,GEOsample.growthprotocol,GEOsample.characteristics,GEOsample.accession,experiment.title,experiment.alias,experiment.library_name,experiment.design_description,experiment.library_construction_protocol,experiment.attributes,experiment.library_strategy,experiment.library_source,experiment.library_selection,experiment.library_layout,experiment.platform,experiment.instrument_model,experiment.spot_descriptor,experiment.study_ref,run.title,run.attributes,run.filename,run.semantic_name,run.total_bases,run.total_spots,run.alias,run.read_lengths,run.base_counts,run.r1_length,run.r2_length,run.r3_length,run.r4_length,run.Acount,run.Ccount,run.Gcount,run.Tcount,run.Ncount,run.experiment,run.pool_member,submission.accession,submission.srasource,submission.bioprojectsource,seqdetective.n_mates,seqdetective.mapping_rate.mate1,seqdetective.mapping_rate.mate2,seqdetective.nofeature_rate.mate1,seqdetective.nofeature_rate.mate2,seqdetective.sparsity.mate1,seqdetective.sparsity.mate2,seqdetective.pos_strand_rate.mate1,seqdetective.pos_strand_rate.mate2,seqdetective.readlen.mate1,seqdetective.readlen.mate2,seqdetective.judgement.mate1,seqdetective.judgement.mate2,seqdetective.judgement.reason,platform_family,instrument_generation,read_bias,selection_class,prep_kit,sc_or_bulk,tech_class,technology,tech_variant,submission.bioprojectsource.country,earliest_date,devstage_curation,devstage_curation_coarse,tissue_curation,tissue_curation_coarse 29215,SRR27489731,SRX23160978,SRS20111136,SRP483112,PRJNA1056276,five prime UTR MPRA during early zebrafish embryogenesis,PRJNA1056276,Other,The goal is to determine the contribution of zebrafish five prime UTR sequences to translation initiation. The five prime UTR MPRA reporter library was injected at the 1 cell stage and samples were collected during early stages of embryogenesis. Polysome profiling was performed to quantify ribosome occupancy of each five prime UTR reporter.,,,RNA product,control RNA library,RNA mMessage MPRA library,,strain:not applicable|age:not applicable|dev stage:not applicable|collection date:2022 05 16|geo loc name:Switzerland: Basel|sex:not applicable|tissue:not applicable|biomaterial provider:Schier lab|collected by:Madalena M. Reimao Pinto|genotype:not applicable|growth protocol:not applicable|sample type:IVT mRNA|sample number:50|replicate:unique sample|BioSampleModel:Model organism or animal,,,,,,,,,control RNA library,Library 50,Library 50,PCR product was amplified from DNA plasmid pool with reporter specific primer UMI were introduced ath the five primeend and library was amplified to include adapters compatible with Illumina sequencing.,,,OTHER,TRANSCRIPTOMIC,RT-PCR,PAIRED,ILLUMINA,Illumina NovaSeq 6000,,SRP483112,,,BSSE_QGF_206685_HGWLYDSX3_3_RNA_mMessage_MPRA_library_test_GGTTATAA_GATATCGA_S50_L003_R1_001_MM_1.fastq.gz BSSE_QGF_206685_HGWLYDSX3_3_RNA_mMessage_MPRA_library_test_GGTTATAA_GATATCGA_S50_L003_R2_001_MM_1.fastq.gz,fastq fastq,16695252486.0,55282293.0,BSSE QGF 206685 HGWLYDSX3 3 RNA mMessage MPRA library test GGTTATAA GATATCGA S50 L003 R1 001 MM 1.fastq.gz,0:151 1:151,A:4275447149;C:4413405571;G:3936523108;T:4069049357;N:827301,151,151,,,4275447149,4413405571,3936523108,4069049357,827301,SRX23160978,SRS20111136,SRA1775336,University of Basel|Biozentrum Basel,University of Basel,2,0.02176,0.00021,0.00058,2e-05,0.99056,0.99933,0.41475,0.48571,151,151,T,T,mates < 9% mapping rate,illumina,novaseq_era,5prime,other,unknown,bulk,unknown,unknown,,Switzerland,2024-01-11,Undetermined,Embryo,Undetermined,Embryo Imprecise 29745,SRR27467678,SRX23139228,SRS20090268,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,eggs mock R2,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: eggs mock rep2,EV04001,EV04001,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV04001.R1.fastq.gz,fastq,970037880.0,6928842.0,EV04001.R1.fastq.gz,0:140,A:258735538;C:237798398;G:268588390;T:204871983;N:43571,140,,,,258735538,237798398,268588390,204871983,43571,SRX23139228,SRS20090268,SRA1781872,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-09,Undetermined,Embryo,Undetermined,Embryo Imprecise 29761,SRR27437481,SRX23109816,SRS20064569,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,eggs BS R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: eggs BS rep3,EV07003,EV07003,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07003.R1.fastq.gz,fastq,688960160.0,4921144.0,EV07003.R1.fastq.gz,0:140,A:187831021;C:119362814;G:195214528;T:186533242;N:18555,140,,,,187831021,119362814,195214528,186533242,18555,SRX23109816,SRS20064569,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0,,0.0,,1.0,,,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Undetermined,Embryo,Undetermined,Embryo Imprecise 29762,SRR27437482,SRX23109815,SRS20064568,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,eggs DM R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: eggs DM rep3,EV07002,EV07002,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07002.R1.fastq.gz,fastq,520725380.0,3719467.0,EV07002.R1.fastq.gz,0:140,A:138972126;C:125739732;G:142785467;T:113214166;N:13889,140,,,,138972126,125739732,142785467,113214166,13889,SRX23109815,SRS20064568,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00014,,1e-05,,0.99969,,0.5,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Undetermined,Embryo,Undetermined,Embryo Imprecise 29763,SRR27437483,SRX23109814,SRS20064570,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,eggs mock R3,,strain:TLAB fish|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: eggs mock rep3,EV07001,EV07001,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV07001.R1.fastq.gz,fastq,684538960.0,4889564.0,EV07001.R1.fastq.gz,0:140,A:178906891;C:169237174;G:192342342;T:144034095;N:18458,140,,,,178906891,169237174,192342342,144034095,18458,SRX23109814,SRS20064570,SRA1780298,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.0001,,1e-05,,0.99977,,0.76923,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-06,Undetermined,Embryo,Undetermined,Embryo Imprecise 29782,SRR27435867,SRX23108229,SRS20063067,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,eggs BS R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:BS|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: eggs BS rep4,EV08006,EV08006,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08006.R1.fastq.gz,fastq,501745580.0,3583897.0,EV08006.R1.fastq.gz,0:140,A:124242793;C:76040623;G:131428076;T:170000220;N:33868,140,,,,124242793,76040623,131428076,170000220,33868,SRX23108229,SRS20063067,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,4e-05,,0.0,,0.99993,,0.66666,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Undetermined,Embryo,Undetermined,Embryo Imprecise 29783,SRR27435868,SRX23108228,SRS20063063,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,eggs DM R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:DM|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: eggs DM rep4,EV08005,EV08005,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08005.R1.fastq.gz,fastq,740147520.0,5286768.0,EV08005.R1.fastq.gz,0:140,A:192131338;C:198130943;G:182616631;T:167216834;N:51774,140,,,,192131338,198130943,182616631,167216834,51774,SRX23108228,SRS20063063,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00052,,8e-05,,0.99922,,0.92537,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Undetermined,Embryo,Undetermined,Embryo Imprecise 29784,SRR27435869,SRX23108227,SRS20063065,SRP482074,PRJNA1061456,tRAM seq: tRNA abundance and modification analysis during zebrafish embryo development,PRJNA1061456,Other,,,,,,eggs mock R4,,strain:TLAB fish|isolate:NA|breed:cross of zebrafish AB and the natural variant TL Tupfel Longfin|cultivar:NA|ecotype:NA|dev stage:activated eggs|collection date:2022|geo loc name:Austria|sex:mixed|tissue:activated eggs|treatment:mock|BioSampleModel:Model organism or animal,,,,,,,,,tRAM seq of zebrafish: eggs mock rep4,EV08004,EV08004,RNA was extracted with Trizol tRNA isolated by size selection on denaturing polyacrylamide gel range 50 150 nt. The RNA was end repaired by alkaline deacylation and T4 PNK treatment three prime adapter ligated with T4 RNA ligase 2 reverse transcribed with TGIRT. The cDNA was circularized with CircLigase and amplified with KAPA HiFi polymerase using NEB Next indexed primers.,,,OTHER,TRANSCRIPTOMIC,size fractionation,SINGLE,ILLUMINA,NextSeq 500,,SRP482074,,,EV08004.R1.fastq.gz,fastq,761663140.0,5440451.0,EV08004.R1.fastq.gz,0:140,A:194684966;C:192212418;G:196372829;T:178340184;N:52743,140,,,,194684966,192212418,196372829,178340184,52743,SRX23108227,SRS20063065,SRA1780265,Medical University of Vienna|Cell and Developmental Biology,Medical University of Vienna,1,0.00151,,0.00037,,0.99884,,0.82352,,140,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,size_fractionation,nebnext,bulk,unknown,unknown,,Austria,2024-01-05,Undetermined,Embryo,Undetermined,Embryo Imprecise 32858,SRR29482326,SRX24993370,SRS21694834,SRP515140,PRJNA1126247,Specific oncogene activation of the cell of origin in mucosal melanoma [SORT seq],GSE270356,Other,Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly melanoma only develops from melanocytes lining internal organs analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations. Overall design: Single cell RNA sequencing was done on internal vs. external normal adult zebrafish melanocytes using the SORT seq platform.,,,,Internal melanocytes,GSM8340241,,source name:Internal melanocytes|tissue:Internal melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP|geo loc name:missing|collection date:missing,Internal melanocytes,BWA was used to align paired end read to danRer11. Count tables were generated using MapAndGo. Count tables were corrected using UMI to remove duplicate reads. Transcript counts were adjusted using Poissonian counting statistics to yield the number of UMIs detected per cell. Counts were imported into R using the Seurat suite version 3.0 Assembly: danRer11 Supplementary files format and content: .tsv file contains count matrix file used for data normalization and visualization using Seurat Library strategy: SORT seq,Internal melanocytes,,Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.,mitfa / ; roy / zebrafish injected with mitfa:GFP were Raised to maturity to obtain tissues,tissue:Internal melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP,GSM8340241,GSM8340241: Internal melanocytes; Danio rerio; OTHER,GSM8340241 r1,GSM8340241,1,Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 500,,SRP515140,,,HAR-MI-002_H5GCWBGXF_R2.fastq.gz HAR-MI-002_H5GCWBGXF_R1.fastq.gz,fastq fastq,2957975418.0,34395063.0,GSM8340241 r1,0:26 1:60,A:738954503;C:560052455;G:520746060;T:1137116132;N:1106268,26,60,,,738954503,560052455,520746060,1137116132,1106268,SRX24993370,SRS21694834,SRA1904773,"Insco Lab, Medical Oncology, Dana Farber Cancer Institute","Insco Lab, Medical Oncology, Dana Farber Cancer Institute",2,0.11637,0.84116,0.10894,0.31188,0.98851,0.71526,0.6688,0.60221,26,60,T,B,sc-like readlen,illumina,nextseq,unknown,small_rna,trueseq,sc,single_cell_plate,celseq,,United States,2024-06-20,Undetermined,Adult,Skin,Surface Structure 32859,SRR29482327,SRX24993369,SRS21694833,SRP515140,PRJNA1126247,Specific oncogene activation of the cell of origin in mucosal melanoma [SORT seq],GSE270356,Other,Mucosal melanoma MM is a deadly cancer derived from mucosal melanocytes. To test the consequences of MM genetics we develop a zebrafish model in which all melanocytes experience CCND1 expression and loss of PTEN and TP53. Surprisingly melanoma only develops from melanocytes lining internal organs analogous to the location of patient MM. We find that zebrafish MMs have a unique chromatin landscape from cutaneous melanoma. Internal melanocytes are labeled using a MM specific transcriptional enhancer. Normal zebrafish internal melanocytes share a gene expression signature with MMs. Patient and zebrafish MMs show increased migratory neural crest gene and decreased antigen presentation gene expression consistent with the increased metastatic behavior and decreased immunotherapy sensitivity of MM. Our work suggests the cell state of the originating melanocyte influences the behavior of derived melanomas. Our animal model phenotypically and transcriptionally mimics patient tumors allowing this model to be used for MM therapeutic discovery. As this is a non MAPK driven genetically engineered model of melanoma our work also has implications for the 15% of cutaneous melanoma patients who lack MAPK driving mutations. Overall design: Single cell RNA sequencing was done on internal vs. external normal adult zebrafish melanocytes using the SORT seq platform.,,,,Cutaneous melanocytes,GSM8340240,,source name:Cutaneous melanocytes|tissue:Cutaneous melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP|geo loc name:missing|collection date:missing,Cutaneous melanocytes,BWA was used to align paired end read to danRer11. Count tables were generated using MapAndGo. Count tables were corrected using UMI to remove duplicate reads. Transcript counts were adjusted using Poissonian counting statistics to yield the number of UMIs detected per cell. Counts were imported into R using the Seurat suite version 3.0 Assembly: danRer11 Supplementary files format and content: .tsv file contains count matrix file used for data normalization and visualization using Seurat Library strategy: SORT seq,Cutaneous melanocytes,,Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.,mitfa / ; roy / zebrafish injected with mitfa:GFP were Raised to maturity to obtain tissues,tissue:Cutaneous melanocytes|cell type:melanocytes|genotype:mitfa / ; roy / fish injected with mitfa:GFP,GSM8340240,GSM8340240: Cutaneous melanocytes; Danio rerio; OTHER,GSM8340240 r1,GSM8340240,1,Respective tissues were mechanically dissociated digested in TrypLE for 45 min Invitrogen 12563011 40uM filtered spun down and resuspended in FACs buffer dPBS Mg+/Ca+ free with 2% FBS pen/strep. Cells were heat lysed at 65°C followed by cDNA synthesis with barcodes. All the barcoded material from one plate was pooled into one library and amplified using in vitro transcription. Following amplification library preparation was done following the CEL Seq2 protocol to prepare a cDNA library for sequencing using TruSeq small RNA primers Illumina.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 500,,SRP515140,,,HAR-MI-001_H5GCWBGXF_R2.fastq.gz HAR-MI-001_H5GCWBGXF_R1.fastq.gz,fastq fastq,2680460212.0,31168142.0,GSM8340240 r1,0:26 1:60,A:704357434;C:519158361;G:467098420;T:988838604;N:1007393,26,60,,,704357434,519158361,467098420,988838604,1007393,SRX24993369,SRS21694833,SRA1904773,"Insco Lab, Medical Oncology, Dana Farber Cancer Institute","Insco Lab, Medical Oncology, Dana Farber Cancer Institute",2,0.11679,0.81545,0.10693,0.5033,0.9808,0.76404,0.44749,0.57623,26,60,T,B,sc-like readlen,illumina,nextseq,unknown,small_rna,trueseq,sc,single_cell_plate,celseq,,United States,2024-06-20,Undetermined,Adult,Skin,Surface Structure 36409,SRR516560,SRX156356,SRS347213,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain embryo prim20 stage,D. rerio prim20 embryo,D. rerio prim20 embryo,,,,,,,,,,,CAGE D. rerio prim20 embryo,CAGE D. rerio prim20 embryo run2,D. rerio prim20 embryo,1,,,OTHER,TRANSCRIPTOMIC,CAGE,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,270Application ReadForward1,SRP013950,,,CAGE_prim20_run1.fastq,fastq,76770666.0,2843358.0,CAGE D. rerio prim20 embryo run1,0:27,A:19320047;C:17585086;G:22511175;T:17354358;N:0,27,,,,19320047,17585086,22511175,17354358,0,SRX156356,SRS347213,SRA055273,University of Bergen,ZEPROME consortium,1,0.56472,,0.10044,,0.77469,,0.74192,,27,,B,,usable mapping rate,illumina,early_illumina,unknown,cage,unknown,bulk,unknown,unknown,,Unknown,2012-06-28,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 36410,SRR516561,SRX156356,SRS347213,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain embryo prim20 stage,D. rerio prim20 embryo,D. rerio prim20 embryo,,,,,,,,,,,CAGE D. rerio prim20 embryo,CAGE D. rerio prim20 embryo run2,D. rerio prim20 embryo,1,,,OTHER,TRANSCRIPTOMIC,CAGE,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,270Application ReadForward1,SRP013950,,,CAGE_prim20_run2.fastq,fastq,163254906.0,6046478.0,CAGE D. rerio prim20 embryo run2,0:27,A:40211042;C:36959797;G:46866669;T:39217398;N:0,27,,,,40211042,36959797,46866669,39217398,0,SRX156356,SRS347213,SRA055273,University of Bergen,ZEPROME consortium,1,0.47475,,0.06947,,0.78409,,0.78014,,27,,B,,usable mapping rate,illumina,early_illumina,unknown,cage,unknown,bulk,unknown,unknown,,Unknown,2013-08-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 36411,SRR516559,SRX156355,SRS347212,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain embryo prim6 stage,D. rerio prim6 embryo,D. rerio prim6 embryo,,,,,,,,,,,CAGE D. rerio prim6 embryo,CAGE D. rerio prim6 embryo,D. rerio prim6 embryo,1,,,OTHER,TRANSCRIPTOMIC,CAGE,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,270Application ReadForward1,SRP013950,,,CAGE_prim6.fastq,fastq,283414275.0,10496825.0,CAGE D. rerio prim6 embryo,0:27,A:70974303;C:66202040;G:80064124;T:66173808;N:0,27,,,,70974303,66202040,80064124,66173808,0,SRX156355,SRS347212,SRA055273,University of Bergen,ZEPROME consortium,1,0.53395,,0.07806,,0.78255,,0.77575,,27,,B,,usable mapping rate,illumina,early_illumina,unknown,cage,unknown,bulk,unknown,unknown,,Unknown,2013-08-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 36420,SRR516550,SRX156337,SRS347206,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain embryo high stage,D. rerio high embryo,D. rerio high embryo,,,,,,,,,,,CAGE D. rerio high embryo,CAGE D. rerio high embryo,D. rerio high embryo,1,,,OTHER,TRANSCRIPTOMIC,CAGE,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,270Application ReadForward1,SRP013950,,,CAGE_high.fastq,fastq,128592846.0,4762698.0,CAGE D. rerio high embryo,0:27,A:33693838;C:27629256;G:36692263;T:30577489;N:0,27,,,,33693838,27629256,36692263,30577489,0,SRX156337,SRS347206,SRA055273,University of Bergen,ZEPROME consortium,1,0.53282,,0.08323,,0.80854,,0.77395,,27,,B,,usable mapping rate,illumina,early_illumina,unknown,cage,unknown,bulk,unknown,unknown,,Unknown,2013-08-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 36423,SRR516547,SRX156325,SRS347201,SRP013950,PRJNA169500,Danio rerio embryonic promoterome,PRJNA169500,Transcriptome Analysis,Goal of this study is to generate genome wide maps of transcription initiation throughout early embryonic development of zebrafish Danio rerio. Cap analysis of gene expression CAGE is used to detect transcription start sites at 1bp resolution. CAGE data is complemented by ChIPseq datasets for promoter associated histone modifications to study dynamic changes of promoter usage and chromatin configuration throughout early embryonic development.,,pubmed:24531765,Zebrafish wild type AB strain fertilized egg,D. rerio fertilized egg,D. rerio fertilized egg,,,,,,,,,,,CAGE D. rerio fertilized egg,CAGE D. rerio fertilized egg,D. rerio fertilized egg,1,,,OTHER,TRANSCRIPTOMIC,CAGE,SINGLE,ILLUMINA,Illumina Genome Analyzer IIx,270Application ReadForward1,SRP013950,,,CAGE_fertilized_egg.fastq,fastq,160948350.0,5961050.0,CAGE D. rerio fertilized egg,0:27,A:42030009;C:34700589;G:45399755;T:38817997;N:0,27,,,,42030009,34700589,45399755,38817997,0,SRX156325,SRS347201,SRA055273,University of Bergen,ZEPROME consortium,1,0.49394,,0.07554,,0.81684,,0.79759,,27,,B,,usable mapping rate,illumina,early_illumina,unknown,cage,unknown,bulk,unknown,unknown,,Unknown,2012-06-28,Undetermined,Embryo,Undetermined,Embryo Imprecise 41827,SRR5251446,SRX2557171,SRS1974564,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR139 B1,nicoli mutmir AG01645,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR139 B1,AG01645.1,AG01645.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01645.1_R1.fastq.gz,fastq,1574284140.0,20714265.0,AG01645.1 R1.fastq.gz,0:76,A:485471345;C:270854124;G:374164721;T:443766613;N:27337,76,,,,485471345,270854124,374164721,443766613,27337,SRX2557171,SRS1974564,SRA537606,Yale University|Genetics,Yale University,1,0.82142,,0.14068,,0.8002,,0.5444,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-27,Undetermined,Embryo,Endothelium,Cardiovascular System 41828,SRR5251445,SRX2557170,SRS1974563,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR139 B2,nicoli mutmir AG01646,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR139 B2,AG01646.1,AG01646.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01646.1_R1.fastq.gz,fastq,1484740104.0,19536054.0,AG01646.1 R1.fastq.gz,0:76,A:453388316;C:246477203;G:365031959;T:419816346;N:26280,76,,,,453388316,246477203,365031959,419816346,26280,SRX2557170,SRS1974563,SRA537606,Yale University|Genetics,Yale University,1,0.82649,,0.1897,,0.79862,,0.52759,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41829,SRR5251444,SRX2557169,SRS1974562,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR139 B3,nicoli mutmir AG01647,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 139|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR139 B3,AG01647.1,AG01647.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01647.1_R1.fastq.gz,fastq,881298660.0,11596035.0,AG01647.1 R1.fastq.gz,0:76,A:270675838;C:160127586;G:228157662;T:222301246;N:36328,76,,,,270675838,160127586,228157662,222301246,36328,SRX2557169,SRS1974562,SRA537606,Yale University|Genetics,Yale University,1,0.76133,,0.15034,,0.83341,,0.56596,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41830,SRR5251443,SRX2557168,SRS1974561,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR139 B1,nicoli mutmir AG01648,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR139 B1,AG01648.1,AG01648.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01648.1_R1.fastq.gz,fastq,637896880.0,8393380.0,AG01648.1 R1.fastq.gz,0:76,A:192829278;C:112701153;G:153321271;T:179019095;N:26083,76,,,,192829278,112701153,153321271,179019095,26083,SRX2557168,SRS1974561,SRA537606,Yale University|Genetics,Yale University,1,0.75971,,0.1181,,0.82171,,0.56797,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41831,SRR5251442,SRX2557167,SRS1974560,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR139 B2,nicoli mutmir AG01649,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR139 B2,AG01649.1,AG01649.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01649.1_R1.fastq.gz,fastq,849868328.0,11182478.0,AG01649.1 R1.fastq.gz,0:76,A:258225905;C:148467172;G:205165181;T:237974100;N:35970,76,,,,258225905,148467172,205165181,237974100,35970,SRX2557167,SRS1974560,SRA537606,Yale University|Genetics,Yale University,1,0.75096,,0.14506,,0.81507,,0.5545,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41832,SRR5251441,SRX2557166,SRS1974559,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR139 B3,nicoli mutmir AG01650,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 139 ya302/ya302|molecule:mRNA|condition:miR 139|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR139 B3,AG01650.1,AG01650.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01650.1_R1.fastq.gz,fastq,998464668.0,13137693.0,AG01650.1 R1.fastq.gz,0:76,A:311526420;C:176545041;G:251852786;T:258497630;N:42791,76,,,,311526420,176545041,251852786,258497630,42791,SRX2557166,SRS1974559,SRA537606,Yale University|Genetics,Yale University,1,0.76479,,0.11192,,0.82674,,0.54621,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41833,SRR5251440,SRX2557165,SRS1974558,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR24 B1,nicoli mutmir AG01651,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR24 B1,AG01651.1,AG01651.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01651.1_R1.fastq.gz,fastq,570492252.0,7506477.0,AG01651.1 R1.fastq.gz,0:76,A:162512811;C:104071716;G:135730697;T:168149427;N:27601,76,,,,162512811,104071716,135730697,168149427,27601,SRX2557165,SRS1974558,SRA537606,Yale University|Genetics,Yale University,1,0.73988,,0.10157,,0.86647,,0.54252,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41834,SRR5251439,SRX2557164,SRS1974557,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR24 B2,nicoli mutmir AG01652,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR24 B2,AG01652.1,AG01652.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01652.1_R1.fastq.gz,fastq,1072886148.0,14116923.0,AG01652.1 R1.fastq.gz,0:76,A:338399596;C:192703439;G:242960887;T:298769761;N:52465,76,,,,338399596,192703439,242960887,298769761,52465,SRX2557164,SRS1974557,SRA537606,Yale University|Genetics,Yale University,1,0.76456,,0.11024,,0.89197,,0.59214,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41835,SRR5251438,SRX2557163,SRS1974556,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR24 B3,nicoli mutmir AG01653,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 24|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR24 B3,AG01653.1,AG01653.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01653.1_R1.fastq.gz,fastq,1016374144.0,13373344.0,AG01653.1 R1.fastq.gz,0:76,A:310958343;C:168702106;G:223420046;T:313241363;N:52286,76,,,,310958343,168702106,223420046,313241363,52286,SRX2557163,SRS1974556,SRA537606,Yale University|Genetics,Yale University,1,0.75735,,0.12224,,0.79756,,0.55136,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-02-13,Undetermined,Embryo,Endothelium,Cardiovascular System 41836,SRR5251437,SRX2557162,SRS1974555,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR24 B1,nicoli mutmir AG01654,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR24 B1,AG01654.1,AG01654.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01654.1_R1.fastq.gz,fastq,782170112.0,10291712.0,AG01654.1 R1.fastq.gz,0:76,A:238316720;C:132163709;G:179301544;T:232350598;N:37541,76,,,,238316720,132163709,179301544,232350598,37541,SRX2557162,SRS1974555,SRA537606,Yale University|Genetics,Yale University,1,0.7683,,0.10712,,0.80034,,0.55804,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41837,SRR5251436,SRX2557161,SRS1974554,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR24 B2,nicoli mutmir AG01655,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR24 B2,AG01655.1,AG01655.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01655.1_R1.fastq.gz,fastq,1053946340.0,13867715.0,AG01655.1 R1.fastq.gz,0:76,A:318351311;C:191163031;G:240348413;T:304030367;N:53218,76,,,,318351311,191163031,240348413,304030367,53218,SRX2557161,SRS1974554,SRA537606,Yale University|Genetics,Yale University,1,0.77588,,0.07983,,0.83934,,0.56228,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41838,SRR5251435,SRX2557160,SRS1974553,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR24 B3,nicoli mutmir AG01656,,strain:TU/AB|age:51.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 24 ya324/? ya325/? ya326/? ya327/?|molecule:mRNA|condition:miR 24|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR24 B3,AG01656.1,AG01656.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01656.1_R1.fastq.gz,fastq,1182467736.0,15558786.0,AG01656.1 R1.fastq.gz,0:76,A:344465226;C:204677242;G:269228338;T:364036735;N:60195,76,,,,344465226,204677242,269228338,364036735,60195,SRX2557160,SRS1974553,SRA537606,Yale University|Genetics,Yale University,1,0.78956,,0.13495,,0.81517,,0.56342,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-02-13,Undetermined,Embryo,Endothelium,Cardiovascular System 41839,SRR5251434,SRX2557159,SRS1974552,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR223 B1,nicoli mutmir AG01657,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR223 B1,AG01657.1,AG01657.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01657.1_R1.fastq.gz,fastq,536336712.0,7057062.0,AG01657.1 R1.fastq.gz,0:76,A:158301607;C:93070120;G:121382262;T:163555487;N:27236,76,,,,158301607,93070120,121382262,163555487,27236,SRX2557159,SRS1974552,SRA537606,Yale University|Genetics,Yale University,1,0.76425,,0.1278,,0.84222,,0.55305,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-02-13,Undetermined,Embryo,Endothelium,Cardiovascular System 41840,SRR5251433,SRX2557158,SRS1974551,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR223 B2,nicoli mutmir AG01658,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR223 B2,AG01658.1,AG01658.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01658.1_R1.fastq.gz,fastq,798581856.0,10507656.0,AG01658.1 R1.fastq.gz,0:76,A:241352089;C:134327379;G:183394123;T:239469845;N:38420,76,,,,241352089,134327379,183394123,239469845,38420,SRX2557158,SRS1974551,SRA537606,Yale University|Genetics,Yale University,1,0.76221,,0.13398,,0.82459,,0.55228,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41841,SRR5251432,SRX2557157,SRS1974550,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs WT miR223 B3,nicoli mutmir AG01659,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|molecule:mRNA|condition:miR 223|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs WT miR223 B3,AG01659.1,AG01659.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01659.1_R1.fastq.gz,fastq,1093998948.0,14394723.0,AG01659.1 R1.fastq.gz,0:76,A:330741822;C:186325335;G:249557623;T:327320449;N:53719,76,,,,330741822,186325335,249557623,327320449,53719,SRX2557157,SRS1974550,SRA537606,Yale University|Genetics,Yale University,1,0.77108,,0.14674,,0.80955,,0.55819,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 41842,SRR5251431,SRX2557156,SRS1974549,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR223 B1,nicoli mutmir AG01660,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 223 ya304/ya304|molecule:mRNA|condition:miR 223|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR223 B1,AG01660.1,AG01660.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01660.1_R1.fastq.gz,fastq,849905492.0,11182967.0,AG01660.1 R1.fastq.gz,0:76,A:250953875;C:146191904;G:190040699;T:262674911;N:44103,76,,,,250953875,146191904,190040699,262674911,44103,SRX2557156,SRS1974549,SRA537606,Yale University|Genetics,Yale University,1,0.7687,,0.14192,,0.82842,,0.5344,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-02-13,Undetermined,Embryo,Endothelium,Cardiovascular System 41843,SRR5251430,SRX2557155,SRS1974548,SRP099466,PRJNA374579,microRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos,PRJNA374579,Other,Proper functioning of an organism requires cells and tissues to behave in uniform well organized ways. How this optimum of phenotypes is achieved during the development of vertebrates is unclear. Here we carried out a multifaceted and single cell resolution screen of zebrafish embryonic blood vessels upon mutagenesis of single and multi gene miRNA families. We found that embryos lacking particular miRNA dependent signaling pathways develop a vascular trait similar to wild type but with a profound increase in phenotypic heterogeneity. Aberrant trait variance in miRNA mutant embryos uniquely sensitizes their vascular system to environmental perturbations. We uncovered a previously unrecognized role for specific vertebrate miRNAs to protect tissue development against phenotypic variability. This discovery marks an important advance in our comprehension of how miRNAs function in the development of higher organisms.,,,,QuantSeq mutant miRNAs Mut miR223 B2,nicoli mutmir AG01661,,strain:TU/AB|age:27.0|sex:pooled male and female|tissue:endothelial cells|genotype:miR 223 ya304/ya304|molecule:mRNA|condition:miR 223|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,QuantSeq mutant miRNAs Mut miR223 B2,AG01661.1,AG01661.1,1,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP099466,,,AG01661.1_R1.fastq.gz,fastq,840115400.0,11054150.0,AG01661.1 R1.fastq.gz,0:76,A:257057495;C:141775085;G:188281166;T:252960590;N:41064,76,,,,257057495,141775085,188281166,252960590,41064,SRX2557155,SRS1974548,SRA537606,Yale University|Genetics,Yale University,1,0.74292,,0.10759,,0.83615,,0.55136,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,lexogen,bulk,unknown,unknown,,United States,2017-03-28,Undetermined,Embryo,Endothelium,Cardiovascular System 43083,SRR7264587,SRX4168710,SRS3380684,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,Raw multiplex: dmsseq AG01269;dmsseq AG01270,,strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal,,,,,,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,AG01269.4;AG01270.4,AG01269.4;AG01270.4,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,C7MYYANXX_JBCX101_016_R1.fastq.gz,fastq,3504515800.0,46112050.0,C7MYYANXX JBCX101 016 R1.fastq.gz,0:76,A:1100987855;C:897481291;G:850509260;T:655386223;N:151171,76,,,,1100987855,897481291,850509260,655386223,151171,SRX4168710,SRS3380684,SRA715414,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.00251,,0.00024,,0.99334,,0.49363,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-05,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43084,SRR7264588,SRX4168709,SRS3380684,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,Raw multiplex: dmsseq AG01269;dmsseq AG01270,,strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal,,,,,,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,AG01269.3;AG01270.3,AG01269.3;AG01270.3,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,HVJ7NADXX_JBCX101_016_R1.fastq.gz,fastq,1533760484.0,20181059.0,HVJ7NADXX JBCX101 016 R1.fastq.gz,0:76,A:486730101;C:387546602;G:372319444;T:287072948;N:91389,76,,,,486730101,387546602,372319444,287072948,91389,SRX4168709,SRS3380684,SRA715414,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,4e-05,,2e-05,,0.99997,,1.0,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43086,SRR7264590,SRX4168707,SRS3380684,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,Raw multiplex: dmsseq AG01269;dmsseq AG01270,,strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal,,,,,,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,AG01269.5;AG01270.5,AG01269.5;AG01270.5,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,C7MWLANXX_JBCX101_016_R1.fastq.gz,fastq,11187105076.0,147198751.0,C7MWLANXX JBCX101 016 R1.fastq.gz,0:76,A:3525623658;C:2869684594;G:2708534500;T:2083102664;N:159660,76,,,,3525623658,2869684594,2708534500,2083102664,159660,SRX4168707,SRS3380684,SRA715414,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.0,,0.0,,1.0,,,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43089,SRR7264593,SRX4168704,SRS3380684,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,Raw multiplex: dmsseq AG01269;dmsseq AG01270,,strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal,,,,,,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,AG01269.2;AG01270.2,AG01269.2;AG01270.2,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,HVK53ADXX_JBCX101_016_R1.fastq.gz,fastq,4318423208.0,56821358.0,HVK53ADXX JBCX101 016 R1.fastq.gz,0:76,A:1370691469;C:1101595011;G:1048719303;T:796936406;N:481019,76,,,,1370691469,1101595011,1048719303,796936406,481019,SRX4168704,SRS3380684,SRA715414,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,1e-05,,0.0,,0.99997,,0.0,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43090,SRR7264594,SRX4168703,SRS3380684,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,Raw multiplex: dmsseq AG01269;dmsseq AG01270,,strain:TU/AB|age:2|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2;1|barcode:AGAG;CACA|BioSampleModel:Model organism or animal,,,,,,,,,Raw multiplex: DMS Seq IVT 64c B2;DMS Seq IVT 64c B1,AG01269.1;AG01270.1,AG01269.1;AG01270.1,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,HMHGVADXX_JBCX101_016_R1.fastq.gz,fastq,3247405520.0,42729020.0,HMHGVADXX JBCX101 016 R1.fastq.gz,0:76,A:1030573532;C:829398246;G:789085434;T:598013908;N:334400,76,,,,1030573532,829398246,789085434,598013908,334400,SRX4168703,SRS3380684,SRA715414,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.0,,0.0,,1.0,,,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43095,SRR5893054,SRX3058791,SRS2404524,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,miniRESA 2h pA RNA B1,miniresa AG01710,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,miniRESA 2h pA RNA B1,AG01710.1,AG01710.1,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01710.1_R1.fastq.gz,fastq,236178588.0,3107613.0,AG01710.1 R1.fastq.gz,0:76,A:63902747;C:43772893;G:46507615;T:81990822;N:4511,76,,,,63902747,43772893,46507615,81990822,4511,SRX3058791,SRS2404524,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.92111,,4e-05,,0.99799,,0.56316,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43096,SRR5893055,SRX3058790,SRS2404526,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,miniRESA 2h pA RNA B2,miniresa AG01711,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,miniRESA 2h pA RNA B2,AG01711.1,AG01711.1,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01711.1_R1.fastq.gz,fastq,226089360.0,2974860.0,AG01711.1 R1.fastq.gz,0:76,A:61341697;C:41846683;G:44622362;T:78273216;N:5402,76,,,,61341697,41846683,44622362,78273216,5402,SRX3058790,SRS2404526,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.91845,,1e-05,,0.99797,,0.60522,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43153,SRR5893120,SRX3058725,SRS2404546,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B2,dmsseq AG01269,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B2,AG01269.2,AG01269.2,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01269.2_R1.fastq.gz,fastq,615648941.0,27257391.0,AG01269.2 R1.fastq.gz,0:22.59 1:0,A:163885634;C:143593857;G:157437520;T:150675530;N:56400,22,0,,,163885634,143593857,157437520,150675530,56400,SRX3058725,SRS2404546,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.6277,,0.07639,,0.78236,,0.60487,,20,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43154,SRR5893121,SRX3058724,SRS2404546,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B2,dmsseq AG01269,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B2,AG01269.1,AG01269.1,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01269.1_R1.fastq.gz,fastq,461341500.0,20486790.0,AG01269.1 R1.fastq.gz,0:22.52 1:0,A:122338299;C:107915972;G:118163678;T:112917569;N:5982,22,0,,,122338299,107915972,118163678,112917569,5982,SRX3058724,SRS2404546,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.62415,,0.07628,,0.78133,,0.60032,,19,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43159,SRR8782100,SRX3058719,SRS2404551,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,miniRESA 2h pA RNA B4,miniresa AG01728,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:4|BioSampleModel:Model organism or animal,,,,,,,,,miniRESA 2h pA RNA B4,AG01728.1,AG01728.1,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,SRR5893126_replace_R1.fastq.gz,fastq,156537732.0,2059707.0,SRR5893126 replace R1.fastq.gz,0:76,A:42070748;C:29088642;G:31333987;T:54029008;N:15347,76,,,,42070748,29088642,31333987,54029008,15347,SRX3058719,SRS2404551,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.94152,,0.0,,0.99797,,0.61884,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2019-03-25,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43160,SRR8782101,SRX3058718,SRS2404553,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,miniRESA 2h pA RNA B3,miniresa AG01727,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:3|BioSampleModel:Model organism or animal,,,,,,,,,miniRESA 2h pA RNA B3,AG01727.1,AG01727.1,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,SRR5893127_replace_R1.fastq.gz,fastq,150519748.0,1980523.0,SRR5893127 replace R1.fastq.gz,0:76,A:40089061;C:28406150;G:30480481;T:51528116;N:15940,76,,,,40089061,28406150,30480481,51528116,15940,SRX3058718,SRS2404553,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.94224,,1e-05,,0.99793,,0.60622,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2019-03-25,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43162,SRR8782104,SRX3058716,SRS2404554,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,miniRESA 2h pA RNA B5,miniresa AG01729,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|molecule:RNA|selection:pA|replicate group:25|replicate:5|BioSampleModel:Model organism or animal,,,,,,,,,miniRESA 2h pA RNA B5,AG01729.1,AG01729.1,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,SRR5893129_replace_R1.fastq.gz,fastq,164152628.0,2159903.0,SRR5893129 replace R1.fastq.gz,0:76,A:44289887;C:30688789;G:32985693;T:56172026;N:16233,76,,,,44289887,30688789,32985693,56172026,16233,SRX3058716,SRS2404554,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.9284,,1e-05,,0.9976,,0.61504,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2019-03-25,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43164,SRR5893131,SRX3058714,SRS2404556,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B1,dmsseq AG01270,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B1,AG01270.4,AG01270.4,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01270.4_R1.fastq.gz,fastq,369232203.0,16423574.0,AG01270.4 R1.fastq.gz,0:22.48 1:0,A:96909706;C:86935520;G:96347195;T:89039251;N:531,22,0,,,96909706,86935520,96347195,89039251,531,SRX3058714,SRS2404556,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.61992,,0.07599,,0.78701,,0.61408,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43165,SRR5893132,SRX3058713,SRS2404556,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B1,dmsseq AG01270,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B1,AG01270.5,AG01270.5,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01270.5_R1.fastq.gz,fastq,1209837988.0,53770802.0,AG01270.5 R1.fastq.gz,0:22.50 1:0,A:315203598;C:286991445;G:317405494;T:290233476;N:3975,22,0,,,315203598,286991445,317405494,290233476,3975,SRX3058713,SRS2404556,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.628,,0.07601,,0.78675,,0.61598,,27,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43166,SRR5893133,SRX3058712,SRS2404556,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B1,dmsseq AG01270,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B1,AG01270.2,AG01270.2,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01270.2_R1.fastq.gz,fastq,475556869.0,21124005.0,AG01270.2 R1.fastq.gz,0:22.51 1:0,A:125248500;C:112069047;G:123791782;T:114403721;N:43819,22,0,,,125248500,112069047,123791782,114403721,43819,SRX3058712,SRS2404556,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.62492,,0.07783,,0.78451,,0.5998,,22,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43167,SRR5893134,SRX3058711,SRS2404556,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B1,dmsseq AG01270,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B1,AG01270.3,AG01270.3,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01270.3_R1.fastq.gz,fastq,161875687.0,7179709.0,AG01270.3 R1.fastq.gz,0:22.55 1:0,A:42971355;C:37785152;G:42094982;T:39023778;N:420,22,0,,,42971355,37785152,42094982,39023778,420,SRX3058711,SRS2404556,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.62849,,0.07622,,0.78307,,0.60361,,27,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43168,SRR5893135,SRX3058710,SRS2404546,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B2,dmsseq AG01269,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B2,AG01269.5,AG01269.5,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01269.5_R1.fastq.gz,fastq,1563607961.0,69286414.0,AG01269.5 R1.fastq.gz,0:22.57 1:0,A:411693836;C:367369547;G:402702896;T:381836642;N:5040,22,0,,,411693836,367369547,402702896,381836642,5040,SRX3058710,SRS2404546,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.62646,,0.07519,,0.78332,,0.60197,,26,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43169,SRR5893136,SRX3058709,SRS2404556,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B1,dmsseq AG01270,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:1|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B1,AG01270.1,AG01270.1,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01270.1_R1.fastq.gz,fastq,355558938.0,15838601.0,AG01270.1 R1.fastq.gz,0:22.45 1:0,A:93238299;C:84024450;G:92763663;T:85527926;N:4600,22,0,,,93238299,84024450,92763663,85527926,4600,SRX3058709,SRS2404556,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.62041,,0.07796,,0.78526,,0.60168,,15,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43170,SRR5893137,SRX3058708,SRS2404546,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B2,dmsseq AG01269,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B2,AG01269.3,AG01269.3,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01269.3_R1.fastq.gz,fastq,212697329.0,9397171.0,AG01269.3 R1.fastq.gz,0:22.63 1:0,A:57025177;C:49118963;G:54415396;T:52137277;N:516,22,0,,,57025177,49118963,54415396,52137277,516,SRX3058708,SRS2404546,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.63192,,0.07668,,0.77983,,0.6006,,20,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 43171,SRR5893138,SRX3058707,SRS2404546,SRP114782,PRJNA397065,mRNA structure dynamics identifies RNA remodelers and functional elements during embryogenesis,PRJNA397065,Other,RNA folding plays a crucial role in RNA function. However our knowledge of the global structure of the transcriptome is limited to steady state conditions hindering our understanding of how RNA structure dynamics influences gene function. Here we have characterized mRNA structure dynamics during the maternal to zygotic transition in zebrafish. We observe that on a global level translation guides structure rather than structure guides translation. We detect a decrease in structure in translated regions and identify the ribosome as a major remodeler of RNA structure in vivo. In contrast we find that three prime UTRs form highly folded structures in vivo which can affect gene expression by modulating miRNA activity. Furthermore we find that dynamic three prime UTR structures are enriched in RNA decay elements including regulatory elements in nanog and cyclin A1 key maternal factors orchestrating the maternal to zygotic transition. These results reveal a central role of RNA structure dynamics in gene regulatory programs during embryogenesis.,,,,DMS Seq IVT 64c B2,dmsseq AG01269,,strain:TU/AB|age:2.0|dev stage:64c|sex:pooled male and female|tissue:embryo|treatment:DMS 0.5% in vitro|molecule:RNA|selection:pA|condition:DMS|replicate group:17|replicate:2|BioSampleModel:Model organism or animal,,,,,,,,,DMS Seq IVT 64c B2,AG01269.4,AG01269.4,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP114782,,,AG01269.4_R1.fastq.gz,fastq,474396378.0,21071500.0,AG01269.4 R1.fastq.gz,0:22.51 1:0,A:125988009;C:110649678;G:121336327;T:116421641;N:723,22,0,,,125988009,110649678,121336327,116421641,723,SRX3058707,SRS2404546,SRA596275,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.6211,,0.07454,,0.78612,,0.60194,,21,,B,,usable mapping rate,illumina,hiseq_era,unknown,small_rna,unknown,bulk,unknown,unknown,,United States,2018-06-07,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 44015,SRR6211474,SRX3320751,SRS2626325,SRP121343,PRJNA415636,Simultaneous lineage tracing and cell type identification using CRISPR/Cas9 induced genetic scars,GSE106121,Other,A key goal of developmental biology is to understand how a single cell transforms into a full grown organism consisting of many different cell types. Single cell RNA sequencing scRNA seq has become a widely used method due to its ability to identify all cell types in a tissue or organ in a systematic manner. However a major challenge is to organize the resulting taxonomy of cell types into lineage trees revealing the developmental origin of cells. Here we present a strategy for simultaneous lineage tracing and transcriptome profiling in thousands of single cells. By combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes we reconstruct developmental lineage trees in zebrafish larvae and adult fish. In future analyses LINNAEUS LINeage tracing by Nuclease Activated Editing of Ubiquitous Sequences can be used as a systematic approach for identifying the lineage origin of novel cell types or of known cell types under different conditions. Overall design: Combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes.,,pubmed:29644996,,Time course 10h24h mRNA,GSM2830047,,source name:Full organism|strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:10h 24h,Time course 10h24h mRNA,Library strategy: Targeted amplification Embryos were injected with Cas9 and sgRNA at the 1 cell stage. post 1 2 3 4 6 8 10 and 24 hours 2 3 embryos were collected and RNA and/or DNA were extracted using TRIzol Reagent according to the manufacturer’s protocols. Bulk scar libraries were produced similarly to the bulk libraries for the scar probabilities. For each sample we calculated the percentage of unscarred RFP. We fit a negative exponential to this data assuming that the fraction of unscarred RFP at t=0 was one. Genome build: N/A Supplementary files format and content: List of scar sequences with CIGAR and cell barcode.,Full organism,,Trizol extraction of RNA. CEL seq,,strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:10h 24h,GSM2830047,GSM2830047: Time course 10h24h mRNA; Danio rerio; OTHER,GSM2830047,,1,Trizol extraction of RNA. CEL seq,GEO Accession:GSM2830047,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 500,,SRP121343,,,dyn_RNA_10h24h_S13_R2_001.fastq.gz dyn_RNA_10h24h_S13_R1_001.fastq.gz,fastq fastq,1456176300.0,9707842.0,GSM2830047 r1,0:100 1:50,A:216943159;C:398650961;G:516656316;T:323899428;N:26436,100,50,,,216943159,398650961,516656316,323899428,26436,SRX3320751,SRS2626325,SRA623333,GEO,Max Delbrück Center,2,3e-05,0.00111,0.0,0.0011,0.99995,1.0,0.75,,100,50,T,T,mates < 9% mapping rate,illumina,nextseq,unknown,other,unknown,sc,single_cell_plate,celseq,,Germany,2017-10-24,Undetermined,Embryo,Trunk,Surface Structure 44016,SRR6211473,SRX3320750,SRS2626324,SRP121343,PRJNA415636,Simultaneous lineage tracing and cell type identification using CRISPR/Cas9 induced genetic scars,GSE106121,Other,A key goal of developmental biology is to understand how a single cell transforms into a full grown organism consisting of many different cell types. Single cell RNA sequencing scRNA seq has become a widely used method due to its ability to identify all cell types in a tissue or organ in a systematic manner. However a major challenge is to organize the resulting taxonomy of cell types into lineage trees revealing the developmental origin of cells. Here we present a strategy for simultaneous lineage tracing and transcriptome profiling in thousands of single cells. By combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes we reconstruct developmental lineage trees in zebrafish larvae and adult fish. In future analyses LINNAEUS LINeage tracing by Nuclease Activated Editing of Ubiquitous Sequences can be used as a systematic approach for identifying the lineage origin of novel cell types or of known cell types under different conditions. Overall design: Combining scRNA seq with computational analysis of lineage barcodes generated by genome editing of transgenic reporter genes.,,pubmed:29644996,,Time course 3h6h8h mRNA,GSM2830046,,source name:Full organism|strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:3h 6h 8h,Time course 3h6h8h mRNA,Library strategy: Targeted amplification Embryos were injected with Cas9 and sgRNA at the 1 cell stage. post 1 2 3 4 6 8 10 and 24 hours 2 3 embryos were collected and RNA and/or DNA were extracted using TRIzol Reagent according to the manufacturer’s protocols. Bulk scar libraries were produced similarly to the bulk libraries for the scar probabilities. For each sample we calculated the percentage of unscarred RFP. We fit a negative exponential to this data assuming that the fraction of unscarred RFP at t=0 was one. Genome build: N/A Supplementary files format and content: List of scar sequences with CIGAR and cell barcode.,Full organism,,Trizol extraction of RNA. CEL seq,,strain/background:Zebrabow M|tissue:Whole body|developmental stage:Embryo|time point:3h 6h 8h,GSM2830046,GSM2830046: Time course 3h6h8h mRNA; Danio rerio; OTHER,GSM2830046,,1,Trizol extraction of RNA. CEL seq,GEO Accession:GSM2830046,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,NextSeq 500,,SRP121343,,,dyn_RNA_3h6h8h_S12_R1_001.fastq.gz dyn_RNA_3h6h8h_S12_R2_001.fastq.gz,fastq fastq,1382400000.0,9216000.0,GSM2830046 r1,0:100 1:50,A:219040774;C:378529638;G:475287684;T:309516830;N:25074,100,50,,,219040774,378529638,475287684,309516830,25074,SRX3320750,SRS2626324,SRA623333,GEO,Max Delbrück Center,2,5e-05,0.00116,0.0,0.00115,0.99987,1.0,0.5,,100,50,T,T,mates < 9% mapping rate,illumina,nextseq,unknown,other,unknown,sc,single_cell_plate,celseq,,Germany,2017-10-24,Undetermined,Embryo,Trunk,Surface Structure 51336,SRR8784147,SRX5574144,SRS4536704,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT TinyLNA430 6h DL B2,RESA WT TinyLNA430 6h DL B2 AGN000468,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection tinyLNA miR 430|molecule:RNA|sample ref:AGS000445|replicate ref:AGN000468|replicate order:2|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT TinyLNA430 6h DL B2,AGR000602,AGR000602,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000602_R1.fastq.gz,fastq,2627525732.0,34572707.0,AGR000602 R1.fastq.gz,0:76,A:750015324;C:666424084;G:623763820;T:586999539;N:322965,76,,,,750015324,666424084,623763820,586999539,322965,SRX5574144,SRS4536704,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.87853,,0.06924,,0.78255,,0.55641,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51337,SRR8784148,SRX5574143,SRS4536697,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT TinyLNA430 6h DL B1,RESA WT TinyLNA430 6h DL B1 AGN000467,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection tinyLNA miR 430|molecule:RNA|sample ref:AGS000445|replicate ref:AGN000467|replicate order:1|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT TinyLNA430 6h DL B1,AGR000601,AGR000601,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000601_R1.fastq.gz,fastq,3663991464.0,48210414.0,AGR000601 R1.fastq.gz,0:76,A:1047383844;C:920761577;G:959252939;T:736380253;N:212851,76,,,,1047383844,920761577,959252939,736380253,212851,SRX5574143,SRS4536697,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.00056,,0.00017,,0.99868,,0.34782,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51339,SRR8784150,SRX5574141,SRS4536704,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT TinyLNA430 6h DL B2,RESA WT TinyLNA430 6h DL B2 AGN000468,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection tinyLNA miR 430|molecule:RNA|sample ref:AGS000445|replicate ref:AGN000468|replicate order:2|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT TinyLNA430 6h DL B2,AGR000603,AGR000603,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000603_R1.fastq.gz,fastq,3393300668.0,44648693.0,AGR000603 R1.fastq.gz,0:76,A:969581621;C:868752008;G:809775803;T:744990313;N:200923,76,,,,969581621,868752008,809775803,744990313,200923,SRX5574141,SRS4536704,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.87891,,0.06856,,0.78317,,0.55832,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51354,SRR8784165,SRX5574126,SRS4536688,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT a Am 6h DL B2,RESA WT a Am 6h DL B2 AGN000466,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT a Am 6h DL B2,AGR000599,AGR000599,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000599_R1.fastq.gz,fastq,598577064.0,7876014.0,AGR000599 R1.fastq.gz,0:76,A:173027792;C:152514326;G:149669126;T:123341073;N:24747,76,,,,173027792,152514326,149669126,123341073,24747,SRX5574126,SRS4536688,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.00013,,1e-05,,0.99963,,0.52631,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51355,SRR8784166,SRX5574125,SRS4536697,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT TinyLNA430 6h DL B1,RESA WT TinyLNA430 6h DL B1 AGN000467,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection tinyLNA miR 430|molecule:RNA|sample ref:AGS000445|replicate ref:AGN000467|replicate order:1|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT TinyLNA430 6h DL B1,AGR000600,AGR000600,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000600_R1.fastq.gz,fastq,2926686508.0,38509033.0,AGR000600 R1.fastq.gz,0:76,A:834684269;C:728545827;G:762223876;T:600884916;N:347620,76,,,,834684269,728545827,762223876,600884916,347620,SRX5574125,SRS4536697,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.00012,,1e-05,,0.99969,,0.6,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51363,SRR8784174,SRX5574117,SRS4536690,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT a Am 6h DL B1,RESA WT a Am 6h DL B1 AGN000465,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000465|replicate order:1|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT a Am 6h DL B1,AGR000593,AGR000593,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000593_R1.fastq.gz,fastq,169214000.0,2226500.0,AGR000593 R1.fastq.gz,0:76,A:48502801;C:44879333;G:42196735;T:33629068;N:6063,76,,,,48502801,44879333,42196735,33629068,6063,SRX5574117,SRS4536690,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.75523,,0.05708,,0.79868,,0.56487,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51364,SRR8784175,SRX5574116,SRS4536690,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT a Am 6h DL B1,RESA WT a Am 6h DL B1 AGN000465,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000465|replicate order:1|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT a Am 6h DL B1,AGR000594,AGR000594,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000594_R1.fastq.gz,fastq,2077622488.0,27337138.0,AGR000594 R1.fastq.gz,0:76,A:611435382;C:538245690;G:522186419;T:402325956;N:3429041,76,,,,611435382,538245690,522186419,402325956,3429041,SRX5574116,SRS4536690,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.00012,,1e-05,,0.99965,,0.58823,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-03-25,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51365,SRR8784176,SRX5574115,SRS4536690,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT a Am 6h DL B1,RESA WT a Am 6h DL B1 AGN000465,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000465|replicate order:1|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT a Am 6h DL B1,AGR000592,AGR000592,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000592_R1.fastq.gz,fastq,3782773916.0,49773341.0,AGR000592 R1.fastq.gz,0:76,A:1114409153;C:956769643;G:933746978;T:777498217;N:349925,76,,,,1114409153,956769643,933746978,777498217,349925,SRX5574115,SRS4536690,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.88163,,0.07197,,0.78376,,0.48999,,76,,B,,usable mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51366,SRR8784177,SRX5574114,SRS4536688,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT a Am 6h DL B2,RESA WT a Am 6h DL B2 AGN000466,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT a Am 6h DL B2,AGR000595,AGR000595,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000595_R1.fastq.gz,fastq,3181198120.0,41857870.0,AGR000595 R1.fastq.gz,0:76,A:916117551;C:764906267;G:794289368;T:705583699;N:301235,76,,,,916117551,764906267,794289368,705583699,301235,SRX5574114,SRS4536688,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.0001,,1e-05,,0.99969,,0.53333,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51367,SRR8784178,SRX5574113,SRS4536688,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT a Am 6h DL B2,RESA WT a Am 6h DL B2 AGN000466,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT a Am 6h DL B2,AGR000596,AGR000596,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000596_R1.fastq.gz,fastq,379188776.0,4989326.0,AGR000596 R1.fastq.gz,0:76,A:110241873;C:94609649;G:95730118;T:78592018;N:15118,76,,,,110241873,94609649,95730118,78592018,15118,SRX5574113,SRS4536688,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.00012,,0.0,,0.99963,,0.55555,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51368,SRR8784179,SRX5574112,SRS4536688,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT a Am 6h DL B2,RESA WT a Am 6h DL B2 AGN000466,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT a Am 6h DL B2,AGR000597,AGR000597,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000597_R1.fastq.gz,fastq,685459276.0,9019201.0,AGR000597 R1.fastq.gz,0:76,A:197858582;C:171590312;G:173902727;T:142090788;N:16867,76,,,,197858582,171590312,173902727,142090788,16867,SRX5574112,SRS4536688,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,0.00018,,4e-05,,0.99957,,0.31818,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 51369,SRR8784180,SRX5574111,SRS4536688,SRP189389,PRJNA528980,Genome wide analysis of three prime UTR sequence elements and proteins regulating mRNA stability during maternal to zygotic transition in zebrafish: RESA,PRJNA528980,Other,Post transcriptional regulation plays a crucial role in shaping gene expression. During the Maternal to Zygotic Transition MZT thousands of maternal transcripts are regulated however how different cis elements and trans factors are integrated to determine mRNA stability is still poorly understood. Here we show that most transcripts are under combinatorial regulation by multiple decay pathways during zebrafish MZT. Using a massively parallel reporter assay we identified cis regulatory sequences in the three prime UTR including poly U motifs that are associated with mRNA stability. In contrast miR 430 target sequences UAUUUAUU AU rich elements ARE CCUC and CUGC elements emerged as destabilizing motifs with miR 430 and AREs causing mRNA deadenylation upon genome activation. We identified trans factors by profiling RNA protein interactions and found that poly U binding proteins are preferentially associated with three prime UTR sequences and stabilizing motifs. We demonstrate that this activity is antagonized by poly C motifs and correlated with protein binding. Finally we integrated these regulatory motifs into a machine learning model that predicts reporter mRNA stability in vivo.This is the RESA libraries part of the study.,,,,RESA WT a Am 6h DL B2,RESA WT a Am 6h DL B2 AGN000466,,strain:TU/AB|age:6|sex:pooled male and female|tissue:embryo|treatment:transcriptome 6h aAm AGN000129 injection alpha am|molecule:RNA|sample ref:AGS000444|replicate ref:AGN000466|replicate order:2|BioSampleModel:Model organism or animal,,,,,,,,,RESA WT a Am 6h DL B2,AGR000598,AGR000598,RNA,,,OTHER,TRANSCRIPTOMIC,unspecified,SINGLE,ILLUMINA,Illumina HiSeq 2000,,SRP189389,,,AGR000598_R1.fastq.gz,fastq,83271604.0,1095679.0,AGR000598 R1.fastq.gz,0:76,A:24099348;C:20368786;G:21051352;T:17745573;N:6545,76,,,,24099348,20368786,21051352,17745573,6545,SRX5574111,SRS4536688,SRA865803,Yale_Giraldez|Genetics,Yale_Giraldez_Group,1,8e-05,,3e-05,,0.99983,,0.5,,76,,T,,under 1.2% mapping rate,illumina,hiseq_era,unknown,unknown,unknown,bulk,unknown,unknown,,United States,2019-05-31,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 70582,SRR20001185,SRX16042033,SRS13721701,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 8h 3,GSM6300339,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,zf library 8h 3,Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300339,GSM6300339: zf library 8h 3; Danio rerio; OTHER,GSM6300339 r1,GSM6300339,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_8h_3_1.fastq.gz zf_library_8h_3_2.fastq.gz,fastq fastq,885299088.0,1763544.0,GSM6300339 r1,0:251 1:251,A:222214043;C:219331579;G:228248922;T:215275916;N:228628,251,251,,,222214043,219331579,228248922,215275916,228628,SRX16042033,SRS13721701,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 70583,SRR20001186,SRX16042032,SRS13721700,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 8h 2,GSM6300338,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,zf library 8h 2,Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300338,GSM6300338: zf library 8h 2; Danio rerio; OTHER,GSM6300338 r1,GSM6300338,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_8h_2_1.fastq.gz zf_library_8h_2_2.fastq.gz,fastq fastq,869922828.0,1732914.0,GSM6300338 r1,0:251 1:251,A:218951651;C:214394584;G:224473321;T:211879293;N:223979,251,251,,,218951651,214394584,224473321,211879293,223979,SRX16042032,SRS13721700,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 70584,SRR20001187,SRX16042031,SRS13721699,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 8h 1,GSM6300337,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,zf library 8h 1,Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:8h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300337,GSM6300337: zf library 8h 1; Danio rerio; OTHER,GSM6300337 r1,GSM6300337,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_8h_1_1.fastq.gz zf_library_8h_1_2.fastq.gz,fastq fastq,895219612.0,1783306.0,GSM6300337 r1,0:251 1:251,A:224849175;C:221105420;G:230877700;T:218157114;N:230203,251,251,,,224849175,221105420,230877700,218157114,230203,SRX16042031,SRS13721699,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 70585,SRR20001188,SRX16042030,SRS13721698,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 5h 3,GSM6300336,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,zf library 5h 3,Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300336,GSM6300336: zf library 5h 3; Danio rerio; OTHER,GSM6300336 r1,GSM6300336,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_5h_3_1.fastq.gz zf_library_5h_3_2.fastq.gz,fastq fastq,872893162.0,1738831.0,GSM6300336 r1,0:251 1:251,A:220087290;C:215314493;G:223004894;T:214259861;N:226624,251,251,,,220087290,215314493,223004894,214259861,226624,SRX16042030,SRS13721698,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 70586,SRR20001189,SRX16042029,SRS13721697,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 5h 2,GSM6300335,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,zf library 5h 2,Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300335,GSM6300335: zf library 5h 2; Danio rerio; OTHER,GSM6300335 r1,GSM6300335,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_5h_2_1.fastq.gz zf_library_5h_2_2.fastq.gz,fastq fastq,842675272.0,1678636.0,GSM6300335 r1,0:251 1:251,A:212323691;C:207621938;G:216058999;T:206458094;N:212550,251,251,,,212323691,207621938,216058999,206458094,212550,SRX16042029,SRS13721697,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 70587,SRR20001190,SRX16042028,SRS13721696,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 5h 1,GSM6300334,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,zf library 5h 1,Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:5h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300334,GSM6300334: zf library 5h 1; Danio rerio; OTHER,GSM6300334 r1,GSM6300334,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_5h_1_1.fastq.gz zf_library_5h_1_2.fastq.gz,fastq fastq,851971810.0,1697155.0,GSM6300334 r1,0:251 1:251,A:214612692;C:209910896;G:219013172;T:208215928;N:219122,251,251,,,214612692,209910896,219013172,208215928,219122,SRX16042028,SRS13721696,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 70588,SRR20001191,SRX16042027,SRS13721695,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 2h 3,GSM6300333,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,zf library 2h 3,Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300333,GSM6300333: zf library 2h 3; Danio rerio; OTHER,GSM6300333 r1,GSM6300333,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_2h_3_1.fastq.gz zf_library_2h_3_2.fastq.gz,fastq fastq,1056027782.0,2103641.0,GSM6300333 r1,0:251 1:251,A:266201946;C:259901869;G:270474572;T:259174077;N:275318,251,251,,,266201946,259901869,270474572,259174077,275318,SRX16042027,SRS13721695,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 70589,SRR20001192,SRX16042026,SRS13721694,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 2h 2,GSM6300332,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,zf library 2h 2,Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300332,GSM6300332: zf library 2h 2; Danio rerio; OTHER,GSM6300332 r1,GSM6300332,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_2h_2_1.fastq.gz zf_library_2h_2_2.fastq.gz,fastq fastq,947154022.0,1886761.0,GSM6300332 r1,0:251 1:251,A:238912401;C:233180719;G:242163235;T:232651663;N:246004,251,251,,,238912401,233180719,242163235,232651663,246004,SRX16042026,SRS13721694,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,1e-05,0.0,0.0,0.0,0.99997,1.0,1.0,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 70590,SRR20001193,SRX16042025,SRS13721693,SRP385134,PRJNA856272,Synonymous codon massive reporter library in zebrafish embryos,GSE207584,Transcriptome Analysis,Messenger RNA mRNA stability substantially impacts steady state gene expression levels in a cell. mRNA stability is strongly affected by codon composition in a translation dependent manner across species through a mechanism termed codon optimality. We have developed iCodon www.iCodon.org an algorithm for customizing mRNA expression through the introduction of synonymous codon substitutions into the coding sequence. iCodon is optimized for four vertebrate transcriptomes: mouse human frog and fish. Users can predict the mRNA stability of any coding sequence based on its codon composition and subsequently generate more stable optimized or unstable deoptimized variants encoding for the same protein. Further we show that codon optimality predictions correlate with both mRNA stability using a massive reporter library and expression levels using fluorescent reporters and analysis of endogenous gene expression in zebrafish embryos and/or human cells. Therefore iCodon will benefit basic biological research as well as a wide range of applications for biotechnology and biomedicine. Overall design: We designed a library of 1 600 sequences containing 100 different 100 amino acid long coding sequences capturing the average composition of the zebrafish proteome with 10 variants each designed using iCodon to have 5 bins of increasing predicted stability with 2 sequences in each bin. The groups were referred as iCodon 1 iCodon 2 iCodon 3 iCodon 4 and iCodon 5 from less to more stable mRNA predictions. Additionally 5 synonymous sequences were designed using 5 independent iterations of IDT's codon optimization tool and 1 synonymous sequence using Genewiz's codon optimization tool as this method returned the exact same sequences in each independent run. These sequences were cloned downstream of 11 fixed codons to control for similar translation initiation and the reporters contain constant five prime and three prime UTR sequences. 1395 of the 1600 designed sequences were ordered in vitro synthetized mRNA was injected into 1 cell stage zebrafish embryos and the mRNA decay post 2 5 and 8 hours post injection was calculated by targeted RNA sequencing.,,pubmed:35840631,,zf library 2h 1,GSM6300331,,source name:Zebrafish embryo|tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,zf library 2h 1,Paired end reads were merged with FLASH using default parameters reads that could not be merged were discarded. Next using Cutadapt the constant regions 5’ = ATGGTGAGCAAGGGCGAGGAGCTGTCCCTCGAG and 3’ = TCTAGATAG were removed to keep only the library variable region. Reads without xxx regions were discarded. Then reads were separated by length read length = 297 expected length based on sequence design and mapped them to the library with salmon to quantify expression at each time point Mapped reads represent the perfect sequences that we designed. Then the reads that were not mapped read length = 297 nucleotide substitutions were merged with the reads that have a different sequence length read length < 297 or > 297 insertions and/or deletions. All these reads were called the “imperfect” set. The constant regions that were removed in the first steps of the analysis were added back and therefore every unique read contains a coding sequence which starts in the first ATG start codon. The codon composition was counted as consecutive triplet until it finds a stop codon. The occurrences of each unique read were counted at every time point to calculate transcript abundance transcripts per million. Assembly: reference.fasta Supplementary files format and content: csv files include TPM values for each sample Library strategy: Targeted Deep Sequencing,Zebrafish embryo,10 pg of library mRNA were injected into 1 cell stage zebrafish embryos in 3 independent replicates. Each replicate utilized an independent needle injection mix and breeding. 25 embryos were collected at 2 5 and 8 hours post injection,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer’s protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer’s protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the 3’ Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in. ,,tissue:Zebrafish embryo|time point:2h|genotype:WT|treatment:Injected zebrafish embryos,GSM6300331,GSM6300331: zf library 2h 1; Danio rerio; OTHER,GSM6300331 r1,GSM6300331,1,Injected zebrafish embryos were collected in Buffer RLT QIAGEN RNeasy kit followed by vortexing for 1 min and stored at 70°C until extraction. RNA was thawed at 37°C extracted following the manufacturer's protocol and eluted in 50 μL. mRNA was isolated with Dynabeads oligo dT mRNA purification kit following the manufacturer's protocol. mRNA was eluted in 10 μl of 10 mM Tris HCl pH 7.5. 5 μL of purified mRNA were used for cDNA synthesis using the SuperScript IV Reverse Transcriptase kit utilizing a specific oligo that binds to the three prime Illumina adapter GTAGTGACTGGAGTTCAGAC. The cDNA was cleaned with the Qiagen MinElute PCR purification kit and eluted in 20 μL of water. We tested different PCR cycles to amplify the library using specific oligos that target the surrounding Illumina adapters. We selected 16 cycles for the samples at 2 and 5 hpi and 18 cycles for 8 hpi. The barcoded libraries were cleaned using AMPure XP beads and resuspended in 20 μL of buffer EB Qiagen. The libraries were sequenced in an Illumina MiSeq instrument 250bp pair end with 10% of PhiX as spike in.,,OTHER,TRANSCRIPTOMIC,other,PAIRED,ILLUMINA,Illumina MiSeq,,SRP385134,,,zf_library_2h_1_1.fastq.gz zf_library_2h_1_2.fastq.gz,fastq fastq,896725612.0,1786306.0,GSM6300331 r1,0:251 1:251,A:225772798;C:221066817;G:229953803;T:219699756;N:232438,251,251,,,225772798,221066817,229953803,219699756,232438,SRX16042025,SRS13721693,SRA1449828,Stowers Institute for Medical Research,Stowers Institute for Medical Research,2,0.0,0.0,0.0,0.0,1.0,1.0,,,251,251,T,T,mates < 9% mapping rate,illumina,miseq,unknown,poly_a,unknown,bulk,unknown,unknown,,United States,2022-07-06,Undetermined,Embryo,Embryo Imprecise,All anatomical structures 71064,SRR21218373,SRX17229104,SRS14795570,SRP394145,PRJNA872137,The Translation Initiation Factor Homolog eif4e1c Regulates Cardiomyocyte Metabolism and Proliferation During Heart Regeneration.,GSE211793,Other,The?eIF4E family of translation initiation factors bind five prime methylated caps and act as the limiting step for mRNA translation. The canonical eIF4E1A is required for cell viability yet other related families exist and are all utilized in specific contexts or tissues. Here we describe a new family called Eif4e1c that is ancestral to the canonical eIF4E1A in vertebrates and for which we find roles during heart development and regeneration in zebrafish.?The Eif4e1c family is present in all aquatic vertebrates but has been lost in all terrestrial species. A core group of amino acids shared over 500 million yrs of evolution from?ray finned fish to sharks?forms an evolutionarily conserved binding interface along the surface of the protein suggesting Eif4e1c functions in a novel pathway.? Deletion of eif4e1c?in zebrafish caused growth deficits and impaired survival in juveniles.?Mutants surviving to maturity had fewer cardiomyocytes while also showing reduced proliferative responses to cardiac injury. Ribosome profiling of mutant hearts demonstrated changes in translation efficiency of mRNA for genes known to regulate cardiomyocyte proliferation. Although?eif4e1c?is expressed in many tissues and is the predominant cap binding initiation homolog in embryos its disruption had most notable impact on the heart and at juvenile stages. ?Our findings reveal context dependent requirements for translation initiation regulators during heart regeneration. Overall design: Ribosome profiling of adult uninjured eif4e1c zebrafish mutant hearts and adult uninjured EK zebrafish wildtype hearts.,,pubmed:37306388,,zebrafish Ribo seq Eif4e1c / rep2 [r mR2],GSM6502516,,source name:heart|tissue:heart|cell line:Mutant|genotype:Eif4e1c / ,zebrafish Ribo seq Eif4e1c / rep2 [r mR2],Fastq files were processed using FastQC v0.11.8; RRID:SCR 014583 for quality control QC analysis. Pre processing of sequencing reads was based on the QC report using the FASTQ Quality Filter module in the FASTX Toolkit RRID:SCR 019035. This was used to filter the bases with 99% accuracy based on Q Score. Reads were removed that showed less than 70% of nucleotides with an accuracy of at least 99%. The sequences were collapsed according to their by Unique Molecular Identifiers UMIs. Cutadapt RRID:SCR 011841 was used to trim 21 nt adaptor before the first nt and the last 4 nt from the reads to remove the UMI. The processed reads were aligned to GRCz11/danRer11 assembly of the zebrafish genome; Genome Reference Consortium using STAR v2.5.3a RRID:SCR 004463. Generated bam files were processed with RiboProfiling package v1.2.2. Coverage counts on the coding regions CDS were obtained for each sample based on RiboProfiling function modules TxDb.Drerio.UCSC.danRer11.refGene v3.4.6; Annotation package for TxDb objects; Team BC 2019 and GenomicFeatures package v1.46.1. Differential expression analysis was performed using the DESeq2 pipeline version 1.26.0 based on the expressed raw reads. Assembly: GRCz11/danRer11 Library strategy: Ribo seq,heart,,The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer’s instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3,Zebrafish used for ribosome profiling were grown together under normal conditions and were genotyped upon reaching maturity.,tissue:heart|cell line:Mutant|genotype:Eif4e1c / ,GSM6502516,GSM6502516: zebrafish Ribo seq Eif4e1c / rep2 [r mR2]; Danio rerio; OTHER,GSM6502516 r1,GSM6502516,1,The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer's instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 550,,SRP394145,,,rS4_mR2.fastq.gz,fastq,6611131472.0,86988572.0,GSM6502516 r1,0:76 1:0,A:1748359123;C:1658689534;G:1706027528;T:1497702781;N:352506,76,0,,,1748359123,1658689534,1706027528,1497702781,352506,SRX17229104,SRS14795570,SRA1485233,"Biological Chemistry and Pharmacology, The Ohio State University","Biological Chemistry and Pharmacology, The Ohio State University",1,0.0,,0.0,,1.0,,,,76,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,United States,2022-08-22,Undetermined,Multi-stage,Heart,Cardiovascular System 71065,SRR21218374,SRX17229103,SRS14795569,SRP394145,PRJNA872137,The Translation Initiation Factor Homolog eif4e1c Regulates Cardiomyocyte Metabolism and Proliferation During Heart Regeneration.,GSE211793,Other,The?eIF4E family of translation initiation factors bind five prime methylated caps and act as the limiting step for mRNA translation. The canonical eIF4E1A is required for cell viability yet other related families exist and are all utilized in specific contexts or tissues. Here we describe a new family called Eif4e1c that is ancestral to the canonical eIF4E1A in vertebrates and for which we find roles during heart development and regeneration in zebrafish.?The Eif4e1c family is present in all aquatic vertebrates but has been lost in all terrestrial species. A core group of amino acids shared over 500 million yrs of evolution from?ray finned fish to sharks?forms an evolutionarily conserved binding interface along the surface of the protein suggesting Eif4e1c functions in a novel pathway.? Deletion of eif4e1c?in zebrafish caused growth deficits and impaired survival in juveniles.?Mutants surviving to maturity had fewer cardiomyocytes while also showing reduced proliferative responses to cardiac injury. Ribosome profiling of mutant hearts demonstrated changes in translation efficiency of mRNA for genes known to regulate cardiomyocyte proliferation. Although?eif4e1c?is expressed in many tissues and is the predominant cap binding initiation homolog in embryos its disruption had most notable impact on the heart and at juvenile stages. ?Our findings reveal context dependent requirements for translation initiation regulators during heart regeneration. Overall design: Ribosome profiling of adult uninjured eif4e1c zebrafish mutant hearts and adult uninjured EK zebrafish wildtype hearts.,,pubmed:37306388,,zebrafish Ribo seq Eif4e1c / rep 1 [r mR1],GSM6502515,,source name:heart|tissue:heart|cell line:Mutant|genotype:Eif4e1c / ,zebrafish Ribo seq Eif4e1c / rep 1 [r mR1],Fastq files were processed using FastQC v0.11.8; RRID:SCR 014583 for quality control QC analysis. Pre processing of sequencing reads was based on the QC report using the FASTQ Quality Filter module in the FASTX Toolkit RRID:SCR 019035. This was used to filter the bases with 99% accuracy based on Q Score. Reads were removed that showed less than 70% of nucleotides with an accuracy of at least 99%. The sequences were collapsed according to their by Unique Molecular Identifiers UMIs. Cutadapt RRID:SCR 011841 was used to trim 21 nt adaptor before the first nt and the last 4 nt from the reads to remove the UMI. The processed reads were aligned to GRCz11/danRer11 assembly of the zebrafish genome; Genome Reference Consortium using STAR v2.5.3a RRID:SCR 004463. Generated bam files were processed with RiboProfiling package v1.2.2. Coverage counts on the coding regions CDS were obtained for each sample based on RiboProfiling function modules TxDb.Drerio.UCSC.danRer11.refGene v3.4.6; Annotation package for TxDb objects; Team BC 2019 and GenomicFeatures package v1.46.1. Differential expression analysis was performed using the DESeq2 pipeline version 1.26.0 based on the expressed raw reads. Assembly: GRCz11/danRer11 Library strategy: Ribo seq,heart,,The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer’s instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3,Zebrafish used for ribosome profiling were grown together under normal conditions and were genotyped upon reaching maturity.,tissue:heart|cell line:Mutant|genotype:Eif4e1c / ,GSM6502515,GSM6502515: zebrafish Ribo seq Eif4e1c / rep 1 [r mR1]; Danio rerio; OTHER,GSM6502515 r1,GSM6502515,1,The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer's instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 550,,SRP394145,,,rS3_mR1.fastq.gz,fastq,13677356644.0,179965219.0,GSM6502515 r1,0:76 1:0,A:3346749848;C:3412648254;G:3629003006;T:3288222747;N:732789,76,0,,,3346749848,3412648254,3629003006,3288222747,732789,SRX17229103,SRS14795569,SRA1485233,"Biological Chemistry and Pharmacology, The Ohio State University","Biological Chemistry and Pharmacology, The Ohio State University",1,0.0,,0.0,,1.0,,,,76,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,United States,2022-08-22,Undetermined,Multi-stage,Heart,Cardiovascular System 71066,SRR21218377,SRX17229102,SRS14795568,SRP394145,PRJNA872137,The Translation Initiation Factor Homolog eif4e1c Regulates Cardiomyocyte Metabolism and Proliferation During Heart Regeneration.,GSE211793,Other,The?eIF4E family of translation initiation factors bind five prime methylated caps and act as the limiting step for mRNA translation. The canonical eIF4E1A is required for cell viability yet other related families exist and are all utilized in specific contexts or tissues. Here we describe a new family called Eif4e1c that is ancestral to the canonical eIF4E1A in vertebrates and for which we find roles during heart development and regeneration in zebrafish.?The Eif4e1c family is present in all aquatic vertebrates but has been lost in all terrestrial species. A core group of amino acids shared over 500 million yrs of evolution from?ray finned fish to sharks?forms an evolutionarily conserved binding interface along the surface of the protein suggesting Eif4e1c functions in a novel pathway.? Deletion of eif4e1c?in zebrafish caused growth deficits and impaired survival in juveniles.?Mutants surviving to maturity had fewer cardiomyocytes while also showing reduced proliferative responses to cardiac injury. Ribosome profiling of mutant hearts demonstrated changes in translation efficiency of mRNA for genes known to regulate cardiomyocyte proliferation. Although?eif4e1c?is expressed in many tissues and is the predominant cap binding initiation homolog in embryos its disruption had most notable impact on the heart and at juvenile stages. ?Our findings reveal context dependent requirements for translation initiation regulators during heart regeneration. Overall design: Ribosome profiling of adult uninjured eif4e1c zebrafish mutant hearts and adult uninjured EK zebrafish wildtype hearts.,,pubmed:37306388,,zebrafish Ribo seq Eif4e1c +/+ rep 2 [r pR2],GSM6502514,,source name:heart|tissue:heart|cell line:Wt|genotype:Eif4e1c +/+,zebrafish Ribo seq Eif4e1c +/+ rep 2 [r pR2],Fastq files were processed using FastQC v0.11.8; RRID:SCR 014583 for quality control QC analysis. Pre processing of sequencing reads was based on the QC report using the FASTQ Quality Filter module in the FASTX Toolkit RRID:SCR 019035. This was used to filter the bases with 99% accuracy based on Q Score. Reads were removed that showed less than 70% of nucleotides with an accuracy of at least 99%. The sequences were collapsed according to their by Unique Molecular Identifiers UMIs. Cutadapt RRID:SCR 011841 was used to trim 21 nt adaptor before the first nt and the last 4 nt from the reads to remove the UMI. The processed reads were aligned to GRCz11/danRer11 assembly of the zebrafish genome; Genome Reference Consortium using STAR v2.5.3a RRID:SCR 004463. Generated bam files were processed with RiboProfiling package v1.2.2. Coverage counts on the coding regions CDS were obtained for each sample based on RiboProfiling function modules TxDb.Drerio.UCSC.danRer11.refGene v3.4.6; Annotation package for TxDb objects; Team BC 2019 and GenomicFeatures package v1.46.1. Differential expression analysis was performed using the DESeq2 pipeline version 1.26.0 based on the expressed raw reads. Assembly: GRCz11/danRer11 Library strategy: Ribo seq,heart,,The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer’s instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3,Zebrafish used for ribosome profiling were grown together under normal conditions and were genotyped upon reaching maturity.,tissue:heart|cell line:Wt|genotype:Eif4e1c +/+,GSM6502514,GSM6502514: zebrafish Ribo seq Eif4e1c +/+ rep 2 [r pR2]; Danio rerio; OTHER,GSM6502514 r1,GSM6502514,1,The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer's instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 550,,SRP394145,,,rS2_pR2.fastq.gz,fastq,8919983048.0,117368198.0,GSM6502514 r1,0:76 1:0,A:2208663451;C:2257902067;G:2371468879;T:2081476473;N:472178,76,0,,,2208663451,2257902067,2371468879,2081476473,472178,SRX17229102,SRS14795568,SRA1485233,"Biological Chemistry and Pharmacology, The Ohio State University","Biological Chemistry and Pharmacology, The Ohio State University",1,1e-05,,0.0,,0.99997,,1.0,,76,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,United States,2022-08-22,Undetermined,Multi-stage,Heart,Cardiovascular System 71067,SRR21218378,SRX17229101,SRS14795567,SRP394145,PRJNA872137,The Translation Initiation Factor Homolog eif4e1c Regulates Cardiomyocyte Metabolism and Proliferation During Heart Regeneration.,GSE211793,Other,The?eIF4E family of translation initiation factors bind five prime methylated caps and act as the limiting step for mRNA translation. The canonical eIF4E1A is required for cell viability yet other related families exist and are all utilized in specific contexts or tissues. Here we describe a new family called Eif4e1c that is ancestral to the canonical eIF4E1A in vertebrates and for which we find roles during heart development and regeneration in zebrafish.?The Eif4e1c family is present in all aquatic vertebrates but has been lost in all terrestrial species. A core group of amino acids shared over 500 million yrs of evolution from?ray finned fish to sharks?forms an evolutionarily conserved binding interface along the surface of the protein suggesting Eif4e1c functions in a novel pathway.? Deletion of eif4e1c?in zebrafish caused growth deficits and impaired survival in juveniles.?Mutants surviving to maturity had fewer cardiomyocytes while also showing reduced proliferative responses to cardiac injury. Ribosome profiling of mutant hearts demonstrated changes in translation efficiency of mRNA for genes known to regulate cardiomyocyte proliferation. Although?eif4e1c?is expressed in many tissues and is the predominant cap binding initiation homolog in embryos its disruption had most notable impact on the heart and at juvenile stages. ?Our findings reveal context dependent requirements for translation initiation regulators during heart regeneration. Overall design: Ribosome profiling of adult uninjured eif4e1c zebrafish mutant hearts and adult uninjured EK zebrafish wildtype hearts.,,pubmed:37306388,,zebrafish Ribo seq Eif4e1c +/+ rep 1 [r pR1],GSM6502513,,source name:heart|tissue:heart|cell line:Wt|genotype:Eif4e1c +/+,zebrafish Ribo seq Eif4e1c +/+ rep 1 [r pR1],Fastq files were processed using FastQC v0.11.8; RRID:SCR 014583 for quality control QC analysis. Pre processing of sequencing reads was based on the QC report using the FASTQ Quality Filter module in the FASTX Toolkit RRID:SCR 019035. This was used to filter the bases with 99% accuracy based on Q Score. Reads were removed that showed less than 70% of nucleotides with an accuracy of at least 99%. The sequences were collapsed according to their by Unique Molecular Identifiers UMIs. Cutadapt RRID:SCR 011841 was used to trim 21 nt adaptor before the first nt and the last 4 nt from the reads to remove the UMI. The processed reads were aligned to GRCz11/danRer11 assembly of the zebrafish genome; Genome Reference Consortium using STAR v2.5.3a RRID:SCR 004463. Generated bam files were processed with RiboProfiling package v1.2.2. Coverage counts on the coding regions CDS were obtained for each sample based on RiboProfiling function modules TxDb.Drerio.UCSC.danRer11.refGene v3.4.6; Annotation package for TxDb objects; Team BC 2019 and GenomicFeatures package v1.46.1. Differential expression analysis was performed using the DESeq2 pipeline version 1.26.0 based on the expressed raw reads. Assembly: GRCz11/danRer11 Library strategy: Ribo seq,heart,,The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer’s instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3,Zebrafish used for ribosome profiling were grown together under normal conditions and were genotyped upon reaching maturity.,tissue:heart|cell line:Wt|genotype:Eif4e1c +/+,GSM6502513,GSM6502513: zebrafish Ribo seq Eif4e1c +/+ rep 1 [r pR1]; Danio rerio; OTHER,GSM6502513 r1,GSM6502513,1,The hearts were lysed on ice with 100ul of lysis buffer with 53 mg/ml cycloheximide using mechanical homogenization with a pestle for thirty seconds. Cells were lysed further by trituration of the sample using a 27.5 gauge needle syringe 20x on ice. Cell extracts average OD 7 were treated with MNase NEB CaCl2 5mM final concentration and Turbo DNAse I Invitrogen at 25°C for 30 minutes. MNase digestion was stopped with SUPERase inhibitor incubation on ice. 80S ribosomes were isolated using SH400 spin columns Cytiva. Columns were prepared according to the manufacturer's instructions. 100 µls of MNase treated sample was loaded per column and centrifuged for 2 min at 600 RCF. The flow through was isolated and incubated for 5 min. with 3x volume of Trizol LS Ambion. 200 µl of chloroform was added and incubated for 2 min. Samples were centrifuged for 15 min. at 12 000 rpm 4°C. The aqueous phase was extracted and precipitated overnight at 20°C using glycoblue ThermoFisher and isopropanol followed by centrifugation for 30 minutes at 4C at 10 000 RPM. Pellets were washed with 75% Ethanol and resuspended into RNase free water. Next Flex smRNA seq kit v3,,OTHER,TRANSCRIPTOMIC,other,SINGLE,ILLUMINA,NextSeq 550,,SRP394145,,,rS1_pR1.fastq.gz,fastq,8551941876.0,112525551.0,GSM6502513 r1,0:76 1:0,A:2015417703;C:2191682962;G:2364697448;T:1979683824;N:459939,76,0,,,2015417703,2191682962,2364697448,1979683824,459939,SRX17229101,SRS14795567,SRA1485233,"Biological Chemistry and Pharmacology, The Ohio State University","Biological Chemistry and Pharmacology, The Ohio State University",1,1e-05,,0.0,,0.99997,,0.0,,76,,T,,under 1.2% mapping rate,illumina,nextseq,unknown,other,unknown,bulk,unknown,unknown,,United States,2022-08-22,Undetermined,Multi-stage,Heart,Cardiovascular System